Background
Triple negative breast cancer (TNBC) accounts for approximately 15% of all breast cancers and is defined by lack of expression of estrogen and progesterone receptors, and lack of overexpression of human epidermal growth factor receptor 2 (HER2). TNBC is an aggressive breast cancer subtype characteristic of having quick progression and poor patient outcomes. Patients have higher rates of early recurrence than other breast cancer subtypes, particularly in the first 5 years after diagnosis [
1]. Due to the aggressive nature of TNBC, patients tend to have poor prognosis, including poor overall survival (OS), breast-cancer specific survival (BCSS), and recurrence-free survival (RFS) [
1‐
3]. It is unclear what drives the aggressive nature of TNBC.
While genetics may play a role, the tumor microenvironment has a substantial influence on many tumor attributes. An inflammatory tumor microenvironment is often present in TNBC. Compared to other breast cancer subtypes, TNBC has a higher level of tumor infiltrating lymphocytes, including CD8 and CD4 + T cells, and CD20 + B cells [
4‐
6]. Likewise, expression of inflammatory cytokines, immunosuppressive genes and markers of chronic inflammation are higher in TNBC than other breast cancer subtypes [
4‐
8]. Although high densities of infiltrating lymphocytes are associated to increased response to chemotherapy and better outcomes in highly proliferative tumors, this prognostic association may be lost in tumors with lower proliferative capacity and in certain subtypes of TNBC, such as the claudin low subtype [
6,
9]. Additionally, gene signatures related to chronic inflammatory responses have been associated to ER negativity, increased metastasis and poor prognosis in TNBC [
4,
8,
10,
11]. Moreover, increased activation of NfKB, STAT3 and AP-1 pathways has been observed in triple negative cell lines and tumors compared to other breast cancer subtypes [
11].
Chronic inflammation associated with the humoral immune response has been found to promote aggressiveness in a number of solid tumor types. B lymphocytes have been shown to drive chronic inflammation in a murine model of inflammation-associated epithelial cancer, contributing to tumor-promoting processes such as an angiogenesis, epithelial cell proliferation, and further recruitment of immune cells [
12]. B lymphocyte-derived factors have also been shown to upregulate proteins and transcription factors involved in pro-inflammatory signaling pathways such as IKK complex proteins and STAT3 in tumor cells, resulting in tumor-promoting processes such as inflammation and angiogenesis [
13‐
18]. Moreover, TIB cells were found to induce chronic inflammation in melanoma, leading to activation of the inflammatory NfKB signaling pathway [
19].
Chronic inflammation is known to induce immunosuppressive responses in both malignant and non-malignant tissues through a variety of process affecting both innate and adaptive immunity. Immune modulation of antibody responses occurs in part through class switching to the immunosuppressive IgG4 antibody subtype. This switch is driven by chronic antigen exposure and T-helper type 2 cytokines such as IL-4and IL-10 [
10,
20‐
22] and serves to ramp down the immune system during inflammatory responses [
23,
24]. Due to the unique structure of its hinge region, IgG4 has reduced effector functions compared to other IgG isotypes. These structural changes result in poor ability to bind complement and Fc receptors and to activate effector cells [
23]. Furthermore, IgG4 can interact with other antibodies of the IgG (particularly IgG1) and IgE classes through their Fc domains, serving in an immunoregulatory role to decrease antibody responses [
25‐
27].
The presence of IgG4 antibodies has been reported in a subset of cancer types, namely melanoma [
28‐
30], extrahepatic cholangiocarcinoma [
31], glioblastoma [
32], pancreatic cancer [
33], and hepatocellular carcinoma [
34] and has been shown to have a negative correlation with recurrence free and overall survival [
29,
30,
34]. Although the role of IgG4 in breast cancer is unclear, a recent study reported an enrichment of IgG + clonally expanded B cells in TNBC, with an increase in IgG4 class switching in TNBC compared to non-TNBC [
35]. In this study we sought to understand the mechanisms driving IgG4 class switching in TNBC and determine the relationship of IgG4 + B cells in the TME to patient outcomes.
Methods
Cell culture and reagents
MDA-MB-231 cells obtained from American Type Culture Collection were maintained in RPMI-1640 medium (ThermoFisher Scientific, #11875) + 10% FBS (ThermoFisher Scientific, #10437028) and 1% antibiotic/antimycotic (ThermoFisher Scientific, #15240). SUM159 cells were obtained from Asterand (Detroit, MI) and cultured in Ham’s F12 medium (ThermoFisher Scientific, #11765) + 10% FBS, 1 × antibiotic/antimycotic, 2 μg/ml insulin (ThermoFisher Scientific, #12585) and 100 ng/ml hydrocortisone (Sigma-Aldrich, #H0135). Primary human peripheral B lymphocytes and EBV transformed B cells were grown in RPMI-1640 + CellXVivo Human B Cell Expansion Kit as described by manufacturer (R&D Systems, #CDK005), L-glutamine (ThermoFisher Scientific, #25030), 2-mercaptoethanol (ThermoFisher Scientific, #21985), Insulin, Penicillin–Streptomycin (ThermoFisher Scientific, #15070063), and 10% FBS. EBV-transformed human peripheral B cells were grown in RPMI + 10% FBS and 1 × antibiotic/antimycotic and treated with CellXVivo Human B cell expansion kit for experimental analysis.
Isolation of PBMCs and flow cytometry
Peripheral human blood was obtained with consent from women with TNBC prior to surgical resection or treatment and peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll-Paque® (GE Healthcare, #95021). B lymphocytes were isolated using B Cell Isolation Kit II, human (Miltenyi Biotech, #130-091-151) according to the manufacturer’s instructions. For co-cultures, B cells and tumor cells were separated with a 0.4 μm 6-well cell culture insert with B cells in the upper chamber. Cells were cultured for 6 days, with media changed on day 3. Following co-culture, B cells were prepared for flow cytometry analysis by staining with an IgG4 antibody for 30 min in the dark (#9200-09, mouse anti-human IgG4 PE-conjugated, 1:50, SouthernBiotech). Cells were washed, resuspended in 300 μl PBS + 10% FBS, and filtered through a 35-um filter cap in a 5 ml FACS tubes to create a single cell suspension. Samples were run on the BD FACSAria II (BD Biosciences) at the Christiana Care’s Helen F. Graham Cancer Center and Research Institute core facility. For IL-10 blocking studies, anti-human IL-10 (clone JES3-97D, Biolegend) was added at a concentration of 1ug/ml, daily during co-culture. Flow cytometry experiments were repeated at least three times with each tumor cell line.
Real-time PCR
Tumor cell lines were cultured with and without B cells for 24 h as described above and RNA was isolated. Real-time PCR was performed as previously described [
36]. Samples were run on an Applied Biosystems’ 7500 Fast Real-Time PCR System with Power SYBR Green PCR Master Mix (Life Technologies), using the primers described in Table
1. All experiments were performed in at least four experimental replicates in each cell line.
Table 1
Primers used for qPCR
VEGF | TGCAGATTATGCGGATCAAACC | TGCATTCACATTTGTTGTGCTGTAG |
PDGFA | GGTGGTCACAGGTGCTTTTT | AAACCACTTAAGGCTCTCAGGA |
PDGFB | TGAGAAAGATCGAGATTGTGCG | GGGCTTCGGGTCACAGG |
IGF-1 | CATGTCCTCCTCGCATCTCT | AGCAGCACTCATCCACGATA |
IL-1beta | CTGAAAGCTCTCCACCTCCA | CCAAGGCCACAGGTATTTTG |
IL-4 | CACAAGCAGCTGATCCGATTC | TCTGGTTGGCTTCCTTCACAG |
Il-6 | GACAAAGCCAGAGTCCTTCAGAGA | CTAGGTTTGCCGAGTAGATCT |
IL-8 | AAGCTGGCCGTGGCTCTCTT | TGG TGG CGC AGT GTG GTC CA |
IL-10 | GGTTCGCAAGCCTTGTCTGA | TCCCCCAGGGAGTTCACAT |
GAPDH | CCAGGTGGTCTCCTCTGACTT | GTGGTCGTTGAGGGCAATG |
ELISA
For the IL-10 ELISA, tumor cells were co-cultured with B cells for 24-h. Control cells were incubated with media only. To ensure detection of tumor cell IL-10, B lymphocytes and media were removed, and fresh media was added back to wells for a 24-h period. Supernatants were then collected, spun down to remove cell debris, and analyzed using the Quantikine IL-10 Elisa kit (R&D systems) according to manufacturer’s instructions. For the IgG4 Elisa, EBV B cells were activated and co-cultured with or without TNBC cell lines for 5 days as previously described. B cells were then removed and allowed to expand for two weeks. Cells were then plated for 24 h and supernatant was captured. Supernatants were analyzed using the Human IgG4 Elisa kit (Invitrogen). Absorbance was read at 450 nm on the Infinite® 200 PRO NanoQuant (Tecan Life Sciences). Experiments were performed in duplicate in each cell line.
Patient samples
Breast cancer tissue specimens were obtained from the Helen F. Graham Cancer Center and Research Institute (HFGCCRI) biorepository under a protocol approved by the institutional review board. Tissue was obtained from surgical resection from women who were pathologically diagnosed with TNBC and consented to the use of their tissues for research. A pathological diagnosis of TNBC is defined as less than 1% of tumor cell expression of the hormone receptors estrogen and progesterone and a negative HER finding by IHC (0 or 1 +) or negative FISH. Tissue blocks were prepared by formalin-fixation and paraffin-embedding. Tissues were constructed into 4 × 5 tissue microarrays (TMA) with a 5 mm core size and cut as serial sections. All patients underwent adjuvant radiation and chemotherapy after surgical resection.
Immunohistochemical procedure
Serial paraffin-embedded slides were deparaffinized and rehydrated, and heat antigen epitope retrieval was performed for 16 h at 60 °C. Slides were stained using the DAB Substrate kit (Abcam, ab64238) for IL-10 and CD20 and the Mouse and Rabbit Specific HRP/AEC (ABC) Detection IHC Kit (Abcam, ab93705) for IL-4 and IgG4, following the manufacturer’s instructions. Primary antibodies were incubated overnight at 4 °C with a rabbit monoclonal antibody to IgG4 (Abcam, ab109493, 1:1000), a rabbit polyclonal antibody to IL-4 (Abcam, ab9622, 1:100), and mouse monoclonal antibodies to CD20 (Abcam, ab9475, 1:100) and IL-10 (Santa Cruz, sc-8438, 1:50). Slides were counterstained with Harris hematoxylin for 10 min. Images were captured using a Zeiss Axio microscope using a 10X objective. CD20 was scored by overlaying a 20 × 20 grid of 1 mm squares and calculating the percent of tissue-containing squares which contained 10 + lymphocytes. IgG4 was scored by counting the total number of IgG4 + B cells. For IL-10 and IL-4 staining, segmentation of tumor cells and measurement of integrated density was performed using Zen Blue. The median intensity or percentage was used to determine low vs high samples. For CD20, low, intermediate and high density was determined using the mean ± one standard deviation. Control staining was performed with an isotype matched antibody (Santa Cruz, sc-2025, sc-2027) using the same staining conditions. No staining was observed. (Additional file
1: Fig. S1).
Statistical analysis
Statistical analysis was done in graph pad PRISM 8 and IBM27 SPSS. Relationships among scored slides was done using Spearman’s correlation analysis. Flow cytometry and real time quantitative PCR data was analyzed using student’s T-test. Survival and recurrence were analyzed using Kaplan–Meier curves and Mantel Log-Rank tests. Multi-variate analysis was carried out using Cox-proportional hazards tests.
Discussion
In this study, we report that presence of IgG4 + B cells in the tumor microenvironment of TNBC associates with increased tumor recurrence and poor patient survival. We also report that presence of IgG4 + B cells correlates with tumor expression of IL-10 and trends with expression of IL-4 by tumors. As IL-10 and IL-4 are known to promote class switching to IgG4 [
22,
39], these findings indicate that TNBC may create a tumor microenvironment that supports class switching to the IgG4 subtype.
TIB have been shown to undergo class switching and somatic hypermutation at a higher frequency in TNBC than other breast cancer subtypes [
40,
41]. Although an increase in IgG1 has been associated with better prognosis [
41], the role of IgG4 has is unclear in breast cancer. However, the association between IgG4 and poor outcomes has been demonstrated in melanoma and other tumor types [
24,
28,
29]. Consistent with our findings, these studies have also shown TIB expressing IgG4 correlate with the presence of Th2 cytokines [
29].
Based on our studies, it is yet to be determined if IgG4 in TNBC actively contributes to poor patient outcomes, or if it is a bystander in a larger process. There is evidence in melanoma that IgG4 hinders tumor associated antigen targeted IgG1, regardless of if the IgG4 antibody was antigen specific or not, indicating that IgG4 may actively impede an anti-tumor antibody response regardless of antigen specificity [
31]. In addition to promoting IgG4 class switching, IL-10 is an immunosuppressive cytokine, and can inhibit the ability of dendritic cells and macrophages to activate CD4 + helper T cells [
42]. In breast cancer, IL-10 expression in tumors positively correlates with locally advanced disease, higher tumor grade, and hormone-receptor negativity [
43,
44]. This finding is different in non-TNBC, where IL-10 is found to be a good prognostic indicator of disease-free survival (DFS) [
45]. In melanoma, IL-10 expression by tumor cells associates with melanoma progression [
46], and high serum IL-10 associates significantly with worse OS [
47]. Therefore, it is possible that IL-10 expression by tumor cells may also be a driver of poor outcomes in TNBC, and this may be independent of IgG4 + B cells. This is supported by our multi-variant analysis where only stage and tumor IL-10 were predictive of shorter OS. Although not examined in the scope of this study, significant expression of IL-10 was also observed in TIB and may play a role in directing anti-tumor immune responses as well. Further study is needed to determine the role of B cell expressed IL-10 in TNBC and if IgG4 + B cells serve as regulatory B cells.
In this study, we find that B cells enhance inflammatory responses, including IL-10 expression in TNBC cells. Cross-talk between tumor cells and TIB may help to shift the immune response towards and immunosuppressive state through induction of IL-10 expression and release by tumor cells. Enhanced IL-10 expression has also been reported in melanoma cells co-cultured with B cells [
30]. The mechanism driving IL-10 gene expression in tumor cells is not yet fully understood. Gene expression studies show that the transcription factors AP-1 and NFκB are important in driving transcription of IL-10, but the majority of studies have been conducted in immune cells [
48]. Further study is needed to determine if IL-10 expression by TNBC is dependent upon B cell induced NFκB or other inflammatory signaling mechanisms. Understanding what drives IL-10 expression in TNBC may reveal potential therapeutic targets for TNBC.
The ability of tumor cells to direct TIB behavior has been previously described in melanoma and lung cancer [
49,
50]. Co-culture with supernatants of melanoma cells was able to induce activation of NFκB and expression of inflammatory cytokines in B cells as well as isotype switching to IgG4. Likewise, co-culture of LPS-stimulated lung tumor cells was shown to induce IL-10 expression and a regulatory phenotype in peripheral B cells. However, these studies did not investigate effects on tumor cells. Our studies show that that co-culture also results in increased expression of inflammatory cytokines by tumor cells. Our findings indicate that significant cross-talk may occur between B cells and tumor cells that may help to shape immune responses. Whether or not enhanced inflammatory signaling in TNBC occurs as a direct consequence of B cell expressed inflammatory cytokine expression remains to be determined.
The role of humoral immune responses in breast cancer is unclear. Recently, high densities of TIB were found to associate with good prognosis in breast cancer [
38]. Garaud et al., reported TIB cells with a germinal center phenotype (CD19
+CD38
highIgD
−) were more often found in breast cancers with high TIB density and these cells were found to associate with tertiary lymphoid structures and maintain functionality. Analysis of secreted immunoglobulins in the supernatants of TIB showed increases in IgG1, IgG2 and IgG3 with increasing TIB density, with a higher concentration of IgA obtained from tissues with intermediate B cell infiltration [
38]. Likewise, increased clonal expansion of IgG + cells has been reported in stromal clusters [
35]. These findings indicate that TIB isotype may be associated with B cell density or other features of the tumor microenvironment. In our study, IgG4 expression was associated with low to medium density of TIB. Of note, IgG4 expressing B cells were more often located intratumorally and diffusely spread throughout the tumor microenvironment, as opposed to being located in B cell aggregates or at the invasive margin. This spatial distribution may promote more interactions with tumor cells as opposed to other immune cells as has been previously described [
51]. The association to tertiary lymphoid structures was not examined in our study and it is unknown if these structures are needed for isotype switching to IgG4 or if this polarization occurs elsewhere. Furthermore, the exact phenotype and clonality of IgG4
+ B cells remains to be characterized.
Conclusions
Our results support that IgG4 expression by B cells is induced through signaling from TNBC cells, and presence of IgG4 + B cells in the TNBC microenvironment associate with worse patient OS, BCSS, and RFS. We show that infiltration of IgG4 + B cells correlate with intermediate but not high densities of B cell infiltration, IL-10 expression by tumor cells, and higher stage. Understanding the contribution of IgG4 + cells to the immune microenvironment of TNBC may reveal ways in which TIB can contribute to tumor growth and provide new targets to increase the immune response to TNBC. As different diagnostic criteria may exist between institutions for TNBC, and there are various subclasses within TNBC, these findings should be confirmed in a larger study population and in the context of heterogeneous subclasses of TNBC.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.