Background
Gastric cancer (GC) is one of the major malignant diseases, especially in Asia, and the second leading cause of cancer-associated deaths worldwide [
1]. It is usually classified into two types (Lauren’s classification) [
2], intestinal and diffuse, which are thought to reflect its pathogenesis [
3]. The diffuse-type GC (DGC) is sub-classified as poorly differentiated GC (non-solid type) or undifferentiated GC in the Japanese Gastric Cancer Association classification system [
4]. DGC is infiltrative and often shows aggressive invasion into the gastric wall, resulting in metastasis and the spread of GC cells into the peritoneal cavity (peritoneal dissemination, PD).
The disseminated GC cells in the peritoneal cavity give rise to peritoneal carcinomatosis (PC) [
5]. PC causes gastrointestinal symptoms, such as abdominal pain, nausea and vomiting, as well as systemic symptoms such as weight loss and ascite. PC not only strongly deteriorates the quality of life of GC patients, but it is also the leading cause of death in GC [
6]. With supportive care alone, the median survival of patients with PC is 3–6 months [
7]. If treated with systemic chemotherapy, in the same manner as for other metastatic lesions, PC shows a poorer response to the therapy than other types of metastasis in GC, mainly because of poor distribution of the chemotherapeutic agent in the peritoneal cavity. Therefore, recent efforts have focused on innovative PC therapeutics, such combining of cytoreductive surgery, thermal therapy, and intraperitoneal chemotherapy. These combined approaches have slightly improved the prognosis of PC, although the median survival period is still less than 12 months, making it clear that there is a practical limit to the efficacy of surgical cytoreduction [
8,
9]. Recent studies suggest that it is important to identify GC patients with occult PD by performing a cytologic examination of peritoneal lavage fluid, because such cases showed improved prognosis if they obtained conversion to negative cytology by extensive intraoperative peritoneal lavage followed by intraperitoneal chemotherapy [
10].
The concept of “suicide gene” cancer therapy, using herpes simplex virus thymidine kinase (HSVtk), emerged in the 1980s [
11]. HSVtk catalyzes the phosphorylation of the guanosine analogue ganciclovir (GCV) into a monophosphate form that is subsequently phosphorylated by cellular nucleotide kinases into highly toxic ganciclovir triphosphate [
12]. Ganciclovir triphosphate blocks DNA replication, leading to cell cycle arrest and cell death [
13]. Therapy involving HSVtk transfer into cancer cells, followed by GCV administration, is known as suicide gene therapy, and this technique was recently used in a phase III clinical trial on glioblastoma multiforme [
12].
In this study, we developed a therapeutic vector that expresses HSVtk in cancer cells, utilizing a regulatory region of the gasdermin B gene (
GSDMB).
GSDMB is a member of the gasdermin (
GSDM) family that consists of four genes,
GSDMA,
GSDMB,
GSDMC and
GSDMD [
14,
15], and is expressed in proliferating cells of normal epithelium and also in many types of cancer, including esophageal, gastric, liver, colon, uterine cervix and breast cancers [
14,
16‐
18].
GSDMB expression is driven by two promoters, the cellular promoter and LTR-derived promoter [
19‐
21]. The LTR-derived promoter (LTR promoter) is active in most normal tissues, except the stomach, and in many cancer cell lines, while the cellular promoter is active in normal stomach tissue and in some cancer cell lines [
20]. In this study, we identified a region in down-stream of the LTR promoter, that showed strong transcriptional activity in GC cell lines. We used this region to construct an HSVtk-expression viral vector for controlling occult PD.
Methods
Human tissues
Gastric cancer (GC) tissues were provided by the National Cancer Center Hospital after obtaining written informed consent from each patient, which was approved by the National Cancer Center Institutional Review Board (ID: No.17-030). Tissue specimens were immediately frozen with liquid nitrogen after surgical extraction, and stored at −80 °C until use.
Microarray analysis
Total RNA was isolated by suspending the cells in ISOGEN lysis buffer (Nippon Gene, Toyama, Japan) followed by precipitation with isopropanol. We performed expression analyses using Human Expression Array U95A version 2 (Affymetrix, Santa Clara, CA) according to the suppliers’ protocols . The expression value (average difference: AD) of each gene was calculated using GeneChip Analysis Suite version 4.0 software (Affymetrix). Hierarchical clustering of microarray data was performed using GeneSpring (Agilent Technologies Ltd., Palo Alto, CA), Microsoft EXCEL, and Cluster & TreeView [
22,
23]. All microarray data have been deposited in a MIAME compliant database, GEO (accession number; GSE47007). By Wilcoxon
u-test (
p < 0.05) and by showing a 2-fold change, genes expressed specifically in diffuse-type GC were selected [
22].
Cell lines and primary culture of mouse mesothelial cells
Three gastric cancer cell lines, HSC-57, derived from intestinal-type GC, and HSC-59 and HSC-60, both derived from diffuse-type GC, were established and characterized by one of the authors [
24]. SNU16, derived from diffuse-type GC, was provided from the American Type Culture Collection (ATCC), Two other cell lines with efficiency in producing PD mice, 60As6 and 60As6GFP (60As6 expressing green fluorescence protein), were established by the authors from the diffuse-type GC derived HSC-60 cell line after several passages of intraperitoneal transplantation to mice [
25]. CC-2511, a fibroblast cell line, was purchased from Lonza, Japan (Tokyo, Japan). All cell lines were maintained in Dulbecco’s Modified Eagle Medium. Mouse mesothelial cells were harvested by injection of 10 mL of warmed 0.25 % Trypsin/EDTA solution into the peritoneal cavity [
26]. The cells were incubated for 3 days in RPMI-1640 supplemented with L-glutamine, Phenol Red and HEPES (WAKO, Tokyo, Japan). Met-5A, a human mesothelial cell line, was provided by ATCC and maintained in Medium 199 (Life Technologies, Tokyo, Japan) supplemented with 3.3 nM EGF (Life Technologies), 400 nM hydrocortison (Sigma-Aldrich, St. Louis, MO USA), 870 nM Insulin (Life Technologies) and 10 % FBS.
RT-PCR
Total RNAs from human normal organs were purchased from BioChain, Hayward, CA. Total RNAs were extracted using an RNeasy Mini kit (QIAGEN, Tokyo, Japan). After generating first-strand cDNA from total RNA using ThermoScript RT-PCR System (Life Technologies, Tokyo Japan), PCR was performed with AccuPrime™ Pfx DNA Polymerase (Life Technologies) under the following cycling conditions of either 35 (LTR transcripts) or 25 cycles (others): 95 °C for 1 min; 56 °C (β-actin) or 58 °C (others) for 1 min; and 72 °C for 1 min. The following primer sets were used: for cellular promoter transcript, 5′-CTTCCTGAGATTCAGAGGCC-3′ and 5′-CCAGAATTTGAAACTCAGCC-3′; for LTR promoter-derived transcripts, 5′-TTCAGTTGCTTCAGGCCATC-3′ and 5′-CCAGAATTTGAAACTCAGCC-3′; for the 3′ side of GSDMB, 5′-ATTCTGGACTTCCTGGATGC-3′ and 5′-ATGTATGAAATCCAGGCTGG-3′; for MYH11, 5′- CAGTGACGATGAGAAGTTCC-3′ and 5′- CGCAGAAGAGGCCAGAGTAC; and for β-actin, 5′-TCATCACCATTGGCAATGAG-3′ and 5′-CACTGTGTTGGCGTACAGGT-3′.
Reporter Assay
A genomic fragment, from −1080 to +1053 of GSDMB and containing the LTR promoter, was amplified by PCR using LA Taq Hot Start DNA polymerase (Takara) in 35 cycles of 96 °C for 30 s and 68 °C for 2 min, using primer sets: 5′-CTTCCTGAGATTCAGAGGCC-3′ and 5′-CTCGAGTTCACTGTGTTAGCCAGG-3′, and inserted into a pGL3 basic vector (Promega, Madison, WI). It was truncated using the restriction sites: Nhe I and EcoR I to generate the −1035 to +1053 fragment; KpnI and EcoR I for −426 to +1053; Nhe I and Afl II for −61 to +1053; Nhe I and Eco81 I for +129 to +1053; and Nhe I and Stu I for +496 to +1053. The +496 to +1053 reporter construct was further truncated with restriction enzymes: Nhe I and Swa I for +757 to +1053; Nhe I and Pvu II for +860 to +1053; Nhe I and BstX I for +989 to +1053; Xho I and BstX I for +496 to +989; Xho I and Pvu II for +496 to +860; and Xho I and Swa I for +496 to +757. For further truncation of the +496 to +989 fragment, PCR was performed with the fragment as a template using Ex Taq DNA polymerase (Takara) in 35 cycles of 95 °C for 1 min, 58 °C for 1 min, and 72 °C for 1 min, using the following primer sets: for +562 to +989, 5′-GCTAGCTGTGGGATTTGTACACATCC-3′ and 5′- AGATCTCGACTGGGATTACAGG-3′; and for +649 to +989, 5′-GCTAGCTTTATTTCCACTGGAAACCG-3′ and 5′-AGATCTCGACTGGGATTACAGG-3′. After amplification, fragments were inserted into pGL4.12[luc2CP] vector (Promega). The −1 kb upstream regions of CXCR4 and CXCR7 were prepared by genomic PCR using MightyAmp DNA polymerase (Takara) in 35 cycles of 98 °C for 10 s, 62 °C for 15 s, and 68 °C for 2 min, using the following primer sets: for CXCR4, 5′-GCTAGCGCGCCCACTGCAAACCTCAG-3′ and 5′-CTTAAGTCACTTTGCTACCTGCTGC-3′; and for CXCR7, 5′-GCTAGCCGGAGGCCCCCGGAGAGCAG-3′ and 5′-CTTAAGTTTGCAACAACTGTGAGC-3′. These fragments were inserted into the pGL4.12[luc2CP] vector. One microgram of each construct and the Renilla luciferase control reporter vector (pRL-SV40 vector, Promega) were co-transfected into 1 × 105 cells using SuperFect Transfection Reagent (QIAGEN). The luciferase assay was performed 24 h after the reporter introduction, using a Dual-Luciferase Reporter Assay System (Promega). The assay was carried out in triplicate.
GSDMB enhancer-HSVtk lentivirus vector
A pMFG-HSVtk vector was provided by RIKEN BRC through the National Bio-Resource Project of the MEXT, Japan, by courtesy of Dr. Hirofumi Hamada, and an HSVtk cDNA was excised from it as an Nco I-BamH I fragment. To construct the GSDMB enhancer-HSVtk lentivirus vector, first the +496 to +989 fragment (GSDMB enhancer) was inserted into pcDNA3.1 (+) (Life Technologies) between Nhe I and Hind III sites, and then HSVtk cDNA was inserted into the vector at a BamH I site in the forward (for sense-strand expression) or reverse (for antisense-strand expression) direction. Next, GSDMB enhancer-HSVtk sense and GSDMB enhancer-HSVtk antisense fragments were excised from the plasmid vectors as Nhe I-Not I fragments and inserted into pLVSIN-CMV neo vectors between the Xba I and Not I sites. Finally, a CMV promoter was removed from the lentiviral constructs. To generate viral particles containing the vectors, the constructs were introduced into Lenti-X™ 293 T Cells (Takara) using Lenti-X™ HTX Packaging System (Takara). After 72 h’-incubation, the medium was collected and the viral titer (cfu/mL) was determined by transduction into HT-1080 cells in the presence of polybrene (5 μg/mL in culture medium, Sigma-Aldrich). The particles were applied to Met-5A and 60As6 (1 × 105 cells per dish, in triplicate) in vitro in the presence of polybrene (5 μg /mL), and the cells were incubated in medium containing Gancicrovir (GCV, 5 μg/mL, WAKO) for 5 days for cell growth assays. The assays were performed in triplicate and P-value of Student’s t-test between the cultured cells with (+) and without (−) GCV was calculated.
Treatment of PD mouse model with GSDMB enhancer-HSVtk vectors
We previously reported a mouse PD model (PD mice) that was produced by intraperitoneal injection of 60As6 cells [
25]. 60As6GFP cells (1 × 10
6 cells per mouse) were injected into the peritoneal cavity of 18 mice (6 week-old mice of CB17/Icr-Prkdc < scid>/CrlCrlj Genotype: scid/scid, Charles River, Yokohama Japan) at day 1. The mice were divided into two groups; one group was injected with the antisense expression vector, and the other group was injected with the sense vector; both groups then were intraperitoneally injected with 2 mL of PBS solution containing viral particle (5 × 10
5 cfu) and Ganciclovir (2 mg) at 8, 10 and 12 day. The mean survival time of each group and the
P-value of Student’s
t-test between the two groups were calculated. The study was approved by the National Cancer Center Committee on Animal Experiments.
Competing interests
The authors declare they have no competing interests.
Authors’ contributions
NS and HS designed and directed this study. NS performed biological analyses and animal experiments with support by RK, FC and KY. All authors read and approved the final manuscript.