Background
Microglia are innate immune cells of the central nervous system that constantly move through the brain parenchyma and constitute an immune surveillance system [
1,
2]. Microglia become activated in response to various stimuli or injury and produce inflammatory mediators such as nitric oxide (NO), cytokines, and matrix metalloproteinases (MMPs). Alternatively, activated microglia produce anti-inflammatory cytokines and lead to matrix deposition and wound healing [
3,
4]. Thus, the balance between the inflammatory M1 and the anti-inflammatory M2 phase of microglial activation is important to maintain homeostasis in the brain. However, prolonged and unresolved inflammatory response leads to destructive, chronic inflammation (neuroinflammation) that results in neuronal cell death and ultimately in the onset of neurodegenerative diseases [
5,
6]. Therefore, inhibition of exaggerated inflammatory responses by microglia has been suggested as an important strategy to develop therapeutic agents for various neuroinflammatory disorders.
β-Lapachone (3,4-dihydro-2,2-dimethyl-2
H-naphtho[1,2-b]pyran-5,6-dione; β-LAP) is a natural compound which was originally isolated from the bark of the South American lapacho tree (
Tabebuia avellanedae) [
7]. β-LAP has been reported to have a wide variety of pharmacological effects including anti-inflammatory, anti-cancer, anti-bacterial, anti-fungal, anti-platelet, and anti-angiogenic action [
8‐
10]. In particular, β-LAP exerts anti-neoplastic effects against various human cancer cell lines, and it is now being used in clinical trials for the treatment of various forms of cancer [
11‐
13]. β-LAP has topoisomerase inhibitory activity and elevates NQO1 levels, leading to a futile redox cycle and apoptosis of cancer cells [
11,
14]. A recent study reports that β-LAP attenuates cisplatin-mediated nephrotoxicity by increasing NAD
+ levels with elevated tumoricidal effects of cisplatin [
15]. Several studies have reported anti-inflammatory effects of β-LAP. β-LAP suppresses inflammatory responses in activated macrophages and protects from lung edema and high mortality in septic mice [
16]. β-LAP alleviates carrageenan-induced rat paw edema by suppressing neutrophil migration and cytokine production [
17]. In addition, β-LAP induces anti-inflammatory heme oxygenase-1 (HO-1) via AMPK activation in RAW264.7 macrophages and endothelial cells [
18,
19]. A previous study has shown anti-inflammatory effects of β-LAP in activated microglia [
20]. It was demonstrated that β-LAP inhibits inducible nitric oxide synthase (iNOS) and cytokine expressions in lipopolysaccharide (LPS)-stimulated BV2 cells. However, the in vivo effects of β-LAP and the detailed molecular mechanism underlying the anti-inflammatory effects of β-LAP have not been fully elucidated.
Therefore, in the present study, we examined the anti-inflammatory effects of β-LAP under both in vitro and in vivo neuroinflammatory conditions and analyzed, in detail, the molecular mechanism. In particular, we investigated the effects of β-LAP on the gene expression and activity of MMPs, because our group recently demonstrated the proinflammatory role of MMPs in activated microglia [
21‐
23]. Through this study, we report for the first time that β-LAP inhibits microglial activation and expression of iNOS, cytokines, and several MMPs in the LPS-injected mouse brain. Furthermore, we demonstrated that multiple signaling pathways are involved in the anti-inflammatory mechanism of β-LAP in activated microglia.
Materials and methods
Reagents and antibodies
All reagents for cell culture were purchased from Gibco BRL (Grand Island, NY, USA). β-Lapachone and LPS (Escherichia coli serotype 055:B5) were obtained from Sigma–Aldrich (St. Louis, MO, USA). All reagents and enzymes for reverse transcription polymerase chain reaction (RT-PCR) and oligonucleotides for electrophoretic mobility shift assay (EMSA) were purchased from Promega (Madison, WI, USA). Antibodies against phospho-/total forms of MAPKs, CREB, β-actin, MMPs (MMP-3, MMP-8, MMP-9), and tissue inhibitor of metalloproteinase-2 (TIMP-2) were supplied by Cell Signaling Technology (Beverley, CA, USA), Abcam (Cambridge, UK), or Chemicon (Temecula, CA, USA). Antibodies against HO-1, NQO1, and Iba1 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA) or Novus (Littleton, CO, USA). The antibody for phospho-p47phox (Ser370) was purchased from Assay Biotechnology Company Inc. (Sunnyvale, CA, USA). All other chemicals were obtained from Sigma–Aldrich, unless otherwise stated.
Microglial cell cultures
The immortalized mouse BV2 microglial cell line [
24] was grown and maintained in Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 10 % heat-inactivated fetal bovine serum, streptomycin (10 μg/ml), and penicillin (10 U/ml) at 37 °C under 5 % CO
2. Primary microglial cells were cultured from the cerebral cortices of 1- to 2-day-old Sprague Dawley rat pups as described previously [
21]. The purity of microglial cultures was >95 %, as confirmed by Western blot and immunocytochemistry analyses using an antibody specific to ionized calcium-binding adapter protein-1 (IBA-1) staining (data not shown).
Measurement of cytokines, nitrite, and intracellular ROS levels
Cells (1 × 10
5 cells per well in a 48-well plate) were pretreated with β-LAP for 1 h and further stimulated with LPS (100 ng/ml) for 16 h. Concentrations of TNF-α, IL-1β, IL-6, and IL-10 in conditioned medium (CM) were measured by ELISA using monoclonal antibodies and procedures recommended by the supplier (PharMingen, San Diego, CA). Accumulated nitrite in CM and intracellular accumulation of reactive oxygen species (ROS) were measured using Griess reagent (Promega) and H
2DCF-DA (Invitrogen, La Jolla, USA), respectively, as previously described [
25].
Assays for MMP-3, MMP-8, and MMP-9 activity
BV2 cells were stimulated with LPS in the presence or absence of β-LAP for 24 h, and the supernatants were collected to measure MMP activity using the SensoLyte® 520 MMP assay system (AnaSpec, San Jose, CA, USA). MMP activity measurements were performed by continuous detection of peptide cleavage using a fluorescence plate reader (Molecular Devices, Sunnyvale, CA, USA). MMP activity units were expressed as a change in the fluorescence intensity at an excitation wavelength of 490 nm and an emission wavelength of 520 nm.
LPS-induced inflammation and administration of β-LAP
C57BL/6 mice (10–11 weeks old) were purchased from the Orient Co., Ltd. (Seoul, Korea). All animal experiments were approved by the Institutional Animal Care and Use Committee at the School of Medicine, Ewha Womans University. All efforts were made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques, if available. Systemic inflammation was induced by LPS administration (5 mg/kg, i.p.) to male C57BL/6 mice as previously described [
26]. β-LAP (10 mg/kg, i.p.), dissolved in vehicle solution (1 % DMSO and normal saline), was given daily for 4 days before the LPS treatment. Samples were obtained 3 or 6 h after LPS treatment.
Immunohistochemistry
Three hours after LPS treatment, the animals were anesthetized with sodium pentobarbital (120 mg/kg i.p.) and perfused transcardially with normal saline containing heparin (5 U/ml), followed by 4 % paraformaldehyde (PFA) in 0.1 M sodium phosphate buffer (PBS), pH 7.2. The brains were removed and incubated overnight in fixatives and stored in a 30 % sucrose solution. Serial coronal brain sections of regions containing the hippocampus (20 μm thick, at 600-μm intervals) were collected using a cryostat. Brain sections were incubated in PBS containing 0.1 % Triton X-100, 5 % normal serum, and 1 % bovine serum albumin for 1 h, and then subsequently incubated with primary antibody. On the next day, sections were incubated in a 1:200 dilution of Alexa Fluor 488-labeled donkey anti-rabbit secondary antibody or Alexa Fluor 594-labeled chicken anti-goat antibody (Molecular Probes Inc., Eugene, OR, USA) for 60 min at room temperature, and then washed with 0.05 % Tween 20 in PBS three times, 5 min each. Sections were then stained with a 0.5-μg/ml DAPI staining solution for 20 min at room temperature and washed. The sections were mounted with Vectashield mounting medium (Vector Laboratories, Burlingame, CA, USA), and fluorescence microcopy images were obtained using confocal microscopy (TSC-SP, Leica, Heidelberg, Germany). Iba1-, MMP-3-, MMP-8-, and MMP-9-positive cells were quantified using the Metamorph program (Carl Zeiss, Jena, Germany). Two serial brain sections from each animal were used for further analysis, and quantification of Iba1-, MMP-3-, MMP-8-, and MMP-9-positive cells was performed in three different areas (500 μm2 in size) in the lateral cortex and dentate gyrus of the right hemisphere per brain section. The mean cell number from six 500-μm2 areas per animal was calculated.
RT-PCR
Total RNA (1 μg) isolated from BV2 or primary microglial cells (4.5 × 10
5 cells on a 6-cm dish), or from the brain tissue of LPS-injected mice, was reverse transcribed, and synthesized cDNA was used as a template for PCR. RT-PCR was performed on a T100 Thermal Cycler (Bio-Rad) with GoTaq polymerase (Promega). The primer sets shown in Table
1 were used to detect specific PCR products, and their values were calculated as fold change relative to control after normalization to the GAPDH gene.
Table 1
Primers used in RT-PCR reactions
Mouse | TNF-α | CCTATGTCTCAGCCTCTTCT | CCTGGTATGAGATAGCAAAT | 354 |
iNOS | CAAGAGTTTGACCAGAGGACC | TGGAACCACTCGTACTTGGGA | 450 |
IL-1β | GGCAACTGTTCCTGAACTCAACTG | CCATTGAGGTGGAGAGCTTTCAGC | 447 |
IL-6 | CCACTTCACAAGTCGGAGGCTT | CCAGCTTATCTGTTAGGAGA | 395 |
IL-10 | GCCAGTACAGCCGGGAAGACAATA | GCCTTGTAGACACCTTGGTCTT | 409 |
MMP-3 | ATTCAGTCCCTCTATGGA | CTCCAGTATTTGTCCTCTAC | 375 |
MMP-8 | CCAAGGAGTGTCCAAGCCAT | CCTGCAGGAAAACTGCATCG | 180 |
MMP-9 | GTGATCCCCACTTACTATGGAAAC | GAAGCCATACAGTTTATCCTGGTC | 352 |
TIMP-2 | TCTAATTGCAGGAAAGGCAGA | TGCTCTTCTCTGTGACCCAGT | 218 |
HO-1 | TGTCACCCTGTGCTTGACCT | ATACCCGCTACCTGGGTGAC | 209 |
NQO1 | AGAGGCTCTGAAGAAGAGAGG | CACCCTGAAGAGAGTACATGG | 401 |
p47phox
| CGATGGATTGTCCTTTGTGC | ATCACCGGCTATTTCCCATC | 256 |
p67phox
| CTTCAACATAGGCTGCGTGA | CTTCATGTTGGTTGCCAATG | 334 |
p22phox
| AAAGAGGAAAAAGGGGTCCA | TAGGCTCAATGGGAGTCCAC | 239 |
gp91phox
| GTCAAGTGCCCCAAGGTATCCA | TTGTAGCTGAGGAAGTTGGC | 453 |
GAPDH | ATGTACGTAGCCATCCAGGC | AGGAAGGAAGGCTGGAAGAG | 420 |
Rat | TNF-α | AAGTTCCCAAATGGGCTCCCT | TGAAGTGGCAAATCGGCTGAC | 306 |
iNOS | GCAGAATGTGACCATCATGG | ACAACCTTGGTGTTGAAGGC | 426 |
IL-1β | AAATGCCTCGTGCTGTCTGACC | TCCCGACCATTGCTGTTTCCT | 377 |
IL-6 | TCATTCTGTCTCGAGCCCAC | GAAGTAGGGAAGGCAGTGGC | 345 |
IL-10 | AGGGCTGCCTTCAGTCAAGT | AGAAATCGATGACAGCGTCG | 396 |
MMP-3 | GTACCAACCTATTCCTGGTTGC | CCAGAGAGTTAGATTTGGTGGG | 231 |
MMP-8 | TACAACCTGTTTCTCGTGGCTGC | TCAACTGTTCTCAGCTGGGGATG | 317 |
MMP-9 | AAGTTGAACTCAGCCTTTGAGG | GTCGAATTTCCAGATACGTTCC | 225 |
TIMP-2 | CGTAGTGATCAGAGCCAAGC | TCTGCCTTTCCTGCAATTAGA | 225 |
GAPDH | GTGCTGAGTATGTCGTGGAGTCT | ACAGTCTTCTGAGTGGCAGTGA | 292 |
Western blot analysis
Proteins isolated from total cell lysates, and from CM, were separated by SDS-PAGE, transferred to nitrocellulose membranes, and incubated with primary antibodies against MMP-3, MMP-8, and MMP-9; TIMP-2 (1:1000); the phospho- or total form of MAP kinases or CREB; HO-1; NQO1 (1:1000); or p-p47phox [anti-phospho-(Ser345)-p47phox Ab] (1:1000, Assay Biotechnology). After thorough washing with Tris-buffered saline with Tween 20 (TBST), horseradish peroxidase-conjugated secondary antibodies (1:2000 dilution in TBST; New England Biolabs, Beverly, MA, USA) were applied, and the blots were developed using an enhanced chemiluminescence detection kit (Pierce Biotechnology, Rockford, IL, USA). To detect secreted MMPs, MMP proteins in the conditioned media were enriched using an Amicon® centrifugal filter (Millipore Corp., Billerica, MA, USA).
Transient transfection and luciferase assay
BV2 cells plated at 50–60 % confluence (2 × 10
5 cells per well) in 12-well plates were transfected with 1 μg of plasmid DNA (ARE-luc, CRE-luc) using the Convoy™ Platinum transfection reagent (CellTAGen, Seoul, Korea). After 36 h of transfection, cells were treated with β-LAP and LPS (100 ng/ml), or β-LAP only, for 6 h. The luciferase assay was used to determine the effect of β-LAP on ARE or CRE promoter activity. The ARE-luciferase reporter gene was kindly provided by Dr. Young-Joon Surh (Seoul National University, Seoul, Korea). The sequence of the anti-oxidant response element (ARE) construct is as follows: 5′-CTCAGCCTTCCAAATCG CAGTCACAGTGACTCAGCAGAATC-3′ [
27,
28]. The CRE-luc vector, which contains four copies of the cyclic AMP response element (CRE, TGACGTCA), was obtained from Stratagene (La Jolla, CA).
EMSA
Nuclear extracts from treated microglia were prepared as follows. Cells (2 × 107) were treated with 1 ml of lysis buffer (10 mM Tris–HCl, pH 7.9; 10 mM NaCl; 3 mM MgCl2; 1 % NP-40) on ice for 5 min. After 10 min of centrifugation at 3000 rpm, the pellet was resuspended in 50 μl of extraction buffer (20 mM HEPES, pH 7.9; 20 % glycerol; 1.5 mM MgCl2; 0.2 mM EDTA; 300 mM NaCl; 1 mM DTT; 1 mM PMSF) and incubated on ice for 30 min. After centrifugation at 13,200 rpm for 15 min, the supernatant was harvested as a nuclear protein extract and stored at −70 °C. Double-stranded DNA oligonucleotides containing the NF-κB, AP-1, ARE, or CRE consensus sequences were end labeled using T4 polynucleotide kinase (New England Biolabs, Beverly, MA) in the presence of [γ-32P]ATP. Nuclear proteins (5 μg) were incubated with 32P-labeled probe on ice for 30 min, resolved on a 5 % acrylamide gel, and visualized by autoradiography. We purchased double-stranded DNA oligonucleotides containing the NF-κB, AP-1, or CRE consensus sequences from Promega (Madison, WI, USA) and that containing ARE from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The DNA sequences of the probes are as follows: NF-κB (5′-AGTTGAGGGGAC TTTCCCAGGC-3′), AP-1 (5′-CGCTTGATGAGTCAGCCGGAA-3′), ARE (5′-TGG GGAACCTGTGCTGAGTCACTGGAG-3′), and CRE (5′-AGAGATTGCCTGACGTCAGAGAGCTA-3′).
Statistical analysis
Unless otherwise stated, all experiments were performed with triplicate samples and repeated at least three times. Data are presented as mean ± SEM, and statistical comparisons among groups were performed using one-way ANOVA followed by Newman–Keuls post hoc tests or t tests. Statistical significance was accepted for P values <0.05.
Discussion
Our present study demonstrates the anti-inflammatory properties of β-LAP in brain microglia and their underlying molecular mechanisms. β-LAP inhibited the expressions of iNOS and proinflammatory cytokines in LPS-stimulated microglia. In addition, β-LAP reduced the expression and activity of MMP-3, MMP-8, and MMP-9, which are inflammatory mediators in activated microglia [
21‐
23]. By using a systemic inflammation mouse model, we confirmed the anti-inflammatory role of β-LAP. Thus, β-LAP inhibited microglial activation and the expression of proinflammatory molecules in the LPS-injected mouse brain. By mechanistic analysis, we showed that β-LAP inhibited the phosphorylation of MAPKs and AKT and the DNA binding activity of NF-κB/AP-1 induced by LPS. Furthermore, we found that β-LAP exerts anti-oxidant effects by reducing ROS production via suppression of NADPH oxidase subunit activity and/or expression, and upregulation of anti-oxidant enzymes such as HO-1 and NQO1. We showed that β-LAP activated Nrf2/ARE and PKA/CREB pathways, which are involved in the upregulation of HO-1/NQO1 expression. Therefore, β-LAP appears to act as an anti-inflammatory/anti-oxidant agent by modulating multiple signaling pathways (i.e., inhibition of MAPKs and PI3K/AKT, upregulation of Nrf2/ARE and PKA).
A previous study reported that β-LAP inhibits the mRNA expression of TLR4 signaling molecules in experimental autoimmune encephalomyelitis mice [
37]. In the present study, however, β-LAP did not affect the mRNA expression of TLR4 or MyD88 in LPS-stimulated microglia (Additional file
1: Figure S1), suggesting that β-LAP exerts anti-inflammatory effects by modulating signaling downstream of TLR4/MyD88 and/or via a MyD88-independent pathway. In addition, we found that β-LAP also inhibited the inflammatory reactions induced by TLR2 or TLR3 agonists. Treatment with β-LAP inhibited NO and TNF-α production in BV2 cells stimulated with lipoteichoic acid (LTA; TLR2 agonist) or polyinosinic–polycytidylic acid (Poly I:C; TLR3 agonist) (Additional file
1: Figure S2). Thus, the data imply that the anti-inflammatory effect of β-LAP is not confined to TLR4 activation. Further studies are necessary to investigate the detailed mechanism underlying the effect of β-LAP on TLR signaling.
MMPs are zinc-dependent endopeptidases which are involved not only in normal brain development but also in various neuropathological conditions such as Alzheimer’s disease, Parkinson’s disease, stroke, and multiple sclerosis [
38]. MMPs are aberrantly expressed in neuropathological conditions and cause breakdown of the blood–brain barrier (BBB), infiltration of peripheral immune cells, demyelination, and neuronal cell death [
39,
40]. Our group recently reported that MMPs play an important role in various neuroinflammatory conditions [
21‐
23]. We showed that MMP-3, MMP-8, and MMP-9 are upregulated in LPS or α-synuclein-stimulated microglia and mediate neuroinflammatory reactions. Thus, the specific inhibition of MMP-3, MMP-8, or MMP-9 suppresses iNOS and cytokine expressions in LPS or α-synuclein-stimulated microglia. We demonstrated that MMPs cleave the N-terminal extracellular domain of protease-activated receptor-1 and activate intracellular inflammatory signaling pathways in α-synuclein-activated microglia [
21]. More recently, we showed that MMP-8 plays a pivotal role in neuroinflammation by activating TNF-α processing in microglia [
22]. We also reported that TIMP-2, as an endogenous inhibitor of MMPs, has an anti-inflammatory effect by modulating MMP-3, MMP-8, and MMP-9 in activated microglia [
29]. Based on these findings, our present study examined the effects of β-LAP on MMPs and TIMP-2 in LPS-stimulated microglia. We observed that β-LAP significantly suppressed the expression and activity of MMP-3, MMP-8, and MMP-9 with enhancement of TIMP-2 under in vitro and/or in vivo neuroinflammatory conditions, which may contribute to the anti-inflammatory properties of β-LAP.
In this study, we found that β-LAP induced phase II anti-oxidant enzymes such as HO-1 and NQO1, which are regulated through the Nrf2/ARE signaling pathway [
34]. Under normal conditions, Nrf2 is sequestered by cytosolic Keap1, which serves as an adaptor to link Nrf2 to the ubiquitin ligase Cul3–Rbx1 complex that ubiquitinates and degrades Nrf2. However, upon stimulation by electrophilic agents or ROS, Nrf2 dissociates from its cytosolic docking protein Keap1, translocates into the nucleus, and binds to the ARE site [
41]. It has been suggested that Nrf2 phosphorylation is involved in this release process. In the present study, we observed that β-LAP increased Nrf2 binding to ARE, as well as ARE-mediated transcriptional activity. However, we did not further examine the effect of β-LAP on the Nrf2 release mechanism related to Keap1; this would be an interesting study in the future.
It is well-known that β-LAP is a substrate and activator of NQO1, which catalyzes the oxidation of NADH to NAD
+. A recent study reported that β-LAP induces HO-1 expression by increasing NQO1 activity and AMPK phosphorylation in RAW264.7 macrophages [
18,
19]. As a mechanism to resolve the neurotoxic responses brought about by microglial activation, microglia usually express anti-inflammatory cytokines (i.e., IL-10, TGF-β1), suppressor of cytokine signaling (SOCS)-family proteins (i.e., SOCS1 and SOCS3), and anti-oxidant enzymes (i.e., HO-1, NQO1, SOD) [
42,
43]. In the present study, we found that LPS itself increased HO-1 expression, which is associated with ARE-dependent transcription. We previously reported that the activation of PKA/CREB signaling is upstream of HO-1 expression and that the upregulation of the HO-1 and PKA pathway plays a key role in mediating the anti-inflammatory mechanism in LPS-stimulated microglia [
35]. Therefore, the potentiation of HO-1/ARE and PKA/CREB by β-LAP may at least partly contribute to the anti-inflammatory and anti-oxidant effects of β-LAP in LPS-stimulated microglia. Interestingly, a recent study demonstrated that HO-1 knockout markedly increases MMP-9 expression in arteriovenous fistulas in mice and that MMP-9 induction reflects the prooxidant and proinflammatory effects recognized in a state of HO-1 deficiency [
44]. Therefore, the upregulation of HO-1/NQO1 may at least partly contribute to the anti-inflammatory effects of β-LAP by suppressing proinflammatory molecules such as cytokines and MMPs in LPS-stimulated microglia.
A number of studies have reported therapeutic and health benefits of β-LAP supplementation in experimental animal models and clinical trials. The most extensively studied property of β-LAP is its anti-cancer potential, and β-LAP is currently being evaluated in clinical trials for treatment of cancer [
9,
11]. In addition, β-LAP has beneficial effects on metabolic syndromes such as obesity, diabetes, hypertension, arterial restenosis, and salt-induced renal injury [
45‐
48]. The anti-inflammatory/cytoprotective effects of β-LAP have also been reported in several disease models. β-LAP attenuates cisplatin-mediated acute kidney injury in mice by suppressing critical mediators for inflammation and ROS [
15]. β-LAP has shown therapeutic effects against rheumatoid arthritis by inhibiting synoviocyte proliferation and suppressing MMP expression in chondrocytes [
49]. β-LAP also protects against renal ischemia/reperfusion injury in mice by inducing NQO1 activation and subsequent inhibition of ROS [
50]. In experimental autoimmune encephalomyelitis, an animal model of multiple sclerosis, the administration of β-LAP ameliorates the development of EAE by inhibiting the production of IL-12 family cytokines [
37]. Interestingly, a recent study demonstrated that potentiation of NQO1 activity by feeding β-LAP prevents the age-dependent decline of motor and cognitive function in aged mice [
51]. β-LAP also increases memory performance and prevents the loss of synapses in aged mice, suggesting the therapeutic potential of β-LAP for neurodegenerative diseases.
As to the BBB permeability of β-LAP, Huntingdon Life Sciences (UK) has reported that a minimal concentration of β-LAP penetrates into the rat brain, compared with other organs, under normal conditions (unpublished report). Therefore, we suggest two possibilities regarding the mechanism of β-LAP: first, β-LAP suppresses the peripheral inflammation induced by LPS and results in the inhibition of subsequent brain inflammation, and second, in systemic inflammatory conditions, BBB permeability is compromised and thus the penetration of β-LAP into the brain might be enhanced. In the latter case, β-LAP may directly modulate microglial activation. We believe that both of these mechanisms may be simultaneously involved in β-LAP action.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
E-JL and H-MK designed the study and performed the experiments and wrote the manuscript. Y-HJ performed the experiments. E-MP designed the study and analyzed the data. H-SK supervised the design of the study and analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.