Background
OSCC presents a major health burden in Sub-Saharan Africa, and novel chemotherapies are urgently needed to combat this disease. HSP90 has been shown to be overexpressed in a number of cancers, and presents an attractive target for anti-cancer therapy, as it plays a central role in contributing to the maintenance of a number of the characteristic hallmarks of cancer cells, by chaperoning key proteins, and maintaining active conformations of signalling proteins, reviewed in [
1]. These include important signalling proteins like EGFR and IGF1-R that have been implicated in sustaining the neoplastic phenotype in OSCC [
2].
Different HSP90 inhibitors have been shown to have promise as chemotherapeutics.
These include the family of benzoquinone ansamycins (BA’s), such as geldanamycin and its derivatives 17-AAG and 17-DMAG. It has been suggested that 17-AAG could be useful for treatment of OSCC [
2]. There are several drawback to this class of drugs, which are reviewed in [
3], most notably the induction of hepatotoxicity. This results from one electron reduction by members of the cytochrome p450 family. This reaction results in unstable intermediates, damaging the tissue, which manifests as severe hepatotoxicity [
4]. On the other hand, the benzoquinone ansamycins can also undergo two electron reduction by the enzyme NADPH quinone oxidoreductase 1 (NQO1), which results in a compound with higher affinity for HSP90, which is therefore a more potent inhibitor [
5,
6].
The gene encoding NQO1 has been found to contain a single nucleotide polymorphism at position 609. The C609T SNP causes a proline to serine mutation at position 187 [
7], allowing ubiquitination of NQO1 and reducing stability of the protein [
8]. Thus, the SNP is effectively a null mutation, as patients homozygous for T at position 609 will express NQO1 that is rapidly degraded by the proteasome.
We aimed to examine the potential of 17-AAG as a chemotherapeutic drug for OSCC, using a panel of cell lines with different NQO1 levels. Results indicated that NQO1 status could be an important determining factor in tumour response to 17-AAG. We next investigated whether the presence of NQO1 enzyme could be predicted with either the absence of the C609T SNP, or expression levels of NQO1 mRNA. Although neither factor alone was sufficient, SNP analysis could allow exclusion of a cohort of NQO1-negative patients who would be less sensitive to 17-AAG.
Methods
Cell lines, plasmids, transfections and drugs
17-AAG was purchased from Calbiochem. The human OSCC cell lines WHCO1 and WHCO6, derived from South African patients, were a gift from Prof R. Veale, and described in [
9]. The Kyse cell lines were purchased from DSMZ, Germany. All cells were grown in DMEM with 10% FCS, in the presence of penicillin and streptomycin. The plasmids for overexpression of NQO1 (pEFIRES-empty, and pEFIRES-NQO1) were a kind gift from Yosef Shaul (Weizmann Institute of Science) [
10]. Cells were transfected using Transfectin (BioRad) and transfected cells were selected using puromycin (Calbiochem). Pools of stably transfected cells were maintained in 1.5 μg/ml puromycin.
MTT assay
Cells were plated in 96 well plates at a density of 5000 cells per well. The following day, cells were treated with drug at different concentrations. After 2 or more days of incubation, 10 μl of sterile MTT solution (5 mg/ml in PBS) was added to each well, and plates were incubated for 4 hours. Thereafter, 100 μl of solubilisation reagent (10% SDS, 0.01M HCl) was added to each well. Plates were incubated at 37°C overnight, before the absorbance was measured at 595 nm.
Western blotting
Proteins were harvested in RIPA buffer, and sonicated for 10s. Protein concentration was calculated using the BCA kit (Pierce). Equal amounts of protein were separated on a polyacrylamide gel, and transferred to a nitrocellulose membrane (Amersham). Membranes were blocked in 5% fat free milk powder, before incubation with the following primary antibodies: NQO1 A180 (sc32793); GAPDH 0411 (sc47424); β tubulin H235 (sc9104); PARP 1/2 H250 (sc7150) (all from Santa Cruz Biotechnology).
SNP analysis
Genomic DNA was harvested from cell lines using Qiazol, according to the user defined protocol provided on the manufacturer’s website. PCR was performed using Amplitaq Gold (Applied Biosystems), and primer sequences from [
11]. PCR products were purified using Wizard SV Spin columns (Promega) before being digested overnight with Hinf1 (Thermo Scientific). Digested DNA fragments were analysed by polyacrylamide gel electrophoresis, staining with ethidium bromide.
Quantitative RT-PCR
Total RNA was harvested from cells at approximately 60- 80% confluency using the Qiazol reagent (Qiagen), according to the manufacturer’s instructions. After agarose gel electrophoresis to confirm RNA integrity, 1μg was reverse transcribed using random hexamer primers, and Impromtu RTase (Invitrogen). cDNA was submitted to quantitative RT-PCR using Sybr-fast reaction mix (Kapa Biosystems), and primers for HSP90α (F: TGAGGACAGACACAGGTGAAC 3′ and R: TGGTCCAGATGGGCTTTGTT 3′) NQO1 (F: TGAAGAAGAAAGGATGGGAGG3′ and R: AGGGGGAACTGGAATATCAC 3′) and β actin (F: AGGAAGGAAGGCTGGAAGAG 3′ and R: ATCGTGCGTGACATTAAGGAG3′). β actin was used as a housekeeping gene. Relative expression was calculated using comparative Ct values. Results of two to three independent experiments were pooled.
Statistical analysis
GraphPad Prism software was used for statistical analysis, as indicated in figure legends. For MTT dose response assays, absorbance values were analysed by nonlinear regression, with a sigmoidal curve (variable slope), allowing calculation of the IC50 value. Dose response experiments were repeated several times in each cell line, and data were pooled to give a more accurate estimation of the IC50 and 95% confidence intervals around the value.
Discussion
Our results show a clear correlation between NQO1 levels and sensitivity to 17-AAG as expected [
5]. Although NQO1 activation is considered necessary for 17-AAG activity [
3], even OSCC cell lines without detectable NQO1 showed considerable sensitivity to 17-AAG, with IC
50 concentrations around 1μM. Although this might lead one to overestimate the promise of 17-AAG as a chemotherapeutic option for OSCC, one must be mindful of the limitations of this in vitro study. Firstly, we have not measured the negative side effects attributed to the drug. Indeed, a recent clinical trial of 17-AAG found that the severity of the side effects outweighed the clinical benefit to patients with solid tumours [
13]. However, this clinical trial did not investigate NQO1 levels in the enrolled patients, nor has any trial testing 17-AAG done so, to the best of our knowledge. This may have important implications as we describe below. Secondly, there are indications in the literature that cultured cell lines may express higher levels of NQO1 than lung and colon patient tumour tissue [
14]. We have not been able to directly compare NQO1 levels in cell lines and OSCC tumour tissue, but in vivo expression may well not be as high as that observed in the cultured cell lines.
The findings of this report suggest that if patients could be stratified on the basis of NQO1 protein levels, then OSCC patients expressing NQO1 could potentially benefit from administration of low doses of 17-AAG, possibly in combination with other chemotherapeutics. This is because NQO1 positive patients would likely be responsive to much lower concentrations of the drug. The low dose of 17-AAG would limit the extent of toxic side effects experienced, as observed in clinical trials, where at the six lowest doses administered (6- 125 mg/m
2), only one out of 20 patients experienced dose-limiting toxicity, compared with eight out of fifteen patients on the two highest doses (175- 225 mg/m
2) [
13]. Since severe hepatotoxicity resulting from 17-AAG treatment is reported to be due to metabolism by a different family of reductases [
4], this is unlikely to correlate with NQO1 expression, although this would need to be confirmed in vivo. Furthermore, very low concentrations of 17-AAG would likely have minimal effect on normal cells, even those expressing NQO1, due to their much lower reliance on HSP90. However, there is a clear need for further in vivo testing to confirm that the presence or absence of NQO1 does not affect hepatotoxicity, and that severe side-effects can be mitigated by administration of sufficiently low doses.
An alternative possibility may be the approach proposed by Karkoulis and co-workers [
15] for the treatment of bladder cancer. These authors propose that the negative side effects of BA chemotherapeutics (in this case geldanamycin) may be mitigated by orthotopic administration of drug. In the case of OSCC, similar to bladder cancer, the tumour site is relatively accessible; therefore an orthotopic delivery may also be feasible. This would allow exposure to dosages that effectively target the tumour, without reaching systemic concentrations that cause hepatotoxicity.
We noticed that 17-AAG treatment resulted in a dose-dependent decrease in endogenously and exogenously expressed NQO1. This is similar to the effect reported by Gaspar and co-workers [
16] who suggested that this down-regulation of NQO1 by 17-AAG may play a role in acquisition of resistance to the drug. We found that there was no down-regulation of NQO1 mRNA levels (Additional file
2: Figure S2), suggesting a post-transcriptional mechanism of control. It is not clear what this mechanism may entail, since disruption of HSP90 activity affects a wide range of cellular functions. Although there is no evidence supporting a direct interaction between NQO1 and HSP90, NQO1 levels are reported to depend heavily on FAD levels [
17], which may be disrupted by HSP90 inhibition.
It was interesting to note that the absence of detectable NQO1 in two of the cell lines (WHCO1 and WHCO6) could not be accounted for by the presence of the C609T SNP, but rather seemed to correlate with low expression of the NQO1 gene. Further investigation in tumour samples could shed light on whether this accurately reflects NQO1 expression in patients, or whether it is an artefact of a subset of cultured cell lines. The possibility therefore exists that expression of NQO1 could be induced in these two cell lines under particular environmental circumstances, such as those which may be experienced in cells of a solid tumour, e.g. the presence of reactive oxygen species or hypoxia. We postulate that due to the possibility of induction of the gene in a tumour setting, it will be necessary to specifically investigate NQO1 protein levels in biopsies, in order to estimate potential sensitivity to 17-AAG. This could be done using protein detection (Western blot/immunohistochemistry), or using an NQO1 enzyme activity assay. However, the SNP could be used as a rapid test to exclude patients with a TT genotype, who would not express NQO1 and would therefore be poor candidates for 17-AAG treatment.
The relevance of NQO1 levels in the clinical setting has been discussed by Siegel et al. [
18]. The authors make the point that NQO1 levels and activity may not remain stable over the course of the treatment, limiting the predictive value of a protein assay, and supporting use of the SNP as a better biomarker of 17-AAG responsiveness. If the SNP were used as a biomarker for responsiveness, patients with the homozygous null mutation, who will certainly not express active NQO1 could easily be excluded from 17-AAG treatment. While SNP analysis could provide a relatively simple tool for elimination of non-expressors, some patients with the wild-type genotype may also express low levels of the protein, and also be less sensitive to 17-AAG treatment. Thus we propose that 17AAG may still hold promise as a chemotherapy, under certain conditions. These include that the drug either be administered orthotopically, or at low concentrations, using the C609T SNP as a screen to exclude non-expressors of NQO1 who would be poor responders.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
KEH performed all the experiments and drafted the manuscript. DTH participated in experimental design and helped draft the manuscript. Both authors read and approved the final manuscript.