A novel small molecule glycolysis inhibitor WZ35 exerts anti-cancer effect via metabolic reprogramming

Curcumin obtained from Sigma (MO, USA). WZ35, a monocarbonyl curcumin analog, was prepared as described in prior studies [28]. Cell Counting Kit-8 (CCK-8) and horseradish peroxidase (HRP)-conjugated anti-rabbit and anti-mouse IgG and N-acetyl-l-cysteine (NAC) were purchased from Beyotime (Haimen, China). Cell Apoptosis DAPI Detection Kit, DCFH-DA ROS detection kit, and pEGFP-hYAP 1 were obtained from Addgene (Shanghai, China). A Hippo Signaling Antibody Sampler Kit (#8579), anti-YAP(#14074S), anti-Cleaved caspase 3 (#9661), anti-Bax (#2774), anti-Bcl-2 (#2870), anti-E-cadherin (#8834S), anti-GLUT1 (#73015), anti-N-cadherin (#13116S), anti- Histone H3 (#9715S) and anti-GAPDH (#D16H11) were purchased from Cell Signaling Technology (USA) for Western blot and IHC. Anti-Cyr61 (Sc-374129), anti-CTGF (Sc-365970) were purchased from Santa Cruz Biotechnology (USA) for Western blot. Anti-Tublin (ac008) was purchased from Abclonal for Western blot.

The human liver cancer cell lines including HCCLM3, HepG2 and Huh7 were obtained from the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences. The cells were grown using Dulbecco's Modified Eagle's Medium (DMEM) containing 10% FBS (Life Technologies) and penicillin/streptomycin at 37 °C in a humidified 5% CO₂ incubator.

110 matched liver cancer samples and precancerous control tissues were isolated from untreated patients at the Department of Hepatopancreatobiliary Surgery of the First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China, between 2010 and 2014. They were separated into two different portions, with one portion being used for routine histopathological examinations, and the rest being snap-frozen and stored at −80 °C for future studies. Liver cancer was pathologically confirmed in all patients, with tumors staging being determined based upon the AJCC/UICC (Union for International Cancer Control/American Joint Committee on Cancer) and WHO classification. The Board and Ethical Committee of the First Affiliated Hospital of Wenzhou Medical University approved this study (ID number: wydw2019-0446), and all the patients provided written informed consent.

The GENE EXPRESSION OMNIBUS (GEO) database was searched using the terms "gene expression", "hepatocellular carcinoma", and "Homo sapiens". We selected the GSE14520 dataset as it met the quality control and the sample size criteria. The R software (version.4.2.0) limma package was used for normalization. Based on quality filtering, two healthy control microarray samples were excluded, while the remaining 486 microarrays (22 liver cancer samples, 19 adjacent control samples based on the GPL571 platform and 225 liver cancer samples, 220 adjacent control samples based on the GPL3921 platform were retained for analysis. The RStudio Limma package was used to identify the differentially expressed genes (adjusted P < 0.05 and | logFC (Fold Change) |≥ 0.5), after which probe names were converted to gene names. The ggplot2 package was used to visualize differences in gene expression between the samples, with appropriate functions also being used to draw the boxplots, survival curves, and volcano plots in R software (version.4.2.0). To reveal the potential biological functions and underlying mechanisms of genes, we used the R package “clusterProfiler” to analyze Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genes (KEGG) term enrichment of the target genes GO terms, including biological processes (BPs), cellular components (CCs), molecular functions (MFs), and KEGG pathways with adjusted P < 0.05, were considered statistically significant. JASPAR [29] and USCS [30] were used to predicted binding sites, conservation and histone modification.

Liver cancer cells were plated in 96-well plates (8 × 10³/well) overnight, after which they were untreated or treated with curcumin (10 μg/mL), WZ35 (10 μg/mL), NAC (5 mM). For some experiments, a range of drug concentrations (0, 5, 10, 20, and 40 μg/mL) were used instead. WZ35 and curcumin were prepared using 0.03% DMSO; NAC was prepared in PBS and diluted using complete media. The CCK-8 kit was used to measure the viability with absorbance at 450 nm being quantified via microplate reader (Spectramax m5, Molecular Devices).

HCCLM3 cells were plated in 6-well plates (5,000/well) with curcumin (1 μg/mL), WZ35 (1 μg/mL), and/or NAC (5 mM). The plate incubated until individual colonies were formed containing approximately 50 cells. The cells were then washed in PBS, fixed for 20 min with methanol, stained for 15 min with crystal violet, washed with distilled water, and colonies were counted using the ImageJ software.

Apoptosis was measured by plating HCCLM3 cells in 6-well plates overnight (5 × 10⁵/well). The cells were then treated using WZ35 or curcumin (both 10 cg/mL) for 18 h, after which they were washed using PBS, fixed for 15 min in 4% paraformaldehyde (PFA), and stained for 15 min with 4',6-diamidino-2-phenylindole (DAPI) (400 μL). The cells were thereafter imaged via microscope (NIKON, Japan) with 100 magnification. Compared to normal cells, cells undergoing apoptosis presented enhanced DAPI fluorescence for condensed nuclear chromatin, which can be individually identified with ImageJ software. Apoptosis rate was calculated by the percentage of condensation nuclear identified by ImageJ.

Radio immunoprecipitation assay (RIPA) lysis buffer obtained from Beyotime (Haimen, China) was used to isolate the proteins from the cells or to homogenize the tumor tissues. The samples were then spun for 15 min at 12,000 rpm, and equal amounts of supernatant protein (10 μg/sample) were separated via sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) (8, 10 or 12%) prior to transfer onto a poly (1,1-difluoroethylene) (PVDF) membrane (Millipore, Burlington, MA, USA). The blots were blocked for 90 min using 5% skim milk in TRIS hydrochloride & Tween (TBST), followed by an overnight incubation with the various primary antibodies at 4 °C. After washing three times in TBST (10 min/wash), the blots were incubated for 1 h with horseradish peroxidase (HRP)-linked secondary antibodies (1:2000), after which they were washed again and protein bands were detected using an electrochemiluminescence (ECL) reagent (Thermo Scientific, IL, USA). The samples were subjected to western blot analyses as described previously [25].

RNAs were isolated from cells using Triozol reagent (sigma) according to the manufacturer’s instructions. The quantity and quality of the extracted total RNA were assessed by using a Nanodrop 1000 spectrophotometer (Thermo Scientific). One microgram of total RNA was reverse-transcribed into complementary DNA with HiScript III 1st Strand cDNA Synthesis Kit with gDNA Wiper (Vazyme;R312-01). Quantitative PCR was performed with SYBR qPCR Master Mix (Vazyme; MQ101-01) and quantified by the StepOne Real-Time PCR System (Applied Biosystems). The signals were detected and analyzed on CFX Connect System (Bio-rad, USA). GAPDH was used as an internal control. The amplification parameters were set at 95 ℃for 30 s, 60 ℃ for 30 s, and 95 ℃ for 10 s (40 cycles total). Gene-specific primers used in the study were:

YAP: TGTCCCAGATGAACGTCACAGC (forward), TGGTGGCTGTTTCACTGGAGCA(reverse);

GLUT1: TTGCAGGCTTCTCCAACTGGAC(forward), CAGAACCAGGAGCACAGTGAAG(reverse); GAPDH:GTCTCCTCTGACTTCAACAGCG(forward), ACCACCCTGTTGCTGTAGCCAA(reverse).

Curcumin- and WZ35-induced changes in the cellular structure were visualized via TEM, with DMSO being used as a control. The treated cells were pre-fixed overnight in primary fixative (2.5% glutaraldehyde and 1 mM CaCl₂ in 0.15 M cacodylate buffer), followed by a 2 h post-fix in 1% osmium tetroxide. Subsequently, specimens were dehydrated in an ascending ethanol gradient (50%, 70%, 90%, 95% and 100% three times; each step 5 min) and in isoamyl acetate 15 min. Ultrathin pellet sections were then stained using 2% aqueous uranyl acetate and lead citrate, after which a TEM instrument (Wenzhou Medical University, H-7500, HITACHI, Japan) was used to image the cells with 26,500 magnification.

A Seahorse XF96 Extracellular Flux Analyzer (Agilent Technologies, CA, USA) was used for oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) measurements. 2 × 10⁴ cells add to machine-specific plates. Drug doses were used to treat cells for 6 h. Following probe calibration, OCR was measured via sequentially injecting oligomycin (ATP synthase inhibitor; 1 µM), FCCP (uncoupler; 0.5 µM), rotenone (complex I inhibitor; 1 µM), and antimycin A (complex III inhibitor; 2 µM). ECAR was measured using the cells treated in the same manner via injection of glucose (10 mM), oligomycin (1 µM), or 2-DG (100 mM).

ROS production was quantified by staining the cells for 30 min with 10 μM 2,7-dichlorofluo-rescein diacetate (DCFH-DA) in DMEM at 37 °C. The cells were then treated for 2 h with corresponding compounds (10 μg/mL), washed twice with DMEM, and DCFH-DA fluorescence was quantified by BD Accuri TM C6 flow cytometer (BD, Franklin Lakes, NJ).

Cells were plated in 3 dishes (60 mm) with DMSO (10 μL/mL), WZ35 (10 μg/mL) and blank. After a 18 h-drug-treatment, the supernatant was collected. According to Beckman Kurt biochemical analysis system, glucose determination kit (Beckman Coulter, CA, USA) was used to detect the glucose content in the culture medium supernatant. In the presence of adenosine triphosphate (ATP) and magnesium ions, the glucose was phosphorylated by hexokinase (HK) to produce glucose-6-phosphate and adenosine diphosphate (ADP). The increase of absorbance at 340 nm was proportional to the glucose concentration in the sample.

A CCK-8 kit was used to measure the cellular proliferation. HCCLM3 cells were plated in 96-well plates (8 × 10³/well) overnight, medium was changed to sugar-free medium the next day, after which the cells were left untreated or treated with Glucose (1 mM), Glucose (25 mM), 2-DG (1 mM), WZ35 (10 μg/mL). After an 18 h-drug treatment, the CCK-8 kit was used to measure the viability, with absorbance at 450 nm being quantified via microplate reader (Spectramax m5, Molecular Devices).

TCA: Targeted metabolite analysis was performed on a Xevo G2-XS QT of mass spectrometry coupled with an ACQUITY UPLC (Ultra Performance Liquid Chromatography) system and data analysis was done with Progenesis QI (all from Waters, Milford, MA, USA). The metabolites in a homogenate of 1 × 10⁶ cells were extracted using chloroform, methanol, and water at a ratio of 8:4:3 and resuspended in 1% acetonitrile. For UPLC, the samples were injected on an HSS T3 column (100 × 2.1 mm, 1.8 μm) using an 8-min gradient containing flow phase A (0.1%formic acid–water) and flow phase B (0.1% formic acid-acetonitrile) at a flow rate of 0.5 ml/min. For the negative ion mode, the capillary energy and sample cone were set as 2000 V and 20 V, respectively. Scan time was set at 0.1 s intervals for 60 s.

Other metabolomics: A. 95% water: 5% acetonitrile + 10 mM ammonium acetate + NH₄OH (PH = 10); B. 95% acetonitrile: 5% water + 10 mM ammonium acetate + NH₄OH (PH = 10). Waters Acquity UPLC BEH Amide 2.1 × 100 mm, 1.7 μm. Time, flow velocity (mL/min), A1%, B1% were arranged in the following order: initial, 0.4, 1, 99; 0.1, 0.4, 1, 99; 6, 0.4, 70, 30; 6.5, 0.4, 1, 99; 10, 0.4, 1, 99.

Female BALB/c nude mice (6–8 weeks old; ~ 20 g) from Wenzhou Medical University Laboratory Animal Center were housed under SPF conditions. All procedures performed in studies involving humans and animals were in accordance with the ethical standards of the ethic committee of Wenzhou Medical University and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Animals were subcutaneously injected with a 100 μL volume containing 5 × 10⁶ HCCLM3 cells in the right flank. When tumors grew to 100 mm³, the mice were randomized into 4 groups (n = 6/group) that were intraperitoneally administered saline, vehicle, curcumin (25 mg/kg), or WZ35 (25 mg/kg) daily for 17 consecutive days. Body weight and tumor volumes were monitored every other day, with the latter being calculated as follows: tumor volume = length × width × height/2. After 17 days, Intraperitoneal injection of 300 mg/kg sodium pentobarbital was used to euthanize mice. Upon examination, all mice lost heartbeat, breathing and righting reflex within two minutes and were therefore judged dead. The tumor tissues were collected to make paraffin sections for HE staining. Our project was conducted under guidelines approved by the Experimental Animal Ethics Committee of Wenzhou Medical University (ID number: wydw2019-0446).

In order to reflect the welfare and "3R" principles in animal experiments, and to "optimize" the animal experiment strategy, we set up "humane endpoints" to help animals reduce end-of-life pain and stress.Carry out detailed inspections at least twice a week, and increase the number of observations after the emergence of toxic manifestations:

General observations: rapid weight loss of 10–20%, loss of appetite or poor appetite, neurodepression with hypothermia without anesthesia, clinical symptoms of organ dysfunction and ineffective treatment, persistent effects of self-harm eating and drinking;Specific indicators: When the tumor growth volume exceeds 10% of the animal's body weight, the average diameter exceeds 15 mm, or the tumor surface ulcers or even causes infection or necrosis.In the event of any of the above symptoms, the experimenter will consider terminating the experiment immediately.

Liver cancer TMAs composed of 110 FFPE tissue Sects. (4 μm thick) were prepared the same way as previously described by Guttà C et al. [31] TMA IHC staining was conducted based on a standard approach. Briefly, the sections were deparaffinized using xylene, rehydrated with an ethanol gradient, treated to quench peroxidase activity, blocked with 5% normal goat serum, and incubated with anti-YAP/GLUT1 (1:200) overnight at 4 °C. As a negative control, the antibody was omitted. The slides were then probed with biotin-labeled goat anti-rabbit IgG, treated with a streptavidin peroxidase solution (SABC kit, Boster, Wuhan, China), and then 3,3-diaminobenzidine (Boster, Wuhan, China) in PBS with 0.05% H2O2 was used to treat the samples for 5 min at the room temperature for color development, after which the samples were counterstained using hematoxylin.

Two pathologists blinded to the samples evaluated the clinicopathological information independently and scored IHC images of TMA samples. We utilized the Image-Pro Plus 6.0 (IPP) (Media Cybernetics, MD, USA) to calculate the integrated optical density (IOD) for the stained images, with this value corresponding to total staining per sample area [32]. Entire TMAs were scanned in order to quantify protein levels in the TMA levels. IHC staining was evaluated based on immunoreactive score (IRS) values as described in the prior studies, with these scores reflecting both staining intensity and the percentage of the positive cells [25]. The percent positivity was stained as follows: 1 (≤ 10%), 2 (10–50%), 3 (50–80%), or 4 (≥ 80%). The staining intensity was scored as: 0 (negative), 1 (weak), 2 (moderate), or 3 (strong). These two scores were then multiplied together to yield the IRS value (0 – 12), with these values being deemed either low (≤ 6) or high (> 6).

To understand the possible role of YAP in liver cancer, we began by analyzing data downloaded on Gene Expression Omnibus (GEO) datasets with accession number GSE14520. YAP1 is regarded the most common subtypes of YAP. Volcano map and Boxplots (Fig. 1A, B) reveal the upregulation of YAP1 in liver cancer cells (adjusted P < 0.001). The heat map visualizes the expression of all DEGs (Additional file 1: Fig.S1A). Visualization of enrichment analyses of up-regulated DEGs have been shown in Additional file 1: Fig. S1B.

The results of Western blotting on 18 liver cancer patients tissue samples and corresponding adjacent controls were assistant with the above (Fig. 1C). IHC staining composed of 110 patient-derived liver cancer samples shows that YAP expression has a positive association with tumor histological TNM stage (P < 0.001) (Fig. 1D, E). Moreover, the expression of YAP in well-differentiated (G1) liver cancer tissues was significantly lower than that were moderately (G2) (P = 0.003) and poorly ( G3) (P < 0.001) differentiated, and the levels of YAP were significantly higher in G3 samples in contrast to G2 samples (P < 0.001) (Additional file 1: Fig. S1C). These findings indicated that an upregulation of YAP can coincide with the progression of liver cancer. Kaplan–Meier analyses of 110 samples found that the high expression of YAP was closely related to poorer OS, while low related to better (Fig. 1F) (P < 0.01). In univariate analyses (Table1), the levels of YAP, tumor nodules, and venous invasion were all found to serve as significant prognostic factors, while in multivariate analyses, the expression of YAP was found to be independently associated with the prognosis of liver cancer patients. Together, these results indicated that YAP protein was overexpressed in liver cancer cells and may serve as an important target for therapeutic intervention.

YAP protein was knocked down or over-expressed in HCCLM3 for various assays (Fig. 2A). YAP knockdown significantly reduced the colony formation rates, whereas the opposite facilitated this process (Fig. 2B, C). Moreover, consistent results were observed in a CCK-8 assay (Fig. 2D). These findings clearly suggested that the proliferation of liver cancer cells was regulated by YAP.

The structure of curcumin-derived WZ35 compound was shown in Fig. 2E. We proved that WZ35 can cause a significant downregulation of YAP and YAP-TEAD target genes Cyr61 and CTGF (Fig. 2F). Western blotting detected that WZ35 can decrease the total abundance and nuclear enrichment of YAP protein (Fig. 2G). Immunofluorescence assay observed that the green signals were significantly diminished following WZ35 treatment, particularly in the nuclei of liver cancer cells, with DAPI used for nuclear visualization (Fig. 2H), thereby indicating that WZ35 was able to retard the nuclear translocation of YAP. Overall, not only can WZ35 down-regulate YAP signaling, but can effectively hinder its translocation and ability to promote the viability of liver cancer cells.

In a CCK-8 assay, both curcumin and WZ35 caused a dose-dependent inhibition of the tumor cell proliferation, with WZ35 being superior to curcumin (Fig. 3A). Moreover, similar outcomes were observed in colony formation assays (Fig. 3B, Additional file 2: Fig. S2A). Flow cytometry analysis indicated that WZ35 substantially induced G2/M cell cycle arrest (Additional file 2: Fig. S2B), thus suppress the growth of HCCLM3 cells, and promoted apoptosis (Additional file 2: Fig. S2C). DAPI staining revealed that WZ35 treatment induced nuclear shriveling and abnormal nuclear morphology at higher rates as compared to curcumin (Fig. 3C). Western blotting detected that drug-treated cells exhibited an upregulated levels of Bax and cleaved caspase-3 and a decrease of Bcl-2 (Fig. 3D).

In order to extend our range of findings to in vivo settings, nude mice bearing subcutaneous HCCLM3 tumor xenografts were used. Both curcumin and WZ35 treatment did not significantly alter murine body weight (Fig. 3E). While both the compounds were able to inhibit tumor growth, WZ35 was found to be superior in suppressing this growth over a 17-day study period (Fig. 3E, F). In histological assessment, WZ35-treated tumors revealed lower cellularity and higher tumor necrosis rates as compared with the vehicle and curcumin treatment (Fig. 3G). These results suggest that WZ35 may exhibit preferable in vivo efficacy by markedly suppressing tumor growth as compared to curcumin.

To further ascertain the cellular mechanism related to drug-associated apoptosis, we examined the impact of WZ35 on intracellular morphology in HCCLM3 cells via TEM. Apparent mitochondrial dysregulation, scattering, and swelling were observed in the treated cells (Additional file 2: Fig. S2D). Mitochondria are the major intracellular sources of ROS generation owing to electron leakage from the electron transport chain (ETC). We therefore analyzed ROS levels via flow cytometry. This treatment led to a more than twofold increase in intracellular ROS levels (Fig. 4A). It’s widely known that excessive ROS levels can cause deleterious oxidative damage [33]. Hence, an increased ROS generation observed in WZ35-treated cells was likely to contribute to observed reduction in the cellular proliferation.

Thereafter, we utilized N-acetyl-l-cysteine (NAC) to inhibit ROS before WZ35 treatment. NAC pretreatment neutralized WZ35-induced cells proliferation inhibition (Fig. 4B), and correspondingly facilitated the colony forming abilities of WZ35-treated cells (Fig. 4C) while attenuating their apoptotic death (Fig. 4D). Western blotting revealed that this antioxidant can significantly counteract changes in the expression of YAP and its target gene CTGF caused by WZ35 (Fig. 4E).

All these results suggested that ROS generation was essential in order for WZ35 to suppress growth and proliferation, with the expression of YAP being closely linked to increased ROS production in treated liver cancer cells.

YAP was knocked down and over-expressed in HCCLM3 cells. The results of various assays indicated that WZ35 and downregulation of YAP caused a concurrent inhibitory effect on cell viability (Fig. 5C) and clonogenicity (Fig. 5B, Additional file 3: Fig. S3B), therefore facilitating death (Fig. 5A, Additional file 2: Fig. S3A).

Data downloaded from TCGA was divided into two groups according to YAP1 expression. Enrichment analysis based on Gene Ontology (GO) annotation system was conducted. The samples were divided into YAP1 high-expression and YAP1 low-expression groups according to the median of YAP1 expression. The DEGs correlated with YAP1 expression had enriched GO terms related to metabolism (Additional file 3: Fig. S3C). Correlated DEGs were also mainly enriched in oncogenic pathway for liver cancer cells (Additional file 4: Fig. S4). As shown in Fig. 5D, E, SLC2A1 expression of YAP1 high expression group was significantly up-regulated and exhibited high association with YAP1. Meanwhile, the pathview (Additional file 5: Fig. S5) showed the changes of genes expression related to central carbon metabolism in the YAP high-expression group versus the low-expression group. SLC2A1 is the official name of GLUT1. Bioinformatics analysis of GEO database proved that YAP expression may be closely related to cellular metabolism genes especially the genes in glycolysis process (Additional file 6: Fig. S6A and B). GLUT1 was significantly up-regulated in tumor samples (Additional file 7: Fig. S7A and B) and high levels of it was associated with a shorter survival in liver cancer patients (Additional file 7: Fig. S7C). Western blotting and qPCR analysis unfolded that WZ35 decreased GLUT1 expression and that knockdown of YAP enhanced the suppressive effect of WZ35 on GLUT1 (Fig. 5F-G), whereas overexpression of YAP neutralized it (Additional file 7: Fig. S7D). Based on the JASPAR [25] database, five potential TEAD binding sites were present on the GLUT1 promoter (Fig. 5H). UCSC Genome Browser revealed that GLUT1 promoter is highly conserved among mammals and an increased level of histone methylation correlated with H3K4Me3 at the promoter (Additional file 8: Fig. S8).

Statistically, after action of curcumin or WZ35, both two curves of the total acidification rate moved down, and the descending degree of the latter outweighed that of the former (Fig. 6A–C), so did the curves of OCR (Fig. 6D–G). We then detected the absorption of glucose via glucose determination kit (hexokinase method). WZ35 was found to significantly attenuate the ability to absorb glucose from outside obviously (Fig. 6H). By means of CCK-8 assay (Fig. 6I), the absorption of glucose was correlated to the proliferative activity of cells. When we artificially retarded the glycolysis process, the ability of WZ35 to inhibit cell proliferation was reduced, which could possibly exert its anti-proliferative effects by hindering the process of cell glycolysis. Metabolomics was used to detect the levels of the various intracellular metabolites. As displayed in Fig. 6J, WZ35 enhanced the ratio of NAD⁺ to NADH, signifying the blockade of oxidative phosphorylation. The content of purine metabolites were also significantly attenuated. The general metabolism changes triggered by WZ35 have been shown in Fig. 6K.

We further explored clinical application of YAP and GLUT1 in above tissue chip with 53 liver cancer samples. The majority of these liver cancer patients were GLUT1-positive (Fig. 7A, B) (P = 0.0208). Boxplot showed that GLUT1 expression was positively correlated with TNM stage (Fig. 7C), suggesting that GLUT1 upregulation could coincide with liver cancer progression. Kaplan–Meier survival analysis showed that high level of GLUT1 was associated with a shorter survival (Fig. 7D) and the areas under curve (AUC) in ROC curve of GLUT1 were 0.7 (at 1 year), 0.77 (at 3 years) and 0.85 (at 5 years) (Fig. 7E). Since biological information mining found that YAP and GLUT1 might display a good predictive function in predicting the prognosis of liver cancer patients (Additional file 9: Fig. S9A-D), to further substantiate the survival significance of YAP and GLUT1, the correlation between YAP/GLUT1 high expression and clinical features of liver cancer patients was analyzed in above 53 clinical cases. The expression of YAP was found to be proportional to GLUT1 (Additional file 9: Fig. S9E). High integrated expression levels of YAP and GLUT1 were negatively correlated with survival in liver cancer patients (Fig. 7F). A nomogram was made according to the result of multi-variate logistic proportional hazards analysis which considers Stage I and II as the early stage, Stage III and IV as the late stage. Through fixing the points associated with YAP and GLUT1, the risk of later stage for an individual patient could be calculated (Fig. 7G). A ROC calibration plot was made to assess the internal validity for the constructed nomogram (Additional file 9: Fig. S9F).The AUC for combination of YAP and GLUT1 was 0.889, which was higher than GLUT1 alone (Additional file 9: Fig. S9G). Considering these data, we can infer the potential link between YAP and GLUT1 and the integration between them may potentially serve as a valuable prognostic biomarker in liver cancer patients.