Introduction
Colorectal carcinoma (CRC) is one of the most common cancers, and is a significant contributor to cancer death[
1]. Although surgery currently offers the possibility of prolonged survival for CRC patients, a significant number of patients with CRC who undergo curative surgery develop local recurrence or distant metastasis, leading to shorter survival[
2]. A better understanding of the molecular mechanisms underlying tumor recurrence or metastasis is essential to facilitate the prevention and treatment of advanced CRC.
MicroRNAs (miRNAs) are endogenous non-coding RNAs that negatively regulate target gene expressions by binding to 3′-untranslated region (UTR)[
3,
4]. MiRNAs participate in gene regulation, apoptosis, hematopoietic development, the maintenance of cell differentiation, and tumor genesis[
5,
6]. The dysregulation of miRNAs is common in various carcinomas and plays an important role in tumorigenesis, tumor progression, metastasis and relapse in cancers[
7‐
9].
Recently, miR-224 has been shown to be up-regulated in cervical cancer and pancreatic ductal adenocarcinomas[
10,
11], and the involvement of miR-224 in the tumorigenesis and development of breast cancer and hepatocellular carcinoma has also been reported[
12,
13]. Previous reports revealed that miR-224 was upregulated in CRC by miRNA microarray analysis[
14,
15]. Moreover, miR-224 is one of the most highly differentially expressed miRNAs in methotrexate-resistant cells, and its over-expression induces the resistant phenotype in HT29 colon cancer cells[
16]. Taken together, these studies suggest that miR-224 functions as an oncogenic miRNA. However, the association between miR-224 and relapse of colorectal cancer has not been evaluated yet, and the biological roles of miR-224 in CRC remain poorly understood.
Thus, we investigated the relationship between expression level of miR-224 and prognosis in CRC, and further studied the possible function of miR-224 in the CRC cell line. Our study results showed the high expression level of miR-244 in CRC was significantly associated with a relative poorer disease-free survival rate. Moreover, we also demonstrated miR-224 promoted proliferation, migration and invasion of SW480 cells, at least partially through suppression of SMAD4 expression.
Materials and methods
Patients and tissue samples
A total of 108 stage I-II (UICC, 6th ed., 2002) colorectal patients received radical surgery at the First Department of General Surgery, the Affiliated Hospital of North Sichuan Medical College, from January 2004 to January 2009, were collected. All clinicopathological characteristics of patients with disease relapse (n=40) or without disease relapse (n=68) within 3 years after surgery were available for all patients. Disease relapse was defined as local recurrence or distant metastasis of colorectal cancer. All tissue specimens were derived from 108 patients who did not received neoadjuvant therapy before surgery. The patients who received postoperative adjuvant therapy were also excluded. To test whether miR-224 was differentially expressed between paired tumor and adjacent normal tissue in the same subject, we recruited a second cohort comprising 20 CRC patients. All tissue samples were immediately frozen in liquid nitrogen and stored at -80°C for subsequent analysis. The median follow-up time was 48.3 months (12.6–62.5 months) until June, 2012. Disease-free survival (DFS) was calculated from radical surgery to the first disease relapse. Informed written consent was obtained from each patient, and research protocols were approved by the Medical Ethics Committee of North Sichuan Medical College.
Cell culture
The human CRC cell line SW480 was purchase from American Type Culture Collection. The cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 100 u/ml penicillin and 100 mg/ml streptomycin, at 37°C in a humidified atmosphere of 5% CO2.
RNA extraction and real-time RT–PCR
Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The PCR primers for miR-224 and U6 were purchased from Applied Biosystems (Applied Biosystems, Foster City, CA, USA). The PCR primers for SMAD4 were 5′-TGGCCCAGGATC AGTAGGT-3′ and 5′-CATCAACACCAATTCCAGCA-3′.The primers for β-actin: 5′-CCAAGGCCAACCGCGAGAAGATGAC-3′ and 5′-AGGGTACAT GGTGGTGCCGCCAGAC-3′. The first-strand cDNA was synthesized using the PrimeScript RT reagent Kit (TaKaRa, Dalian, China). Real-time PCR was performed using SYBR Premix Ex Taq (TaKaRa) and measured in a LightCycler 480 system (Roche, Basel, Switzerland). U6 or β-actin was used as internal control. Relative gene expression was calculated using 2-ΔCT method, and fold change of gene was calculated using the equation 2-ΔΔCT.
Transfection of miRNA
Ectopic expression of miR-244 in cells was achieved by transfection with Pre-miR-224 precursor (pre-miR-224) (Ambion, Foster City, CA, USA) using Lipofectamine 2000 (Invitrogen). 2 ×105 cells were seeded into each well of a 6-well plate and transfected for 24 h or 48 h. Transfected cells were used in further assays or RNA/protein extraction.
MTT assay
2×104 SW480 cells were plated onto 96-well plates for 24 h. The cells were then transfected with 50 nM pre-miR-224 or pre-miR-nc. At different time points (24 h, 48 h and 72 h), the culture medium was removed and replaced with culture medium containing 10μl of sterile MTT dye (5 mg/ml). After incubation at 37°C for 4 h, the MTT solution was removed, and 150μl dimethyl sulfoxide (DMSO) was added to each well followed by measuring the absorbance at 570 nm on an enzyme immunoassay analyzer (Bio-Rad).
Migration and invasion assays
For migration assays, 5×104 cells transfected with either pre-miR-224 or pre-miR-nc were placed into Boyden chambers (Corning, Cambridge, MA, USA) with an 8.0mm pore membrane. For invasion assays, 5×104 cells were placed into chambers coated with 150μg of Matrigel (BD Biosciences, Bedford, MD, USA). Medium containing 10% fetal bovine serum in the lower chamber served as the chemoattractant. After the cells were incubated for 48 h at 37°C in a humidified incubator with 5% CO2, the cells remaining on the upper surface of the membranes were removed, whereas the cells adhering to the lower surface were fixed, stained with hematoxylin and counted under a microscope at a magnification of 400× to calculate their relative numbers.
Western blot analysis
Immunoblotting was performed to detect the expression of SMAD4 in CRC cell lines. Transfected cells were lysed in RIPA lysis buffer (ProMab Biotechnology). Protein was loaded onto a SDS-PAGE minigel and transferred onto PVDF membrane. After probed with 1:500 diluted mouse polyclonal SMAD4 antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at 4°C overnight, the blots were subsequently incubated with HRP-conjugated secondary antibody (1:5000). Signals were visualized using ECL Substrates (Millipore, MA, USA). GAPDH was used as an endogenous protein for normalization.
Luciferase assay
For luciferase reporter experiments, the wild-type and mutated 3′UTR of SMAD4 mRNA were subcloned into the
Xho I and
Not I site of the psicheck-2 vector (Promega) and the new vectors were named psicheck-2-SMAD4-WT and psicheck-2-SMAD4-MUT, respectively. The primers as shown in Table
1 were used to amplify specific fragments. For reporter assay, HEK 293T cells were plated onto 24-well plates at 2×10
4 cells/well and transfected with 200 ng of psicheck-2-SMAD4-WT or psicheck-2-SMAD4-MUT and 40 nM pre-miR-224 or pre-miR-nc using Lipofectamine 2000 (Invitrogen). Firefly luciferase was used to normalize the Renilla luciferase. After transfection for 48h, cells were harvested and assayed with Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s protocols.
Table 1
PCR primers and oligonucleotide sequences of constructs in luciferase reporter assay
SMAD4 |
(site 1, site 2) | WT1 | Sense | CACAACTCGAGAGGCACAAGGTTGGTTGCTA |
| | Antisense | GGAAAAAAGCGGCCGCGACCTTCTGAGCAAGGCAGT |
SMAD4 | WT2 | Sense | CACAACTCGAGTGTGTGACACCACCCTCCTA |
(site3) | | Antisense | AAGGAAAAAAGCGGCCGCTCAATCCAAGCCCGTGAGTC |
SMAD4 | MUT1 | Sense | TGATGCACTGAATTTTTGGTATAATGTTTAAATCATGT |
(site1) | | Antisense | CCAAAAATTCAGTGCATCAAATCAAGTACAAAAATA |
SMAD4 | MUT2 | Sense | TGGCACACTGAATGTATAGAGAATTTAAGTAGAAAAGTT |
(site2) | | Antisense | TATACATTCAGTGTGCCAATTGATATGATCATTGATGG |
SMAD | MUT3 | Sense | GATTAACACTGAATGGCTGGATCATTCAGAGCTCTCTTCT |
(site3) | | Antisense | GCCATTCAGTGTTAATCAAAATGGACCTAAAAAGAGCCA |
Statistical analysis
All data presented in this study have been repeated at least three times from three independent experiments. Continuous variables were expressed as the mean ± standard deviation. Measurement data were analyzed using Student's t-test, while categorical data were studied using chi-square test. Receiver operating characteristic (ROC) curve was used to determine the cut off value of miR-224 expression. The postoperative survival rate was analyzed with Kaplan–Meier method, and differences in survival rates were assessed with log-rank test. All statistical analyses were performed using SPSS 16.0 software (SPSS, Chicago, IL, USA). Two-sided P-values were calculated, and differences were considered significant at P-values of <0.05.
Disscussion
It was reported that disease relapse was an important factor leading to the poor survival of colorectal cancer patients[
17]. At present, poor clinicopathological characteristics and high carcinoembryonic antigen (CEA) level were known as high risk factors for relapse but with varying reliability reported[
18]. Therefore, effective biomarkers were wanted to distinguish between patients with and without high relapse risk followed by appropriate therapy in CRC.
Differential miRNA expression in tumor samples compared to normal samples or between groups of tumor samples with a favourable and poor clinical outcome have been used to generate miRNA signatures with potential prognostic and/or predictive value[
19,
20]. In the current study, we confirmed that miR-224 expression in CRC tumor tissues was significantly higher than that in normal tissues. Furthermore, miR-224 expression levels were significantly up-regulated in the tissues of CRC patients with disease relapse compared with those without disease relapse, and the CRC patients with up-regulated miR-224 in tumor tissues had a high risk of relapse. Thus, miR-224 could function as a potential predictive marker for relapse following radical surgery of colorectal cancer.
In this study, we investigated the biological role of miR-224 in regulating CRC cancer progression. Our results revealed that miR-224 promoted CRC cells growth, migration and invasion in vitro. To address the molecular mechanisms involved in miR-224-mediated changes of biological properties, SMAD4 was selected for further study because it was predicted to be a target of miR-224 by bioinformatics analysis. SMAD4 belongs to the evolutionarily conserved family of SMAD proteins which are transmitters of signals from the transforming growth factor-β (TGF-β) superfamily of cytokines[
21]. It is suggested that SMAD4 can function as a tumor suppressor gene in gastrointestinal carcinoma[
22,
23]. Previous study showed that patients with tumors expressing low SMAD4 levels had significantly worse overall and disease-free survival than patients with high levels in colorectal cancer[
24]. Moreover, Loss of SMAD4 expression was found to be associated with liver metastasis, and reduced SMAD4 expression enhances tumorigenicity in CRC[
25]. A recent study also reported that loss of SMAD4 promoted migration and invasion, and mediated epithelial– mesenchymal transition (EMT) in CRC cell line SW480[
26,
27]. Hence, it is an attractive target for anti-cancer therapy in colorectal cancer.
Our study suggested that SMAD4 was a possible target of miR-224. Firstly, the luciferase reporter assay demonstrated its down-regulation was mediated by the direct binding of miR-224 to the SMAD4 3′-UTR, because the alteration of this region abolished this effect. Secondly, over-expression of miR-224 suppressed SMAD4 protein levels without any change in SMAD4 mRNA expression. Therefore, we proposed that the main mechanism of miR-224-induced SMAD4 suppression was post-transcriptional. In addition, SMAD4 has been confirmed as a target gene of miR-224 in Granulosa Cells[
28]. In our study, restoration of miR-224 promoted CRC cell proliferation, migration and invasion, this could possibly be due to miR-224-mediated down-regulation of SMAD4 expression.
Cancer stem cells (CSCs) are predicted to be critical drivers of tumor progression due to CSC characteristics including self-renewal and pluripotency, drug resistance, limitless proliferative potential and metastatic capability, suggesting that targeting CSC characteristics would likely eliminate CSCs which are the “seeds” of tumor recurrence and metastasis. Specific miRNAs have been shown to be involved in CSC regulation in CRC, such as miR-328 and miR-449b[
29,
30]. Recently, Fellenberg et al. showed that the miR-224 functions as an important regulator of stem cells induction by targeting the apoptosis inhibitor, API5[
31]. The generation of CSCs involves a process of mesenchymal-to-epithelial transition (MET), therefore factors inducing MET or blocking the EMT by inhibiting TGF-β signaling play an essential role in cell reprogramming[
32]. It is also known that TGF-β/Smad4 signaling plays a crucial role in the regulation of EMT as well as cell stemness in CRC[
27,
33]. We have discovered a novel target of miR-224 (Smad4), which has key function in TGF-β signaling, providing the possibility that miR-224 may mediate CSC by suppressing TGF-β/Smad4 activity. Thus, our studies might provide a potential molecular mechanism and crosstalk of CSC regulation and tumor metastasis.
In summary, the association between increased levels of miR-224 and disease relapse in CRC patients indicated that miR-224 was a potential biomarker for identifying high-risk CRC patients after radical resection. The present data showed that miR-224 had oncogenic effects, including the promotion of CRC cell proliferation, migration and invasion, at least in part by targeting the anti-oncogene SMAD4, highlighting the function of miR-224 in the process of tumor progression.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
ZGJ, XHX and LY performed experiments; ZGJ, ZH and ZT designed research and wrote the paper; ZGJ and ZH analyzed data. All authors read and approved the final manuscript.