Background
Epithelial ovarian cancer is the most lethal gynecologic cancer worldwide, and accounts for 4% of all cancers in women [
1,
2]. Despite advances in surgical management and cytotoxic therapy, the overall 5-year survival rate for women with advanced ovarian cancer is just 20% because of a lack of new diagnostic and treatment methods [
3‐
5]. Currently, the recommended management is primary cytoreductive surgery followed by platinum–paclitaxel combination chemotherapy; however, more than 75% of treated patients experience tumor relapse and ultimately die of the disease [
6,
7]. Poor understanding of the mechanism of chemo-resistance in ovarian cancer poses a critical research challenge. Elucidation of the molecular mechanisms underlying the chemo-resistance and recurrence of ovarian cancer is necessary to improve clinical outcomes.
The transcription factor nuclear factor-κB (NF-κB) is activated in multiple cell-survival scenarios, and promotes survival and chemo-resistance in solid-tumor cancers [
8]. The survival cascades initiated by NF-κB are a key component of cellular apoptotic resistance. Reportedly, TGM2-NFKB/NF-κB signaling enhances lymphoma progression in both mice and humans; disruption of this network may increase the efficacy of current therapies and reduce MCL drug resistance [
9]. Peng et al. [
10]found that activation of NF-κB signaling confers chemo-resistance on tongue squamous cell carcinoma cells and promotes their survival, whereas inhibition of NF-κB signaling dramatically reduces the proliferation of oral squamous cell carcinoma cells. Canino and colleagues [
11] showed that the addition of a dual signal transducer and activator of transcription NF-kB inhibitor to cultured pemetrexed-treated and cisplatin-treated mesothelioma cells abolishes their chemo-resistance. Blocking NF-κB signaling using an aurora kinase A inhibitor decreases the proliferation of epithelial ovarian cancer (EOC) stem cells by inducing cell-cycle arrest, which suggests that NF-κB inhibition may prevent recurrence and chemo-resistance in ovarian cancer [
12]. Furthermore, the growth of xenografts of MCF-7TN-R cells is blocked following treatment with ABC294640, a pharmacologic inhibitor of sphingosine kinase-2 that diminishes NF-κB survival signaling through decreased activation of the Ser536 phosphorylation site on the p65 subunit [
13]. These results indicate that pharmacologic inhibition of NF-κB has therapeutic potential for the treatment of therapy resistant breast cancer. The NF-κB pathway may play an important role in chemo-resistance; therefore, the discovery of novel molecules capable of regulating aberrant activation of the NF-κB pathway may facilitate the treatment of chemo-resistant cancers.
GOLPH3L, is a novel gene which highly homologous to Golgi phosphoprotein 3 (GOLPH3), the protein encoded by GOLPH3L localizes to the Golgi stack and may have a regulatory role in Golgi trafficking [
14]. Reportedly, increased expression of GOLPH3L is associated with a poor prognosis in patients with EOC and may act as a novel, useful, and independent prognostic indicator [
15]. Kunigou et al. [
16] showed increased expression of GOLPH3L in human rhabdomyosarcoma, and that GOLPH3L knockdown by short-interfering RNA prevents the proliferation of human rhabdomyosarcoma cell lines. These findings suggest that GOLPH3L repression may be an effective treatment for rhabdomyosarcoma. Although the two isoforms are highly homologous in their amino-acid sequences and GOLPH3 is upregulated in various malignancies, the function and mechanism of action of GOLPH3L in cancer, particularly in ovarian cancer, were rarely reported.
In this study, we demonstrate that GOLPH3L expression is significantly upregulated in cisplatin-resistant ovarian cancer cells and clinical tissues, and is associated with ovarian cancer recurrence. Moreover, we show that GOLPH3L overexpression enhances cisplatin resistance, and that GOLPH3L silencing restores the sensitivity of ovarian cancer cells to cisplatin, through regulation of the NF-κB signaling pathway. Our findings suggest that GOLPH3L plays a critical oncogenic role in ovarian cancer progression, and highlight its potential as a therapeutic target for overcoming cisplatin resistance in ovarian cancer therapy.
Materials & methods
Cell lines and cell culture.
Immortalized normal ovarian surface epithelial cell line (IOSE80) was purchased from Shanghai Ai Rui Biological Technology Co., Ltd., this cells were grown in 1:1 combination of two media, Medium 199 (Invitrogen) and MCDB 105 (Cell Applications Inc., San Diego, CA) with 10% FBS in a humidified atmosphere containing 5% CO2 at 37 °C. The ovarian cancer cell lines, including SKOV3, CAOV3, OV56, A2780, A2780/cis, COV362, EFO-27, TOV21G, EFO-21 and OV90 was purchased from The European Collection of Authenticated Cell Cultures (ECACC), were grown in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen), at 37 °C in a 5% CO2 atmosphere in a humidified incubator. A2780/cis was grown in RPMI 1640 + 2 mM Glutamine +1 μM cisplatin +10% Foetal Bovine Serum (FBS), at 37 °C in a 5% CO2 atmosphere in a humidified incubator. All cell lines were authenticated by short tandem repeat (STR) fingerprinting at Medicine Lab of Forensic Medicine Department of Sun Yat-Sen University (Guangzhou, China).
A total of 177 paraffin-embedded and archived ovarian cancer samples, which were histopathologically and clinically diagnosed at the First Affiliated Hospital, Sun Yat-sen University from 2005 to 2010, were examined in this study. Clinical information on the samples is summarized in Additional file
1: Table S1. All tumors were staged according to the International Federation of Gynaecology and Obstetrics standards (FIGO). Ten freshly collected ovarian cancer tissues were frozen and stored in liquid nitrogen until further use. Prior patient consent and approval from the Institutional Research Ethics Committee were obtained for the use of these clinical materials for research purposes.
Vectors, retroviral infection and transfection
A GOLPH3L expression construct was generated by subcloning PCR-amplied full-length human GOLPH3L cDNA into the pMSCV retrovirus plasmid, and human GOLPH3L-targeting short hairpin RNA (shRNA) oligonucleotides sequences were cloned into pSuper-retro-puro to generate pSuper-retro-GOLPH3L-RNAi(s). The shRNA sequences were: RNAi#1, GOLPH3L; and RNAi#2, TATAATGGTCAAGGTCTATGG (synthesized by Invitrogen). pNF-κB-luc and control plasmids (Clontech) were used to examine NF-κB activity. pBabe-Puro-IκBα-mut (plasmid#15291) expressing IκBα dominant-negative mutant (IκBα-mut) was purchased from Addgene (Cambridge, MA). Transfection of siRNA or plasmids was performed using the Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruction. Stable cell lines expressing GOLPH3L or GOLPH3L RNAi were selected for 10 days with 0.5 μg/ml puromycin 48 h after infection.
Western blot analysis
Western blot was performed using anti- GOLPH3L (Abcam, 1:500), anti-p-IκBα, IκBα and anti-p-IKKβ, IKKβ, anti-p65, anti-p84 antibodies (Cell Signaling, Danvers, MA, USA). The membranes were stripped and re-probed with an anti-α-tubulin antibody (Sigma, Saint Louis, MI) as a loading control.
Xenografted tumor model, IHC, and H&E staining
In the subcutaneous tumor model, the BALB/c nude mice were randomly divided into four groups (n = 6/group). Four groups of mice were inoculated subcutaneously with 2 × 106 A2780-Vector, A2780- GOLPH3L, A2780-cis/shRNA-Vector, A2780-cis/ GOLPH3L -shRNA#1 cells, respectively, in the left dorsal flank per mouse. Mice bearing established A2780 xenograft were established as mentioned above. After xenografts reached 0.5 cm in diameter, CDDP (5 mg/kg) was given intraperitoneally every 4 days for 28 days. Tumor growth was monitored by measurements of length and width and the tumor volume was calculated using the eq. (L × W2)/2. Tumors were detected by an IVIS imaging system, and animals were euthanized, tumors were excised, weighed and paraffin-embedded. TUNEL assay was performed on paraffin-embedded tissue section according to the manufacturer’s instructions (Promega). Apoptotic index was measured by percentage of TUNEL-positive cells.In the intraperitoneal tumor model, therapeutic effectiveness of GOLPH3L siRNA was evaluated in combination with cisplatin(5 mg/kg, every 4 days for 28 days). The BALB/c nude mice were divided into four groups (10 mice per group). Two groups of mice were inoculated intraperitoneally with 2 × 106 A2780-Vector, A2780- GOLPH3L cells, respectively. Another two groups of mice were intraperitoneally injected with 2 × 106 A2780. Treatment was initiated 21 days after the cell suspension injection, when tumors could be detected by palpation. Mice injected intraperitoneally with 2 × 106 A2780-Vector, A2780- GOLPH3L, A2780-cis/shRNA-Vector, A2780-cis/ GOLPH3L -shRNA#1 cells, respectively treated with CDDP (5 mg/kg) every 4 days for 28 days. Mice bearing established A2780 xenograft were established as mentioned above. Tumors were detected by an IVIS imaging system twice a week. Survival was evaluated from the first day of treatment initiation until death and tumors were excised and paraffin-embedded. Apoptotic index was measured by percentage of TUNEL-positive cells.
Cytotoxicity assay
The sensitivity to cisplatin of ovarian canccer cells was determined using the MTT assay as previously described (Landen CN, et al. Efficacy and antivascular effects of EphA2 reduction with an agonistic antibody in ovarian cancer. J Natl Cancer Inst. 2006; 98(21):1558–1570.). Briefly, 2 × 103 cells were seeded onto 96-well plates and incubated at 37 °C overnight. Cells were then transfected with different concentrations of cisplatin (0–200 μM). After incubation for 72 h, 50 μl of the MTT solution (0.15%) was added to each well, and the plates were further incubated for 2 h. One hundred microliters of DMSO was added to solubilize the MTT formazan product. Absorbance at 540 nm was measured with a Falcon microplate reader (BD-Labware). Dose-response curves were plotted on a semilog scale as the percentage of the control cell number, which was obtained from the sample with no drug exposure. IC50 was determined by the intersection of the cisplatin concentration and the midpoint of the 570-nm reading.
Apoptosis assay
For evaluation of apoptosis, PE Annexin V Apoptosis Detection Kit I (BD Pharmingen) was used. Briefly, 1 × 106 ovarian cancer cells were plated in 10-cm plates and incubated for 24 h. Treatment was started with cisplatin (10 μM) for 24 h. Cell morphology was assessed by phase-contrast microscopy. Then, cells were removed from plate by trypsin-EDTA, washed twice with PBS, and resuspended with binding buffer at 106 cells/ml. FITC Annexin V and propidium iodide were added (each at 5 μl/105 cells). Cells were incubated for 15 min at room temperature in the dark. Percentage of apoptosis was analyzed with an EPICS XL flow cytometer (Beckman-Coulter). Each sample was analyzed in triplicate.
Transient luciferase assay
Cells (1 × 104) were seeded in triplicate in 48-well plates and allowed to settle for 24 h. For each transfection, one hundred nanograms of luciferase reporter plasmids pGL-3-GOLPH3L or vector and 5 ng of pRL-TK, expressing Renilla luciferase as an internal control, were transfected into cells using the Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer’s instruction. 48 h after transfection, cells were harvested and Luciferase and renilla signals were measured using the Dual Luciferase Reporter Assay Kit (Promega) according to a protocol provided by the manufacturer. The luciferase activity was normalized by the Renilla luciferase activity of each transfection to normalize the transfection efficiency.
Nuclear and cytoplasmic extraction assay
Nuclear fractions were prepared by using the nuclear extraction kit (Active Motif, Carlsbad, CA). Briefly, after drug treatment, cells were pelleted and lysed by vigorous vortex in hypotonic buffer for 15 min. The samples were then centrifuged at 14,000×g for 1 min; the supernatant was considered cytoplasmic. Insoluble pellets were further lysed in complete lysis buffer for 30 min, and nuclear extracts (supernatant) were collected after a 10-min centrifugation at 14,000×g. Both cytoplasmic and nuclear fractions were quantified and subjected to Western blot analysis.
Statistical analysis
Statistical tests for data analysis included Fisher’s exact test, log-rank test, Chi-square test, and Student’s 2-tailed t test. Multivariate statistical analysis was performed using a Cox regression model. Statistical analyses were performed using the SPSS 11.0 statistical software package. Data represent mean ± SD. P < 0.05 was considered statistically significant.
Microarray data process and visualization
Discussion
Our results provide evidence that GOLPH3L plays an important role in cisplatin resistance in ovarian cancer and the regulation of the NF-κB signaling pathway. GOLPH3L gene expression was substantially increased in cisplatin-resistant cells and GOLPH3L overexpression enhanced cisplatin resistance, but GOLPH3L silencing restored the sensitivity of ovarian cancer cells to cisplatin. Moreover, we found that GOLPH3L enhanced cisplatin resistance by upregulating downstream target genes that regulate the anti-apoptosis effect of the NF-κB signaling pathway both in vitro and in vivo. These findings identify GOLPH3L as a potential target for overcoming cisplatin resistance in patients with ovarian cancer.
Chemo-resistance has a considerable influence on the efficacy of cancer therapy, and involves anti-apoptotic signal-transduction pathways that prevent cell death [
17,
18]. Intrinsic or acquired resistance of cancer to current treatment protocols is associated with apoptosis resistance in cancer cells and treatment failure [
19,
20]. Despite this, the currently recommended management is primary cytoreductive surgery followed by platinum–paclitaxel combination chemotherapy, but more than 75% of treated patients experience tumor relapse. Current and future efforts toward designing new therapies must include strategies that specifically target cancer cell resistance to current chemotherapies [
21,
22]. Therefore, we will discuss the potential roles of small-molecule candidates that target apoptosis signaling to enhance the sensitivity of tumors to conventional cancer therapies and improve the survival and quality of life of cancer patients.
Activation of the transcription factor NF-κB is frequently encountered in tumor cells and contributes to chemoresistance during cancer treatment [
8,
23,
24]. Suppression of NF-κB by genetic or chemical inhibitors induces apoptosis and restores the apoptotic response after treatment with chemotherapeutic agents or radiation in various tumor cells, thus overcoming NF-κB-mediated chemoresistance. It is established that the inhibition of NF-κB activation abolishes tumor chemoresistance [
25‐
29]. Suppression of NF-κB through adenoviral delivery of a modified form of IκBα markedly sensitizes chemoresistant tumors to the apoptotic potential of tumor necrosis factor-α and the chemotherapeutic compound CPT-11, resulting in tumor regression [
30]. Treatment with the proteasome inhibitor MG132 increases the apoptotic effects of etoposide or doxorubicin on Capan-1 and A818–4 cells through the inhibition of NF-κB [
31]. Furthermore, using reporter assays and reverse-transcription PCR analysis, Li et al. [
32] demonstrated that abrogation of NF-κB activation by a dominant-negative IκBα adenoviral construct triggered paclitaxel-induced cell death, suggesting that suppression of the activation of NF-κB blocks paclitaxel-induced apoptotic signaling pathways. In chemoresistant cancer cells, both inhibitors of apoptosis and NF-κB play a pivotal role in preventing apoptosis triggered by a variety of stresses, highlighting them as potential targets for cancer treatment [
33‐
37]. Collectively, these findings establish a strong rationale for therapeutic targeting of the NF-κB pathway in cancer therapy. Although current therapeutic approaches, such as the use of NF-κB or IKK-β inhibitors, may abrogate the cancer-promoting activities of NF-κB, they fail to preserve its pleiotropic physiologic functions in normal cells, such as in immunity and inflammation. Therefore, there is an urgent need to identify more effective therapeutic targets that regulate NF-κB in an appropriate manner as alternatives to global NF-κB blockade. Here, we reported that GOLPH3L expression was significantly upregulated in cisplatin-resistant ovarian cancer and associated with ovarian cancer recurrence. Moreover, GOLPH3L overexpression enhanced cisplatin resistance, but GOLPH3L silencing restored the sensitivity of ovarian cancer cells to cisplatin by regulation of the NF-κB signaling pathway, suggesting that GOLPH3L contributes to ovarian cancer progression and thereby represents a novel target for overcoming cisplatin resistance in ovarian cancer therapy.
GOLPH3L is a GOLPH3 paralog found in all vertebrate genomes. Like GOLPH3, GOLPH3L binds to PI4P, localizes to the Golgi as a consequence of PI4P binding, and is required for efficient anterograde trafficking [
14]. Although the two isoforms are highly homologous in their amino-acid sequences, the function of GOLPH3L has yet to be determined. We showed that GOLPH3L overexpression enhanced the resistance of ovarian cancer cells to cisplatin treatment through regulation of the NF-κB signaling pathway. However, the underlying mechanism by which GOLPH3L activates NF-κB signaling remains unclear. Interestingly, Ting Dai et al. [
38] showed that GOLPH3 promotes K63-linked polyubiquitination of Tumor necrosis factor receptor-associated factor 2, receptor interacting proteins, and NF-κB essential modulator and substantially sustained the activation of NF-κB in hepatocellular carcinoma (HCC) cells. It is likely that GOLPH3L activates NF-κB signaling via the same mechanism as GOLPH3 activation of NF-κB signaling in HCC cells. Therefore, the underlying mechanism by which GOLPH3L activates NF-κB signaling requires further investigation.
Although GOLPH3L is reportedly overexpressed in several cancers, including EOC and human rhabdomyosarcoma, the mechanism of GOLPH3L upregulation in ovarian cancer remains unknown. Interestingly, we found that large amounts of NF-κB were recruited to the promoter region of GOLPH3L, according to chromatin immunoprecipitation sequencing tracks in the University of California Santa Cruz Genome Browser (
http://genome.ucsc.edu/cgi-bin/hgGateway). Furthermore, according to TCGA data, we found that GOLPH3L exhibited a high amplification rate of 61.8% in ovarian cancer, suggesting that the overexpression of GOLPH3L in ovarian cancer is associated with genomic amplification. Further studies are necessary to determine whether GOLPH3L upregulation in ovarian cancer is attributable to genomic amplification or NF-κB-mediated transcriptional upregulation.
In summary, GOLPH3L was markedly upregulated in ovarian cancer cells and clinical ovarian cancer samples, and a positive correlation was evident between GOLPH3L expression and the recurrence-free survival of ovarian cancer patients. Overexpression of GOLPH3L augmented the cisplatin resistance of ovarian cancer both in vitro and in vivo, and activated the NF-κB signaling pathway. Elucidation of the biologic function of GOLPH3L during ovarian cancer progression will advance our knowledge of the mechanisms underlying ovarian cancer chemo-resistance and establish GOLPH3L as a potential therapeutic target for overcoming drug resistance in patients with ovarian cancer.