Background
Nasopharyngeal carcinoma (NPC) is a prevalent malignancy in southern China and throughout Southeast Asia [
1]. Currently, a combination of platinum-based chemotherapy and radiotherapy is the mainstay of treatment for primary and local NPC [
1]. However, 5–10% of all patients and 15–45% of those with stage IV NPC develop locally recurrent disease after treatment, and approximately a quarter of patients in the latter group also develop distant metastases [
2,
3]. Accordingly, the management of advanced NPC, including recurrent, metastatic, and chemoresistant tumors, remains a major challenge. New targeted therapeutic methods that can effectively control NPC at both early and advanced stages of disease are highly sought after as a means of improving survival outcomes.
Currently, the screening and evaluation of novel and potentially effective therapeutic agents against NPC is significantly limited by the lack of a preclinical NPC model. NPC patient-derived xenografts and cell lines are difficult to establish. Although a few such xenografts have been developed for investigation, including XenoC15 and XenoC17 (derived from African NPC patients [
4];) and Xeno2117 and Xeno666 (derived from a Hong Kong NPC patient [
5];), all were established more than 25 years ago and have been passaged continuously in nude mice. As a result, the genetic and pathological properties of these xenografts may have diverged from those of the parental NPC tumors isolated from patients. Only one in vitro Epstein–Barr virus (EBV)–positive NPC cell line (C666–1) is available for investigation [
6], whereas other commonly used “NPC cells” have lost their EBV episomes and may not be representative of NPC [
7]. Furthermore, the detection of HeLa cell’s and HPV18’s genomic materials in these cell lines has cast doubt on the cellular origins [
7] and has limited the applications of these lines in evaluations of novel therapeutic agents against NPC. To address this limitation, we have established new NPC xenografts and cell lines for in vivo and in vitro investigations, including Xeno32 and Xeno76 (xenografts derived from primary NPC [
8];), Xeno23 and NPC43 (a xenograft and cell line respectively derived from recurrent NPC [
8];) and C17 (NPC cell line derived from a xenograft of metastatic NPC [
9];). Together with the conventional NPC cell line C666–1, these newly established NPC xenografts and cell lines represent a comprehensive panel of preclinical NPC models available to assess chemotherapeutic drug efficacy.
The field of targeted therapy for NPC is grossly underdeveloped due to the scarcity of representative preclinical NPC models for novel agent evaluations and our insufficient knowledge of the genomic properties of NPC. Our group and others recently conducted several genomic analyses to define the genetic alterations that contribute to NPC tumorigenesis [
10‐
12] and generated knowledge that will shape the focus of future strategies for NPC therapeutic development [
13]. Currently, the genetic alterations amenable to targeted therapies are heterogenous and present at relatively low rates in NPC. Specifically, mutations in
PIK3CA,
EGFR,
FGFR1/2/3/4, and
BRCA1/
BRCA2/
ATM were identified in only 1.68, 0.24, 2.16, and 1.68% of patients with NPC, respectively [
10,
11,
14,
15].
Research evidence suggests that the aggressive growth and metastatic behaviors of cancer cells depend on the dysregulation of p16–CDK4/6–cyclin D1–RB signaling. In proliferating cells, the suppression of p16 expression relieves the inhibitory effect of this protein on the kinase activity of CDK4/6. The CDK4/6 kinases then form an active complex with cyclin D, which hyper-phosphorylates RB and releases E2F to initiate a cascade of downstream events involved in the transcription of proliferation genes. This process enables the cell to enter the cell cycle. The overexpression of cyclin D1 and downregulation of p16 are common events in NPC, and therefore treatment with a specific CDK4/6 inhibitor could target this essential cell cycle regulatory pathway and improve the druggability of NPC [
16‐
18]. Previously, we detected cyclin D1 overexpression in more than 90% of NPC tumor tissues [
18]. Cyclin D1 is also overexpressed in premalignant and dysplastic nasopharyngeal epithelial (NPE) cells and may play an important role in early NPC pathogenesis by supporting persistent and latent EBV infection in the premalignant nasopharyngeal epithelium [
19]. A whole-exome sequencing analysis of a large cohort of patients with NPC (
N > 100) also identified cyclin D1 amplification and homozygous p16 gene deletion as common features of NPC [
10]. Importantly, the observation that RB mutation is uncommon in NPC suggests that a blockade of CDK4/6 activity could abolish the dependency of this tumor type on the cyclin D1–RB pathway.
In this study, we used a comprehensive panel of NPC models to examine the efficacy of palbociclib, a selective CDK4/6 inhibitor approved by the Food and Drug Administration (FDA), as a treatment for NPC. Palbociclib was initially tested in both in vitro and in vivo models of breast cancer and was shown to effectively inhibit the growth of tumor cells, especially cell lines with increased RB phosphorylation and cyclin D1 expression and decreased p16 expression [
20]. Later, patients with breast cancer were recruited to participate in the human clinical trial PALOMA-2, which demonstrated that palbociclib treatment could prolong the median progression-free survival duration for more than 10 months. In 2016, palbociclib was approved by the FDA for the treatment of hormone receptor–positive, human epidermal growth factor receptor 2–negative advanced or metastatic breast cancer [
21]. The results of preclinical studies in other cancer types, such as hepatocellular carcinoma [
22], ovarian cancer [
23], rhabdoid tumor [
24], and glioblastoma [
25], also indicated that palbociclib effectively targets cancer cells with the following characteristics: (a) cyclin D1 overexpression, (b) functional RB, and (c) p16 inactivation. As described above, the CDK4/6–cyclinD1 axis is often dysregulated in NPCs at all stages, so inhibition of the related activity represents a common target in primary, recurrent, and even metastatic NPC.
In this study, we also examined the therapeutic efficacy of combinations of palbociclib with two other FDA-approved chemotherapeutic drugs, cisplatin and suberanilohydroxamic acid (SAHA). Antagonistic effect was observed in vitro when palbociclib and cisplatin were used together to treat the NPC cells. Interestingly, we observed a synergistic effect when SAHA was combined with palbociclib. SAHA is a histone deacetylase (HDAC) inhibitor that alters gene transcription by inhibiting histone deacetylation and inducing chromatin relaxation, leading to the general expression of genes that encode tumor suppressors [
26]. The synergistic effects of combined treatment with SAHA and palbociclib were also confirmed for the first time in our preclinical NPC xenograft models. Furthermore, transcriptome profiling of SAHA- and palbociclib-treated NPC cells revealed that the synergistic inhibitory actions of these drugs on NPC cells may be related to the activation of autophagy. Finally, we established palbociclib- and cisplatin-resistant cell lines and evaluated the responses of these cells to cisplatin and palbociclib, respectively. Our findings provide essential information to support the design of the first in-human trial of palbociclib therapy for the treatment of NPC.
Materials and methods
Non-malignant NPE and cancerous NPC cell lines
Three telomerase-immortalized, nonmalignant human NPE cell lines (NP361 and NP460) [
19,
27] and one SV40T-immortalized NPE cell line (NP69) [
28] were used as non–cancer cell controls in this study. All NPE cell lines were cultured under the conditions described in our previous publication [
29]. Three EBV-positive NPC cell lines (C666–1, NPC43, and C17) were also used in this study. C666–1 [
6] was established from an NPC xenograft, XenoC666, which is widely used in preclinical studies on NPC. NPC43 [
8] and C17 [
9] were newly established in our laboratory and have been carefully characterized with respect to EBV infection status, genomic profiles, and growth properties. The NPC cell lines were maintained as monolayers in RPMI supplemented with 10% FBS and 1% penicillin/streptomycin, and their responses to palbociclib were evaluated under both two-dimensional (2-D; monolayer) and 3-D (spheroid) culture conditions. For 3-D culture, the NPC cells were seeded in ultra-low attachment plates (Corning, #4520) to enable the formation of floating spheroids.
NPC xenografts
Four-week-old male immunodeficient (NOD/SCID) mice were supplied by the Laboratory Animal Unit (LAU) of The Hong Kong University (HKU) and housed under pathogen-free conditions. All animal experiments were conducted according to the animal license issued by the Hong Kong Department of Health and with the approval of the Committee on the Use of Live Animals in Teaching and Research (CULATR) of HKU. To initiate the growth of NPC cell lines (C17, NPC43, and C666–1 cells) as tumor xenografts in NOD/SCID mice, we resuspended 107 cells in 200 μl of a 1:1 (vol/vol) mixture of Matrigel and culture medium and injected this suspension subcutaneously into the left dorsal flank region of each mouse.
For the three newly established xenografts (Xeno23, Xeno32, and Xeno76) [
8], xenografted tumors were cut into 2 mm
3 blocks and implanted subcutaneously into the left dorsal flank regions of mice. The mice were then randomized into drug treatment or vehicle control groups once the tumors became palpable (i.e., 4-mm diameter). The CDK4/6 inhibitor palbociclib (Pfizer, 571,190–30-2) was dissolved in filtered distilled deionized water (ddH
2O; 7.5 mg/ml) and administered daily to mice via oral gavage at the concentrations stated for each experiment. SAHA (Cayman Chemical, 10,009,929) was dissolved in DMSO to a concentration of 100 mg/ml and administered by intraperitoneal injection (20 μl per mouse). The tumor size and animal body weight were recorded every other day throughout the treatment period. All mice were euthanized at the end of the experiment, and the tumors were excised and fixed with 10% neutral buffered formalin (NBF) before histopathological and immunohistochemical examinations.
For the metastasis model, each NOD/SCID mouse was injected with 106 C666–1 cells via the tail vein, and treatment was initiated 10 days later. The mice were dosed with vehicle or palbociclib continuously for 21 days and left for observation for 124 days. At the end of the study, lung tissues were dissected from the mice, fixed, and processed to examine the presence of growth of C666–1 cells.
Cell viability determination
NPC cells in culture medium were seeded at a density of 4000 cells/well in a 96-well plate (100 μl per well) and incubated overnight. Palbociclib (Selleck Chemicals, S1116) was dissolved in cell culture medium to concentrations of 0–20 μM and added to the NPC cell cultures. The viability of the cells was examined on Days 1, 3 and 5 of culture. SAHA was diluted from a stock solution (100 mg/ml) into culture medium and used at various treatment concentrations (0–0.5 μM). The concentration of DMSO (vehicle) was less than 0.001% in the culture with the highest concentration of SAHA. Cisplatin (Sigma, 479,306) was diluted with dimethylformamide (DMF) to a stock concentration of 40 mM.
A resazurin (Sigma, R7017) stock solution (0.02% w/v dissolved in PBS) was added to the cells (10% v/v) to determine cell viability after drug treatment. After incubation with resazurin for 4 h, the amount of the fluorescent product resorufin in the cultures was measured at excitation/emission wavelengths of 530/590 nm using a Victor 3 Plate Reader (PerkinElmer). Growth inhibition in each well was calculated as: (viabilitycontrol-viabilitydrug) / viabilitycontrol *100%.
Western blot
RIPA lysis buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Nonidet P40, 0.5% deoxycholic acid, 0.1% sodium dodecyl sulfate (SDS)] was supplemented with protease inhibitors (1 tablet/10 ml RIPA buffer; Thermo Scientific, A32961) and PhosSTOP (1 tablet/10 ml RIPA buffer; Roche, 4,906,837,001) immediately prior to use. After lysing the cells in RIPA buffer, the protein concentrations in the samples were measured and adjusted to ensure that equal amounts of protein per sample would be resolved by SDS–polyacrylamide gel electrophoresis. The resolved proteins were then transferred from the gels to PVDF membranes (GE Healthcare, 10,500,023).
The following specific antibodies were used to detect various proteins in the membrane-bound samples: RB (1:1000 dilution; BD, 554136), phosphorylated (phospho)-RB (Ser708) (1:1000; Cell Signaling Technology, 9307S), cyclin A (1:1000; Santa Cruz, sc-751), cyclin B1 (1:1000; Cell Signaling Technology, 4138), cyclin D1 (1:1000; BD Biosciences, 556,470), cyclin D2 (1:1000; BD Biosciences, 3741), cyclin D3 (1:1000; BD Biosciences, 2936), cyclin E1 (1:1000; Cell Signaling Technology, 4129), cyclin E2 (1:1000; Cell Signaling Technology, 4132), Cyclin H (1:1000; BD Biosciences, 2927), cleaved PARP (1:1000; Cell Signaling Technology, 9541S), CDK2 (1:1000; Santa Cruz, SC6248), CDK4 (1:1000; Santa Cruz, SC260), CDK6 (1:1000; Santa Cruz, SC271364), E-cadherin (1:1000; Santa Cruz, SC21791), N-cadherin (1:1000; Santa Cruz, SC7939), caspase 3 (1:1000; Cell Signaling Technology,14,220), cleaved caspase-3 (1:1000; Cell Signaling Technology, 9664), PARP (1:1000; Santa Cruz, SC8007), cleaved PARP (1:1000; Cell Signaling Technology, 9541S), involucrin (1:1000; Thermo Fisher, MS-126-P1ABX), Bcl-2 (1:1000; Cell Signaling Technology, 15071S), Bax (1:1000; Cell Signaling Technology, 5023S), and LC3 (1:1000; Cell Signaling Technology, 2775S). The chemiluminescence signal corresponding to each labeled protein was then captured with the ChemiDoc MP Imaging System (Bio-Rad). A specific antibody against GAPDH (1:10000; Proteintech, 10,494–1-AP) was used as a protein loading control.
Cell cycle analysis
Cells were detached from the plates using trypsin, washed with cold PBS, and fixed in 70% ethanol at 4 °C overnight. The cells were then washed with PBS and incubated with propidium iodide (1 μg/ml; Invitrogen, P3566) and RNase (10 μg/ml; Roche, 10,109,169,001) for 30 min. After washing, 104 cells per sample were analyzed on a FACSCalibur flow cytometer (BD Biosciences) to detect the DNA content. FlowJo software (TreeStar) was used for the data analysis.
Histology and immunohistochemistry
Fresh tumor samples collected from NOD/SCID mice were fixed in 10% neutral buffered formalin, embedded in paraffin and processed for immunohistochemical examinations. Five-micrometer-thick sections were cut from embedded tumors and baked in a 37 °C oven overnight before processing for hematoxylin–eosin and immunohistochemical staining.
For immunohistochemical staining, the tissues were subjected to antigen retrieval by boiling in sodium citrate buffer (10 mM, pH 6.0), followed by incubation at a temperature just below boiling for 20 min. The paraffin sections on slides were then de-waxed and rehydrated. The sections were incubated with 3% H2O2 for 8 min to inactivate endogenous peroxidases and then with 3% bovine serum albumin for another 8 min to block non-specific protein binding sites. The following specific antibodies were used for immunohistochemical analyses: AE1/AE3 for keratin detection (1:250; DAKO, M3515) and Ki-67 as a cell proliferation marker (1:200; Santa Cruz, sc-23,900). After overnight incubation with the primary antibody in a moist chamber, a horseradish peroxidase-conjugated secondary antibody (DAKO, K4001) was applied to the sections for 1 h at room temperature. Finally, 3,3′-diamino-benzidine substrate (DAB; DAKO, K346711–2) was applied to the sections for brown color development. The slides were then dehydrated, mounted with Permount mounting medium (DAKO, S3023), and scanned and analyzed using a Vectra Polaris Imaging System (Perkin Elmer).
RNAscope detection of EBV gene expression in NPC xenografts
An RNA in situ hybridization protocol was conducted to examine the expression of the selected EBV gene BZLF1 (Advanced Cell Diagnostic, 450,411). For this analysis, the RNAscope 2.5HD detection kit (Advanced Cell Diagnostic, 322,370) was used according to the manufacturer’s recommended protocol. This new RNA-in situ hybridization platform uses a specific and sensitive RNA-FISH probe provided by the company to detect specific EBV-RNA expression during lytic reactivation.
RNA sequencing analysis
To evaluate the RNA profiles of NPC cells after drug treatments, mRNA libraries were prepared using the TruSeq mRNA Library Prep kit (Illumina) and sequenced on a HiSeq2000 system (Illumina). The gene expression ratio between the treatment groups was then calculated based on the fragments per kilobase of transcript per million mapped reads of each gene (FPKM). HISAT2 was used to perform a sequence alignment analysis based on the reference sequence [
30], and the alignment results were inputted into Stringtie [
31] to complete the quantitative gene expression analysis. The differential expression analysis was conducted using edgeR [
32]. Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) enrichment analyses were conducted using ClusterProfiler.
Micro-positron emission tomography (PET)/magnetic resonance imaging (MRI) scanning
The mice were scanned using a nanoScan PET/3 T MRI scanner (Mediso) with spatial resolutions of 700 μm for PET and 100 μm for MRI. Before scanning, the mice were fasted overnight. Sixty minutes before the PET/MRI scan, each mouse received an injection of 200 μCi of 18F-flurodeoxyglucose (FDG) via the tail vein with < 2 min of isoflurane inhalation (5% in 100% oxygen). For the scan, each mouse was placed into the PET/MRI scanner in a head holder and remained under isoflurane inhalation (2% in 100% oxygen) until the end of the scan. The body temperature and respiration rate were monitored throughout the scan. The FDG uptake was quantified using standardized uptake values (SUVs), which were calculated using the following formula: ¼ regional FDG concentration (Bq/mL)/injected FDG dose (Bq)* body weight (kg). The raw images were anatomically standardized to achieve a symmetrical midline alignment. The images were then reconstructed using Nucline software (Mediso), and PET/MRI fused images were coregistered using InterView FUSION (Mediso). The internal liver metabolism (SUVliver = 0.5) was used as the basal metabolism level. The SUV of the tumor (SUVtumor) was normalized to the basal metabolism. SUV=SUVtumor-SUVliver.
Small interfering RNA (siRNA) transfection
Cells were transiently transfected with siRNAs specific for beclin-1 (Qiagen, GS8678) or ATG5 (Qiagen, GS9474) in Lipofectamine RNAiMAX transfection reagent (Invitrogen, 13,778–150) according to the manufacturer’s protocol. After 48 h, the transfected cells were trypsinized and seeded into 96-well plates for drug treatment and cell viability analyses as described in previous sections.
Autophagic flux assay with an GFP-LC3II reporter
NPC cells were infected with commercially available viruses engineered to carry the autophagy tandem sensor GFP-LC3II (Invitrogen, P36239) according to the manufacturer’s protocol. The cells were then transferred into a Vision 96-well plate (4titude, 4ti-0221) for live cell imaging. A LSM880 confocal microscope (Carl Zeiss) was used to obtain images of the GFP-labeled autophagosomes.
qPCR analysis
Extraction of total RNA and reverse transcription to cDNA were performed using TRIzol® reagent (Invitrogen) and SuperScript® First-Strand Synthesis System for qPCR (Invitrogen), respectively, according to the manufacturer’s protocols. Expression levels of cancer stemness related genes were examined by qPCR. The primers and probes for different genes were designed using Universal Probe Library System (Invitrogen) as follow: SOX2 (probes#2; F: AATGCCTTCATGGTGTGGTC; R: CGTCTCCGACAAAAGTTTCC), NANOG (probes:#1; F: CCCCAGCCTTTACTCTTCCT; R: ACTGGATGTTCTGGGTCTGG), ABCG2 (probes:#2; F: GCTGCCAAGTTTCCTCTCTC; R: CCACGCCTACTAAACAGACGA), MMP2 (probes:#1; F: CAGGAGGAGAAGGCTGTGTT; R: GGTCAGTGGCTTGGGGTA), MMP9 (probes:#6; F: GAACCAATCTCACCGACAGG; R: GCCACCCGAGTGTAACCATA), GAPDH (probes:#60; F: AGCCACATCGCTCAGACAC; R: GCCCAATACGACCAAATCC), BMI1 (probes#1; F:AAAGACAAAGAGAAATCTAAGGAGGA; R: AACTTTCTTAAGTGCATCACAGTCA).
Statistical analysis
The results are presented as mean values ± standard errors of the means. Comparisons between groups were performed using the two-tailed Student’s t-test with an assumption of equal variance. Statistical analyses were performed using Prism (GraphPad, Inc.). A p-value of less than 0.05 was considered to indicate statistical significance.
Discussion
In this study, we aimed to generate preclinical evidence to support the administration of palbociclib as a targeted drug therapy for NPC and to assess the compatibility of palbociclib with other chemotherapies for the treatment of this malignancy. Recent genomic profiling analyses of NPC determined the existence of few druggable targets in NPC [
10,
11,
13,
14]. Nevertheless, dysregulated p16–CDK4/6–cyclinD1 signaling is a well-known common event in the pathogenesis of NPC that promotes uncontrolled tumor growth and metastasis.
Targeted therapies for various types of cancer have been widely adopted and continuously investigated over the past decade, and many FDA-approved targeted therapies have been developed based on the genomic properties of prevalent malignancies such as gastric, breast, and liver cancers. In contrast, concurrent and adjuvant chemotherapy remain the main lines of treatment for NPC, particularly in the advanced stage of disease [
39]. Most current phase III clinical trials of NPC are assessing the therapeutic efficacies of combination of conventional cytotoxic drugs (e.g., cisplatin, doxorubicin, and 5-fluorouracil) [
40]. Therefore, the development of effective and selective therapeutic agents with novel molecular targets may improve the efficacy of NPC treatment. Very few clinical trials are investigating the use of targeted drugs for the treatment of NPC. The clinical effects of camrelizumab and tislelizumab, which target programmed cell death-1 (PD-1), and of anlotinib and nimotuzumab, which respectively target receptor tyrosine kinases and epidermal growth factor receptor (EGFR) [
41‐
44], remain to be reported.
In this study, we evaluated the tumor-suppressive effects of palbociclib in a large panel of NPC preclinical models, including newly established and well-characterized xenografts and cell lines derived from primary, recurrent, and metastatic NPCs [
45]. We confirmed that functional RB and inactivated p16 are common features in our tested NPC models, as described in our previously published study [
8]. We also confirmed the sensitivity of NPC to palbociclib both in vitro in NPC cell lines and in vivo in xenografts and determined that this drug induced cell cycle arrest in the G1 phase. All the examined NPC xenografts were sensitive to treatment with 75 mg/kg palbociclib each day, which is comparatively lower than the doses used in many reported in vivo studies of other cancer types (150–200 mg/kg/day) [
46‐
48]. The variable responses of different NPC xenografts to palbociclib (Supplementary Fig. S
5) may be related to the varied basal expression of some markers that are sensitive to palbociclib or to other intrinsic properties of various NPC cell lines and xenografts. In our study, the Xeno23, Xeno76, and Xeno32 xenografts exhibited the strongest responses to palbociclib; in these models, tumor growth was arrested throughout the treatment (Fig.
2b). Although the NPC xenografts from established NPC cell lines (NPC43, C666–1, and C17) exhibited slight increases in tumor size during the treatment periods, the tumors remained significantly smaller in the treatment groups than in the vehicle control groups.
Palbociclib is an FDA-approved drug for clinical use, so potential adverse effects should not be a significant issue. In this preclinical trial, we did not observe significant differences in body weights between the mice in the treatment and control groups. Interestingly, we also observed that palbociclib could inhibit the in vivo colonization of lung tissues with intravenously injected NPC cells, which suggests that this drug could potentially inhibit NPC metastasis (Supplementary Fig. S
8). Consistent with this observation, palbociclib was shown to inhibit breast cancer metastasis in animal models through a mechanism that involves inhibition of the c-Jun/COX-2 signaling pathway [
49]. However, the detailed molecular mechanism by which palbociclib suppressed NPC metastasis warrants further investigation.
The potent suppressive effects of palbociclib on the growth of NPC xenografts derived from patients with primary, recurrent, and metastatic tumors support the application of this drug in clinical trials related to NPC treatment. A previous preclinical study evaluated another CDK4/6 inhibitor, ribociclib, that targets a different site in the ATP-binding pocket of CDK4/6 and similarly demonstrated that the inhibition of this signaling pathway could inhibit the growth of NPC cells [
50]. An integrated genomic and transcriptomic study of five patient-derived xenografts also determined that the copy numbers of
CCND1 and
CDKN2A are potential targets of palbociclib and may mediate the suppression of tumor growth [
51]. A case report also demonstrated the clinical benefits of palbociclib treatment in a patient with previously treated metastatic NPC with
CDK4 amplification [
52]. Taken together, these observations emphasize the strong therapeutic value of targeting the dependency of NPC cells on the CDK4/6–cyclinD1 pathway.
In the second part of this study, we furthered our exploration of the efficacy of combination treatments that include palbociclib for the treatment of NPC. Combinations of chemotherapy drugs are commonly used in cancer treatment to prevent drug resistance, reduce drug dosages, and minimize adverse effects. Because platinum-based chemotherapy (e.g., cisplatin) is the most commonly used NPC treatment option, we first assessed the combined effect of cisplatin and palbociclib on the viability of NPC cells in vitro. Previous studies have reported antagonistic effects when CDK4/6 inhibitors are combined with other specific chemotherapeutic drugs [
53,
54] such as taxane, PLK1 inhibitors, gemcitabine, and other drugs with mechanisms of action that rely on continuous cell cycle progression. In this study, palbociclib also protected NPC cells from the cytotoxic effects of cisplatin (Fig.
3a), possibly because palbociclib induces cell cycle arrest in the G1 phase. To mediate its cytotoxic actions, cisplatin induces DNA damage by crosslinking purine bases on DNA, interfering with DNA damage repair and triggering apoptosis and cell death [
55]. These actions take place in the S phase of cell cycle and therefore may be abrogated by the effects of palbociclib.
In contrast, we observed a synergistic effect when palbociclib was combined with SAHA, an FDA-approved drug for the treatment of cutaneous T cell lymphoma [
56]. SAHA is a broad-spectrum HDAC inhibitor that disables HDAC by removing acetyl groups from histone proteins, thus disrupting the regulation of gene expression [
57,
58]. SAHA can induce growth arrest and death in a broad range of transformed cells both in vitro and in vivo at concentrations that induce few or no toxic effects on normal cells [
26,
59]. Although the exact mechanisms remain to be elucidated, the anticancer effect of SAHA is attributed to dysregulation of the expression of genes involved in cell proliferation and death pathways [
26]. In this study, we confirmed the synergistic effects of palbociclib and SAHA in three authenticated EBV-infected NPC cell lines (Fig.
3b). We further observed that the addition of SAHA enhanced the tumor inhibitory effect of palbociclib in our Xeno76, Xeno23, and C666–1 xenograft models (Fig.
4a). This is the first report to demonstrate the ability of SAHA to enhance the efficacy of palbociclib for the treatment of NPC.
We sought to understand the mechanisms that underlie enhanced NPC cell death in response to this combination treatment. In a previous study of NPC, SAHA was shown to induce apoptosis and suppress tumor growth by activating the lytic cycle of EBV [
34,
60]. In our study, we demonstrated the lytic reactivation of EBV at the single-cell level by using an RNAscope analysis of the lytic gene,
BZLF1 (Supplementary Fig. S
12). However, fewer than 1% of the xenograft tumor cells were shown to express this gene, suggesting that lytic reactivation was not the major cause of the enhanced cell death in response to combined treatment. We also did not detect increased levels of apoptosis and differentiation markers in cells subjected to the combined treatment (Supplementary Fig. S
11), suggesting that these processes were not responsible for the enhanced cell death. Interestingly, RNA sequencing and Western blot analyses revealed the common induction of autophagy-related pathways in all three NPC cell lines in response to the combination of palbociclib and SAHA (Fig.
5). Evidence suggests that autophagy can participate in a caspase-independent form of programmed cell death induced by anticancer drugs [
61]. Autophagic cell death is due to the accumulation of presumably toxic autophagic cargo in cells with a defective ability to degrade this material in lysosomes. Autophagy has been reported to play contradictory roles in tumor initiation and progression, and both autophagic repression and stimulation have been identified as therapeutic approaches, depending on the cellular context of the tumor.
Autophagy-associated cell death can be induced therapeutically by modulating regulators of autophagy. In a previous study, a combination of autophagy-associated mTOR inhibition and radiation yielded enhanced therapeutic effects in cancer cells and xenografted tumors [
62]. In our study, palbociclib increased the expression of LC3-II, and the combined use of palbociclib and SAHA further augmented this expression (Fig.
5). The autophagy inhibitor CQ can alkalize the lysosomal lumen and block autolysosomal degradation. In our study, CQ treatment further enhanced the increased expression of LC3-II in groups treated with palbociclib monotherapy or combined palbociclib and SAHA, indicating that palbociclib itself can upregulate autophagic flux. Furthermore, we found that CQ could inhibit the death of C666–1 cells exposed to palbociclib alone or in combination with SAHA. In vivo, the combined treatment induced higher LC3-II/LC3-I ratios in the xenograft tumors (Fig.
5h). These observations suggest that autophagy is a factor in the cell death induced by palbociclib monotherapy or combined palbociclib and SAHA therapy. A previous study of hepatocellular carcinoma cells demonstrated that palbociclib induced autophagy in a CDK4/6-independent manner; in those cells, autophagy was induced via a mechanism involving 5′ AMP-activated protein kinase (AMPK) activation and protein phosphatase 5 (PP5) inhibition [
63]. Other studies reported that HDAC inhibitors could induce caspase-independent autophagic cell death in HeLa and chondrosarcoma cells [
64,
65]. In our NPC cell systems, SAHA appeared to potentiate the autophagy-inducing effect of palbociclib, which may have led to the massive degradation of essential cellular structures and autophagy-associated cell death. Investigations are needed to further elucidate the role of autophagy as a mediator of the enhanced cytotoxic effects of palbociclib, either alone or in combination with SAHA, especially in the context of NPC cells.
We have demonstrated the potent effect of palbociclib as a suppressor of the growth of primary, recurrent and metastatic cancer cells and anticipate a first-in-human clinical trial of this drug in patients with NPC. In 2009, 16 patients with treatment-naïve World Health Organization histological grade III, stage II (
n = 2), III (
n = 6), and IVB (
n = 8) NPC were treated with the non-selective CDK inhibitor seliciclib [
51]. However, the use of seliciclib in clinical trials was displaced by the subsequent development of specific inhibitors to CDK4/6 such as palbociclib. However, palbociclib use may eventually lead to drug resistance [
66,
67]. Therefore, we examined whether palbociclib-resistant NPC cells would remain vulnerable to cisplatin treatment and observed the acquisition of a new cell cycle pathway independent of RB phosphorylation (Fig.
6a). Cyclin A expression, which indicates proliferation, could be maintained at a high level in these cells even under the treatment of palbociclib. Cyclin E1 overexpression was also observed in palbociclib-resistant NPC43 cells. A previous study identified E2F activation via the cyclin E–CDK2 axis as a factor that reverses the inhibition of CDK4/6 and enables cell cycle progression from the G1 to the S phase [
67]. NPC cells may use a similar mechanism to develop resistance to palbociclib. Importantly, these palbociclib-resistant NPC cell lines remained sensitive to cisplatin (Fig.
6e), suggesting that this platinum-based drug could still be used to treat patients who develop resistance to palbociclib.
Despite the promising use of palbociclib as a therapeutic option for NPC, irradiation and concurrent cisplatin chemotherapy will remain the first-line treatment options for most primary cases until the benefits of palbociclib can be demonstrated in clinical trials of recurrent or metastatic NPC patients. Cisplatin is also used in salvage chemotherapeutic regimens for the treatment of recurrent tumors and even palliative regimens for the treatment of metastases, as approved targeted therapies for NPC are not available [
3]. Accordingly, we sought to verify whether palbociclib would effectively target cisplatin-resistant NPC cell lines. In our study, palbociclib could effectively suppress the growth of cisplatin-resistant NPC43 cells (Fig.
6g). In summary, cisplatin and palbociclib could each potentially be used to treat patients who have developed resistance to the other drug.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.