Introduction
Over two decades ago cold-induced RNA-binding protein (CIRP) was discovered during the investigation of the mechanisms by which mammals adapt to cold stress. Previous studies have demonstrated that as a general stress-responsive protein, the expression of CIRP can be regulated by various stress conditions, including heat stress, hypoxia, UV irradiation, H2O2, and glucose starvation [
1,
2]. Under these stressful conditions, CIRP can migrate to the cytoplasm from the nucleus and subsequently regulates mRNA stability via binding to the 3’-UTR of target mRNA. Currently, multiple cellular processes are affected by CIRP, such as telomere maintenance, circadian rhythm regulation, cell proliferation, and cell survival [
1,
2].
Heart failure (HF) is a multifactorial disease and often occurs in the end stage of many cardiovascular diseases. Myocardial infarction (MI) is a leading cause of HF with reduced ejection fraction [
3]. After a heart attack, the immune system helps repair ischemic damage and restores tissue integrity. However, excessive inflammation can promote adverse cardiac remodeling and the genesis of HF [
4]. Preconditioning with interventions such as ischemia has shown beneficial effects in reducing infarct size and pathological remodeling in acute myocardial infarction [
5]. Pharmacological preconditioning is also a practical approach to protecting the heart under stressful conditions [
6]. The cardioprotective mechanisms of these preconditioning interventions/agents are associated with the activation or blockade of underlying signaling pathways that contributed to disease progression [
6]. The prognosis of patients with HF is still not ideal despite great improvements in the management of HF. Thus, a new treatment strategy is needed.
Recent studies suggest a beneficial effect of CIRP on the heart. For instance, CIRP was reported to prevent the heart from apoptosis and dysfunction during ex-vivo extended hypothermic heart preservation, as more severe cell apoptosis and a worse cardiac function were found in CIRP knockout rat hearts, whereas CIRP transgenic rat hearts showed the less apoptotic rate of cardiomyocytes and a better cardiac function [
7]. Mechanistic studies showed that CIRP could increase the expression of ubiquinone biosynthesis protein COQ9 at the post-transcriptional level, which could further enhance the biosynthesis of ubiquinone COQ10, thus promoting the production of ATP and protect cells against injury induced by oxidative stress [
7]. In addition, treatment with a CIRP agonist zr17-2 has also been shown to extend heart preservation coupled with increased COQ
10, ATP levels, and scavenging of reactive oxygen species via elevating the protein level of CIRP [
7]. Collectively, these results suggest a beneficial role of CIRP in the heart and pharmacological activation of CIRP by zr17-2 may be a promising strategy in ameliorating heart damage under stress conditions. Moreover, our previous study also found that myocardial CIRP was downregulated in HF patients and post-infarction animals, suggesting a possible role of CIRP in HF [
8]. Additionally, the knockdown of CIRP has been shown to exacerbate H
2O
2-induced cell apoptosis and cell death in cardiomyocytes [
8]. Taken together, these results suggest a potential role of CIRP in the pathogenesis of HF, and the downregulation of CIRP might result in cardiomyocyte apoptosis.
However, currently, there is limited literature that investigates the role of CIRP in HF in vivo, and whether the activation of CIRP could prevent the development of HF is still unknown. Zr17-2 is a recently identified CIRP agonist, which is selected based on the properties of compounds that can bind and modulate the activity of CIRP by using high-throughput virtual screening and cell-based western blot assay [
9]. Zr17-2 has been demonstrated to enhance the expression of CIRP in various organs including the heart [
9]. In this study, we evaluated the effects of the CIRP agonist on the development of HF in a rat model of MI.
Methods
Reagents
Zr17-2 was purchased from AOBIOUS INC (Cat No: AOB33334, USA). Fetal bovine serum (FBS), DMEM medium, streptomycin, and penicillin were obtained from GIBICO (USA) for cell culture.
Ethical approval
Male Sprague-Dawley (SD) rats (6 weeks, weighing from 180 to 220g) were purchased from HFK Biotechnology Company (Beijing, China). All the animal experiment protocols were approved by the Animal Care and Use Committee of Renmin Hospital of Wuhan University and in accordance with ARRIVE gudelines. During the experiment, rats were housed in a temperature-regulated room where the ambient temperature was 22°C and the humidity was 50%. Rats were provided with food and water ad libitum in a 12-h:12-h light/dark cycle. The rats were placed in a bell jar at the end of the experiment, and they were deeply anesthetized with isoflurane for euthanasia.
Myocardial Infarction model
Rats were randomized to sham, MI+saline, and MI+zr17-2 groups. Rats were anesthetized with pentobarbital sodium (40mg/kg, IP) and ventilated by endotracheal intubation using a Zoovent ventilator. MI was induced by ligating the left anterior descending coronary artery (LAD) as previously described [
10]. Successful occlusion of the artery was confirmed by the ST-segment elevation in the electrocardiogram (ECG). The MI+zr17-2 group was treated with zr17-2 (20nmol/kg, i.p.) once every other day 3 times before the operation. The sham group underwent the same procedure as MI-operated rats except for the ligation of LAD.
Echocardiography
Echocardiography was performed using a Vevo2100 imaging system (Visual Sonics Inc., Toronto, Canada). Rats were anesthetized with pentobarbital sodium (40mg/kg), and transthoracic echocardiography was performed by an experienced operator to assess cardiac function. The left ventricular (LV) ejection fraction (LVEF), LV internal diameters in end-diastole (LVIDd), LV fractional shortening (LVFS), LV end-diastolic volume (LVEDV), LV end-systolic volume(LVESV), LV internal diameter at end-systole (LVIDs) and interventricular septum diameter at end-diastole (IVSD) were detected by M-mode tracing system.
Histological analysis
Rats were euthanized and hearts were isolated and immersed in buffered formalin for 24 hours.LV tissues were cut into a series of 5-μm-thick slices and stained with hematoxylin-eosin (H&E) and Sirius red to evaluate collagen deposition, or stained with CD68 antibody followed by FITC conjugated-secondary antibody to evaluate macrophage infiltration. Nuclei were counterstained with DAPI and sections were examined with a fluorescent microscope. The percentage of LV circumference was measured to evaluate infarction size at 7 days post-infarction.
Quantitative real-time PCR
Total RNA was obtained using the Trizol reagent. 5 μg RNA was used to synthesize complementary DNA. qRT-PCR was performed using an Applied Biosystems 7500 Fast Dx Real-time PCR instrument (Thermo Fisher). The primer sequences were shown in Table
1. β-action was used as an internal reference and the fold alterations of each target mRNA level relative to β-actin under different conditions were detected based on the threshold cycle (CT) as r=2
-Δ(ΔCT), where ΔCT=CT (target)-CT (β-action) and Δ(ΔCT) = ΔCT (experimental)- ΔCT (control).
Table 1
The primer sequences for qRT-PCR
β-actin | Rat | GACGTTGACATCCGTAAAGACC | CTAGGAGCCAGGGCAGTAATCT |
IL-6 | Rat | GAGTTGTCAATGGCAATTC | ACTCCAGAAGACCAGAGCAG |
IL-1β | Rat | CACCTCTCAAGCAGAGCACAG | GGGTTCCATGGTGAAGTCAAC |
VCAM-1 | Rat | TCAACTGCACGGTCCCTAAT | TGTGCCAATTTCCTCCCTTA |
ICAM-1 | Rat | AGATCATACGGGTTTGGGCTTC | TATGACTCGTGAAAGAAATCAGCTC |
Enzyme-linked immunosorbent assay (ELISA)
Serum interleukin-6 (IL-6) level was detected using rat commercially available ELISA assay kit (R&D SYSTEM), relying on the product description.
Cell culture and treatment
H9C2 cells (obtained from the Shanghai Institute of Biochemistry and Cell Biology, Shanghai, China) were cultured using DMEM containing high glucose (4.5 g/L) ,10% heat-inactivated FBS, penicillin(100 units/ml), and streptomycin(100 µg/ml) at 37℃in a 5% CO2-humidified incubator. Cells were pretreated with zr17-2 (10µmol/L) for 2 days before the stimulation with H2O2(600µM) for 24 h. Subsequently, cells were subjected to the assay of CCK8 and western blot study.
siRNA transfection
All chemical CIRP-targeting siRNA (siCIRP) and nonsense siRNA (negative control siRNA, siCtrl), described in this study were synthesized by Genscript (Shanghai, China). After cells were plated, siRNA was mixed with lipofectamine RNAiMAX (catalog number:13,778,075, Invitrogen) and then added into cell culture for 48 h according to the manufacturer’s instructions. The final concentration for the nonsense siRNA or CIRP siRNA was 10 nM. The silencing efficiency of the siRNA was verified by the protein level of the targets.
Western blot analysis
Total proteins were extracted from the left ventricular tissues. The protein concentration was determined using the Pierce BCA protein Assay kit (Pierce) and 50 µg protein was collected for SDS-PAGE (Invitrogen) and transferred to a polyvinylidene fluoride membrane (Millipore). Proteins were then incubated with several primary antibodies [NQO-1 (ab2346), IL-1β (ab9722), CIRP (ab106230), collagen III (ab7778), and collagen 1(ab6308) obtained from Abcam; ICAM-1 (sc-107), Bax (sc-7480), VCAM-1(sc-13,160), Bcl2(sc-7382), Nrf2 (sc-81,342), and HO-1 (sc-136,960), GAPDH (sc-47,724), obtained from Santa Cruz; cleaved-caspase 3 (#9661) and TGF-β1 (#3711), purchased from Cell Signaling; collagen I (PA1-26204), purchased from Invitrogen] overnight at 4℃ and then incubated with HRP-conjugated secondary antibodies at room temperature for another 2-hour and the blots were visualized with ECL (Bio-Rad) reagent. The protein expression was normalized to GAPDH.
Statistical analysis
Data are represented as the mean ± S.D. Data were analyzed by one-way ANOVA, followed by Tukey’s Multiple Comparison Test. All statistical analyses were performed in GraphPad Pro 5.0. Statistical significance was set at P < 0.05 (*p < 0.05, **p < 0.001, ***p < 0.001 and ****p < 0.0001).
Discussion
Recent studies have suggested that CIRP exerted a protective effect against cell death under stress conditions in the hearts. For instance, in prolonged ex-vivo heart preservation under hypothermic conditions, CIRP KO hearts were shown to have more cell apoptosis and worse cardiac function, while CIRP transgenic hearts showed less apoptosis and better cardiac function [
7,
13]. Mechanistic studies found that CIRP could positively and post-transcriptionally regulate the protein level of ubiquinone biosynthesis protein COQ9, an essential component in regulating the ubiquinone (CoQ10) biosynthesis, thus promoting ATP production and protecting cells against oxidative stress [
7,
13,
14]. More interestingly, treatment with a CIRP agonist zr17-2 also extended heart preservation, coupled with enhanced expression of CIRP, increased CoQ10 and ATP levels, as well as promoted scavenging of reactive oxygen species [
7,
13]. Taken together, these ex-vivo studies indicate a protective role of CIRP in the heart, and the application of CIRP agonist zr17-2 may have therapeutic potential in the heart under stress conditions. Our previous study showed that CIRP is downregulated in patients with heart failure and animal models of heart failure. However, the significance of such downregulation of CIRP in the development of heart failure is still unknown. In the present study, we used a CIRP agonist zr17-2 as a research tool to test the effects of elevating CIRP expression on the development of heart failure following acute MI. Interestingly, upregulation of CIRP by pretreatment with zr17-2 before the induction of the MI model significantly attenuated MI-induced cardiac dysfunction and dilation, coupled with reduced cardiac infarction size and improved cardiac remodeling. In addition, the beneficial effects of zr17-2 pretreatment on the heart were associated with the downregulation of inflammation and the upregulation of antioxidant genes in the heart. Taken together, our study suggests an important role of CIRP in the development of heart failure and demonstrated a beneficial effect of CIRP agonist zr17-2 in preventing the development of heart failure in the context of MI conditions, possibly via anti-inflammatory and anti-oxidant pathways.
More interestingly, we found an anti-inflammatory effect of CIRP agonist zr17-2 in vivo as evidenced by the reduction in the numbers of macrophage infiltration and the levels of inflammatory cytokine in the MI heart. Studies have shown that inflammatory response following acute MI plays a critical role in determining acute MI size and subsequent post-MI adverse LV remodeling [
11]. Following acute MI, local cellular injury and death could initiate a pro-inflammatory response and result in the recruitment of inflammatory cells into the MI zone which may further induce the death of cardiomyocytes and extend ischemic injury beyond the original MI zone [
11]. Therefore, anti-inflammatory therapy has the potential to reduce cardiomyocyte injury associated with MI. The identified anti-inflammatory role of zr17-2 may contribute to better cardiomyocyte preservation and subsequent cardiac function in the context of MI conditions. In addition, we also found that pretreatment with zr17-2 reduced IL-6 levels in serum in the MI rats. As clinical studies have provided evidence that targeting serum IL-6 with an anti-IL-6R antibody could reduce peri-procedural myocardial injury in acute MI patients [
15], the effect of zr17-2 on serum IL-6 level may also contribute to less cardiac injury.
Nrf2 regulates the transcription of antioxidant defense enzymes in the cell and is important for regulating cellular resistance to oxidative stress. Activation of antioxidant genes, including HO-1 and NQO-1, is mediated by Nrf2, which translocates into the nucleus and binds to the antioxidant response element in the DNA promoter region. Nrf2 and its regulated downstream antioxidant genes have been reported to be downregulated in post-MI hearts, contributing to the occurrence of an oxidative stress injury in the MI hearts and the development of heart failure [
16‐
18]. In our study, we also observed that the gene levels of Nrf2, HO-1 and NQO-1 were markedly downregulated in the post-MI hearts. However, the reduction in the expression of Nrf2 and its downstream antioxidant genes were significantly recovered in the zr17-2-pretreated group, suggesting a role of zr17-2 in regulating cellular antioxidant capacity. In addition, we also evaluated the direct effect of zr17-2 on the expression of Nrf2 and its downstream antioxidant genes in the heart in vitro and in vivo. Interestingly, the protein levels of Nrf2, HO-1, and NQO-1 could also be elevated by the direct treatment with zr17-2 both in vitro and in vivo (Fig.
5B and supplemental Figure S
1). Moreover, our in vitro study also demonstrated a direct cardioprotective effect of zr17-2 against H
2O
2 stimulation. These results suggest an antioxidant effect of zr17-2 in the heart. Importantly, genetically knocking down CIRP could block the protective effect of zr17-2 against oxidative stress in response to H
2O
2 stimulation. These results suggests that the antioxidant role of zr17-2 is dependent on CIRP. Our previous study also showed that CIRP can protect cells against oxidative stress injury, as silencing of CIRP leads to more cell apoptosis in response to H
2O
2 stimulation [
8]. Furthermore, CIRP overexpression in neural cells has been shown to increase key antioxidant enzyme levels, including glutathione (GPx), superoxide dismutase (SOD), and catalase (CAT) [
19]. Interestingly, the antioxidant enzymes listed above can be controlled by Nrf2 [
20]. Moreover, our recent mechanistic study also identified the Nrf2 pathway as the downstream target of CIRP, and CIRP knockdown could lead to the downregulation of Nrf2 and its regulated antioxidant genes [
12]. Collectively, these results indicate a possible role of CIRP and its agonist zr17-2 in regulating the Nrf2 antioxidant system, and further studies in vitro cultured primary cardiomyocytes are needed to verify the relationship between CIRP or its agonist zr17-2 in regulating the Nrf2 antioxidant system.
It should be noted that the possible toxicity of zr17-2 was not evaluated in our present study. As it is of vital importance to determine the safety of drugs, further toxicity studies should be performed to evaluate the possible effects of zr17-2 on other organs such as the liver and kidney. In addition, we did not evaluate the systemic hemodynamic parameters, which would be a good complement to the echocardiography analysis and would make the conclusion more convincing. In the present study, we only evaluate the early effects of zr17-2 on the post-MI hearts at 7 days, the evaluation of the cardiac function and histology at later time points including 2 or 4 weeks after MI would be more valuable to determine the long-term effects of zr17-2 on the heart. Another limitation is that a drug control group was lacking in vivo. Whether zr17-2 has any direct effects and inflammatory response is still unknown and further studies are needed to determine this. Additionally, CIRP has also been considered a proto-oncogene that activates several cell cycle-related proteins leading to cancer promotion. Therefore, whether elevation of CIRP by zr17-2 has any pro-carciogenic effects needs to be investigated. In the present study, as zr17-2 was only administered for a short time (three injections in one week), we did not observed any apparent abnormalities in the outward appearance of the skin, lungs and live of the experimental rats. Thus, longer-term observational studies are warranted to determine the long-term effects of zr17-2 administration.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.