Background
Neuropathic pain is a chronic pain and may result from primary damage, disease or dysfunction of the peripheral or central nervous system, which is characterized by an increased responsiveness of nociceptive neurons in the nervous system [
1]. The molecular mechanisms of neuropathic pain remain poorly understood, but it is known to involve nerve injury, inflammatory cytokine release, anatomical remodeling, and nociceptive receptors. [
2,
3]. Thus, an improved understanding of pathogenesis from gene interactions in neuropathic pain is crucial for the development of the genetic and various neurobiological base therapeutic strategies to prevent neuropathic pain and improve the treatment effect.
The chronic constriction injury (CCI) rat model which simulates the symptoms of chronic nerve compression has been used as a model of neuropathic pain because rats subjected to CCI behave analogously to humans with neuropathic pain [
4,
5]. Reportedly, CCI is highly associated with inflammation [
6,
7]. Activation of immune and immune-like glial cells in the injured nerve, dorsal root ganglia, and spinal cord could generate a variety of mediators such as cytokines, chemokines, and other inflammatory mediators [
8]. Interestingly, some of these mediators, such as cytokines and chemokines, can directly activate or sensitize nociceptors, contributing to the development of neuropathic pain [
9].
Gene expression profile studies can be used to provide understanding of the molecular mechanisms underlying the development and maintenance of neuropathic pain [
10‐
12]. Some studies using microarray and RNA sequencing (RNA-seq) analysis have been conducted to investigate the mechanism underlying the generation of neuropathic pain in spared nerve injury (SNI) model [
13,
14]. Although they identified several crucial differentially expressed genes (DEGs) and different immune actions in SNI models, the alteration of gene expression and mechanisms on neuropathic pain are still unclear. Therefore, the present study was carried out to compare the different gene expression profiles of the dorsal horn of CCI rats and controls using the Illumina Hiseq 4000 to reveal the underlying regulatory mechanism of CCI rat models. Moreover, the molecular and cellular functions of the predicted mRNAs as well as the signaling pathways involved based on the present experiment will be further investigated.
Methods
Animals
Adult male Wistar rats weighing 200–250 g were obtained from the Animal Center of Taishan Medical University. All experimental procedures followed the guidelines of the Taishan Medical University Institutional Animal Care and Use Committee. Efforts were made to minimize the number of animals used and their sufferings.
CCI models
CCI to the sciatic nerve of the right hind limb in rats was performed based on previous description [
15]. Briefly, animals were anesthetized with 4% chloral hydrate (10 ml/kg; i.p.). The sciatic nerve of the right hind limb was exposed at the middle of the thigh by blunt dissection. To prevent the interruption of blood circulation through the epineural vasculature, four chromic gut ligatures were loosely tied (4.0 silk) around the nerve with spacing at ~ 1 mm. In the control group, the right sciatic nerve was exposed for 2–3 min, but was not ligated. Following surgery, the skin was closed with a single suture, and the animals were allowed to recover for various period of time before behavioral testing.
Mechanical withdrawal threshold (MWT)
All behavioral tests were performed in a blinded manner. Mechanical allodynia and thermal hyperalgesia are reproducible and sensitive behavioral readouts of neuropathic pain. Behavioral testing was conducted prior to surgery and on days 1, 3, 7, 10, and 14 following surgery. Animals were allowed to acclimate to elevated cages (20 × 14 × 16 cm) with a wire mesh bottom. MWT was measured by assessing hind paw sensitivity to innocuous mechanical stimulation. Von Frey filaments (0.41–15.1 g; North Coast, Gilroy, CA) were applied to the plantar aspect of the right hind paw. Lifting, licking the paw, and running away were all considered as positive responses. The maximum applied pressure was recorded. The MWT of each animal was the average of six measurements taken at 5 min intervals.
Thermal withdrawal latency (TWL)
In this assay, rats were placed in a transparent, square, bottomless acrylic box (17 × 11.5 × 14 cm) and allowed to adapt for 20 min. Responses to thermal stimulation were evaluated using a 37,370 plantar test apparatus as a source of radiant heat. A beam of focused light set at 60 °C was directed towards the plantar surface of the hind paw, and the maximum latency time was recorded. The time to purposeful withdrawal of the foot from the beam of light was measured. A cutoff time was set at 40 s to prevent tissue damage. Every hind paw was tested alternately at 5 min intervals. The results obtained for each rat were expressed in second as the mean of six withdrawal latencies. Finally, the average value was used for statistical analysis.
Tissue collection, RNA isolation, cDNA library preparation, and sequencing
Animals were deeply anesthetized with isoflurane (3%) at 14 days after surgery and perfused through the ascending aorta with normal saline (100 ml, 4 °C). The L4–5 spinal cord segments that correspond to L4–5 spinal nerve roots and match L1 vertebral level were dissected. The dorsal horns of L4–5 spinal cord were collected. Total RNA was extracted from the dorsal horn tissue using Trizol reagent (Invitrogen, Carlsbad) according to the manufacturer’s protocol. RNA quantity and quality were measured using a NanoDrop ND-1000. The cDNA library was constructed using KAPA Stranded RNA-Seq Library Preparation Kit (Illumina) following the manufacturer’s protocol. Briefly, poly-(A) mRNA was isolated from total RNA using the NEBNext Oligo d(T) magnetic beads. Under an elevated temperature, mRNA was fragmented into small pieces after the fragmentation buffer was added. Using the mRNA fragments as templates, the first-strand cDNA was synthesized with random primers. Then, the second-strand cDNA was obtained using DNA polymerase I and RNase H. The synthetic cDNAs were end-repaired by polymerase and ligated with “A-tailing” base adaptors. Suitable fragments were selected for PCR amplification to construct the final cDNA library. The final double-stranded cDNA samples were verified with an Agilent 2100 Bioanalyzer (Agilent Technologies). After cluster generation (TruSeq SR Cluster Kit v3-cBot-HS, Illumina), sequencing was performed on an Illumina HiSeq 4000 sequencing platform.
RNA-seq data processing
Image analysis, base calling, and error estimation were performed using Illumina/Solexa Pipeline version 1.8 (Off-Line Base Caller software, version 1.8). Quality control was checked on the raw sequence data using FastQC (
https://en.wikipedia.org/wiki/FASTQ_format). Raw data were pre-processed using Solexa CHASTITY and Cutadapt to remove adaptor sequences, ribosomal RNA, and other contaminants that may interfere with clustering and assembly. The trimmed reads are mapped to the corresponding reference genome using HISAT2 (version 2.0.4) for RNA-seq, and StringTie (version 1.2.3) was used to reconstruct the transcriptome [
16,
17]. Then, Ballgown software was applied to calculate the fragments per kilobase of exon per million fragments mapped (FPKM) in RNA-seq data and analyze DEGs [
18,
19], with the FPKM ≥ 0.5 (Cuffquant) considered statistically significant.
The Gene Ontology (GO) functional and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis were performed for DEGs using the Database for Annotation, Visualization and Integrated Discovery (DAVID) and KEGG Orthology-Based Annotation System (KOBAS) online tools (
http://www.geneontology.org and
http://www.genome.jp/kegg). Hierarchical cluster analysis was performed for enriched genes by Cluster 3.0 software. The protein-protein interaction (PPI) network of the proteins encoded by the DEGs was searched using STRING online software (
http://string-db.org/).
Quantitative reverse transcription-PCR (qRT-PCR) analysis
Thirteen DEGs (11 regulated and 2 downregulated genes) were randomly selected and detected by qRT-PCR. The expression of β-actin mRNA was also determined as an internal control. Total RNA was extracted from the dorsal horn tissue using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. RNA concentration was determined spectrophotometrically. cDNA was synthesized using a cDNA synthesis kit (Invitrogen) according to the manufacturer’s instructions. Primer sequences are listed in the Table
1. qRT-PCR was performed in triplicates by using a 7300 real-time PCR system (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. A comparative cycle of threshold fluorescence (∆Ct) method was used, and the relative transcript amount of target gene was normalized to that of β-actin using the 2
−∆∆Ct method. The final results of qRT-PCR were expressed as the ratio of test mRNA to control.
Table 1
The primers used in real-time PCR
Cxcl13 | GGCCACGGTATTCTGGAGAC | CCATCTGGCAGTAGGATTCACA | 192 |
Reg3b | GTCCTGGATGCTGCTCTCCT | GGCAACTAATGCGTGCAGAG | 92 |
Plac8 | AGGCAGCAACAGTTATCGTGAC | CTCATCGCCACCGTTGTTCC | 196 |
C1qc | GTCAAGTTCAATTCCGCCATCAC | TGTGGTGGACGAAGTAGTAGAGG | 103 |
Ccl2 | CCTGCTGCTACTCATTCACTGG | TTCTGATCTCACTTGGTTCTGGTC | 197 |
C1qa | TGTCTGTCTATCGTGTCCTCCTC | GATGCTGTCGGCTTCAGTACC | 192 |
C3 | TGTGAGCCTGGAGTGGACTAC | CTGAGCCTGACTTGATGACCTG | 112 |
C1qb | AGGTGGCTCTGGAGACTACAAG | GAACTGGCGTGGTAGGTGAAG | 198 |
C4a | CCAGACTCACATCTCCATCTCAAG | CCTCCAGGTCTCCGATCTCAG | 80 |
Ngfr | CCTGCCTGGACAGTGTTACATTCTC | CAGTCTCCTCGTCCTGGTAGTAGC | 132 |
Aif1 | CCAACAGGAAGAGAGGTTGGA | CAGCATTCGCTTCAAGGACA | 169 |
Urgcp | ACGTCAGCAGCAACTCCAAG | GGATTCGTGCCTAAGTTGAGGT | 106 |
Dusp1 | AGATATGCTCGACGCCTTGG | TGTCTGCCTTGTGGTTGTCC | 122 |
β-actin | TGTCACCAACTGGGACGATA | GGGGTGTTGAAGGTCTCAAA | 165 |
Statistical analysis
Data are presented as the means ± SEM. The results from the behavioral study were statistically analyzed using repeated measures analysis of variance. qRT-PCR results were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test. Significance was set at p < 0.05.
Discussion
In this study, we profiled gene expression in the dorsal horn following CCI-induced neuropathic pain, using RNA-seq method. Sixty-three DEGs were identified in CCI rat model, including 56 upregulated and 7 downregulated genes. We also predicted potential functions of DEGs using GO, KEGG pathway, and PPI network analysis in the CCI model. These findings prompted the proposal that DEGs played a significant role in neuropathic pain processing, and sequencing analysis revealed a potential therapeutic target of neuropathic pain.
Accumulating evidence showed that Cxcl13 and Ccl2 are known to be involved in pathogenesis of neuropathic pain via different forms of neuron-glia interaction in the spinal cord [
20,
21]. The chemokines by binding to the G protein-coupled receptors play an essential role in pathological pain conditions triggered by either peripheral inflammation or nerve injury [
23,
24]. Our results demonstrated that chemokine genes showed the greatest upregulation, such as Cxcl13 (6.426 fold increase), suggesting that chemokines play a crucial role in the development of neuropathic pain. Furthermore, complements, a key component of the innate immune system and potentially important trigger of some types of neuropathic pain, have been associated with neuroinflammation [
22,
25,
26]. Previous study showed that C1qc, C1qa, and Fcer1g might contribute to the generation of neuropathic pain after SNI via immune and defense pathways [
26]. Activation of Cd68, the inflammatory microglia-dominant molecule, could result in neuropathic pain in mice with peripheral nerve injury [
27]. Cd53, the inflammation-related gene, is chronically upregulated after spinal cord injury [
28,
29]. The up-expression of nerve growth factor (NGF) and the NGF receptor is involved in regulating the function of sensory and the development of neuropathic pain [
30]. In the present study, upregulated genes included chemokines, complement components, Fc fragment receptors, cluster of differentiations, G protein-coupled receptors, and NGF receptor. Most of the genes are well known in neuropathic pain (e.g., Cxcl13, C1qc, Ccl2) [
20‐
30], suggesting DEGs with the differential functions in diverse cellular pathways, and many are involved in neuropathic pain development and progression.
Previous study demonstrated that Urgcp plays a critical role in glial cell cycle and cell proliferation [
31]. Dusp1, a MKP-1, plays a pivotal role in controlling MAPK-dependent inflammatory responses [
32]. In the present study, we found that Urgcp and Dusp1 displayed obvious down-expression in CCI rats, which would provide a better understanding of immune and glia cell proliferation, as well as MAPK-dependent inflammatory response abnormalities involved in the neuropathic pain of CCI rats.
In order to obtain insights into DEGs function, GO analysis annotation was applied to the DEG gene pool. GO terms for biological process categories included immune system process, phagocytosis, defense response, and response to external stimulus. Several studies using SNI rat model have reported that key higher expressed genes included those associated with immune and inflammatory pathways in neuropathic pain [
20‐
30], similar to those in CCI model we observed. GO functional analysis showed that downregulated DEGs might associate with inactivation of MAPK activity in CCI models. Inhibition of MAPKs results in downregulation of downstream molecules (cytokines, chemokines, nitric oxide, etc.) in immunocompetent cells and depresses the excitability of neurons in the spinal cord [
33,
34]. Therefore, spinal MAPK signaling pathway, such as p38-MAPK (p38) or extracellular receptor-activated kinases (ERKs), may play an important role in the development of chronic allodynia in CCI [
35].
PPI network analysis showed that Cd68, C1qc, C1qa, Laptm5, and Fcgr3a were crucial nodes with high connectivity degrees. Laptm5 and Fcgr3a which have previously been linked to immune and inflammation-related pathways have not been reported in neuropathic pain [
36,
37]; and other three genes (Cd68, C1qc, and C1qa) have been demonstrated to be involved in this pathogenesis [
26,
27]. Previous study showed that Laptm5 is involved in the dynamics of lysosomal membranes associated with microglial activation after nerve injury [
36]. Upregulation of Fcgr3a increased the microglial phagocytic capacity in neuroinflammation [
37]. It might be inferred that Laptm5 and Fcgr3a are neuroinflammation-related genes that influence neuropathic pain behavior after CCI.
Conclusions
In conclusion, our results suggest that genes involved in immune and defense responses are affected most significantly after CCI. Genes like Cxcl13, Cd68, C1qc, Laptm5, and Fcgr3a are crucial for neuropathic pain after CCI in rat models. These genes could be used as novel diagnostic and therapeutic targets against CCI-induced neuropathic pain. However, the predicted expressions and interactions need to be further validated by extensive experiments.
Acknowledgements
The authors would like to thank Dr. Zhen Ye for skillful assistance in protein-protein interaction (PPI) network analysis. RNA-seq experiments were performed by KangChen Bio-tech, Shanghai, China.