Background
Duck hepatitis A virus (DHAV) causes an acute, contagious, and highly fatal disease that is characterized by a swollen liver mottled with hemorrhages and effects young (less than 3 weeks old) ducklings [
1]. In contrast, adult ducks infected with DHAV do not become clinically ill, however, infection induces the egg drop syndrome [
2]. DHAV was first described in the United States and isolated from chick embryos in 1949 [
3]. Subsequently, outbreaks of duck viral hepatitis in other parts of the world including China, South Korea, and Japan were reported [
4‐
6]. Birds are a well-known reservoir of infectious diseases. Due to the high mortality associated with the disease, DHAV causes significant financial losses, while no public health concern has been identified [
3]. A previous study showed that natural infection occurs in domestic ducks [
3]. DHAV infection was recently identified in mallards, goslings and pigeons [
7]. A goose embryonated epithelial cell line efficiently assists with the replication of DHAV, which shows a higher virus titer compared to other duck cell lines [
8]. Based on phylogenetic and neutralization assays, DHAV has been divided into three distinct genotypes: DHAV-1, DHAV-2, and DHAV-3 [
1,
9]. DHAV-1 is the most common type and has spread worldwide, and the development of accurate detection methods is essential [
10‐
14].
According to the International Committee on Taxonomy of Viruses (ICTV) report, DHAV belongs to the genus
Avihepatovirus, as a member of the family
Picornaviridae [
15]. DHAV is a small, simple, nonenveloped, spherical icosahedral virus that is approximately 30 nm in diameter and contains a single-stranded positive-sense RNA genome of approximately 7.7 kb. The viral genome contains one open reading frame (ORF) that encodes a single polyprotein including structural proteins, P1 region (VP4/VP2/VP3/VP1), and nonstructural proteins, P2 (2A1/2A2/2A3/2B/2C) and P3 (3A/3B/3C/3D) regions, as well as two untranslated regions (5′ UTR and 3′ UTR) [
16]. The DHAV 3D protein was confirmed to recognize and bind the 3′ UTR as an RNA-dependent RNA polymerase (RdRp) [
17]. The processing of the polyprotein depends on viral proteases to produce functional and mature proteins. In general, the leader protease in aphthovirus, 2A protease in enteroviruses, and 3C protease in most picornaviruses contribute to the processing of the polyprotein [
18,
19]. In contrast to the highly nonconserved 2A proteins in the family
Picornaviridae, the 3C protease is a conserved chymotrypsin-like serine protease with a conserved catalytic triad of His-Asp-Cys. Furthermore, due to its structural conservation, the 3C protease is an important antiviral target for the development of inhibitors [
20‐
23]. Regarding DHAV, it does not possess an L protein but has three 2A proteins. Specifically, DHAV possesses an NPG/P autocleavage motif in 2A1, avrRpt2-induced gene 1 (AIG1) domain in 2A2, and H-NC motif in 2A3 protein [
24,
25]. It is likely that the 3C protease is an important putative protease in DHAV for polyprotein processing [
26] (Table
1).
Table 1
Predicted protease cleavage sites of the DHAV polyprotein
1AB/VP0 | 1–256 | 256 aa | PFDNQ/GKRKP | 40% | 3Cpro |
1C/VP3 | 257–493 | 237 aa | ATNNQ/GDTNQ | 43.33% | 3Cpro |
1D/VP1 | 494–731 | 238 aa | DLEIE/SDQIR | 33.33% | 3Cpro |
2A1 | 732–751 | 20 aa | EPNPG/PILVV | 46.47% | ribosome skipping site |
2A2 | 752–912 | 161 aa | PEFVS/HLPRL | 43.33% | 3Cpro |
2A3 | 913–1036 | 124 aa | ITTDQ/SFPGK | 36.67% | 3Cpro |
2B | 1037–1155 | 119 aa | MLEDQ/SGKTT | 43.33% | 3Cpro |
2C | 1156–1488 | 333 aa | SFMNQ/SKVRR | 46.67% | 3Cpro |
3A | 1489–1581 | 93 aa | RRFAQ/SIYSQ | 40% | 3Cpro |
3B | 1582–1613 | 32 aa | TGLDQ/SGRVN | 53.33% | 3Cpro |
3C | 1614–1794 | 181 aa | PVFNQ/GKVVS | 40% | 3Cpro |
3D | 1795–2247 | 453 aa | | | |
In other reported viruses, the 3C protease targets certain cellular factors for efficient viral infection. For instance, the 3C protease could mediate the cleavage of cellular proteins such as cAMP response element-binding protein-1(CREB-1), polyadenylation factor (CstF-64), and TATA box binding protein (TBP), which are associated with the blockage of host genome transcription [
27‐
29]. Furthermore, the 3C protease is capable of disrupting intrinsic immune responses by inhibiting the functions of some immune factors. During enterovirus infection, the 3C protease induces cleavage of TIR-domain-containing adapter-inducing interferon-β (TRIF), interferon regulatory factor 7 (IRF7) and transforming growth factor-β-activated kinase 1 (TAK1) to escape host antiviral signaling [
30‐
32]. In coxsackievirus B3 (CVB3) infection, the 3C protease cleaves TRIF and mitochondrial antiviral signaling protein (MAVS) to suppress host immunity [
33]. In DHAV infection, it has been reported that activation of the toll-like receptor 7 (TLR7) pathway is involved in the immune response and viral clearance [
34]. To date, some epidemiological, pathogenic and immunological mechanisms of DHAV have been reported [
35‐
37]. It is likely that different picornaviruses adopt various strategies to interfere with cellular resources.
Fluorescence resonance energy transfer (FRET)-based assays have been utilized successfully to monitor enzyme activity using substrates composed of peptides that are known to be recognized and cleaved by a protease. To date, the kinetics of some picornaviral proteases have been characterized, including human rhinovirus (HRV), enterovirus 71 (EV71), hepatitis A virus (HAV) and foot-and-mouth disease virus (FMDV), providing insight into the proteolytic mechanism and inhibitor discovery. The EV71 3C protease exhibited the protease activity (
Km = 30 ± 2 μM,
Vmax = 85 ± 1.4 nM min
− 1) against the 3B-3C cleavage site [
38]. In addition, the enzyme activity of the EV71 3C protease was increased to 60-fold (
Km = 5.8 ± 0.9 μM) against a substrate of the SARV-CoV 3C-like protease compared to the autoprocessing site (VP2-VP3, VP3-VP1, 2A-3C, 3A-3B, 3B-3C, and 3C-3D) [
39]. For FMDV, different mutations in the cysteine residue at position 142 resulted in different reductions in the protease activity of the 3C protease compared to wild type (
kcat/
Km = 990 ± 20 M
− 1 s
− 1) [
40]. However, studies on the DHAV 3C protease have been limited [
41]. Here, we report the activity and localization of the DHAV 3C protease, which provides insight for a better understanding and further characterization of the 3C protease in DHAV infection.
Methods
Cells and virus
The separation and preservation of the DHAV H strain were performed at the Institute of Preventive Veterinary Medicine of Sichuan Agricultural University. Duck embryo fibroblast (DEF) cells were cultured in modified Eagle’s medium (MEM; Gibco) containing 10% newborn bovine serum (NBS; Gibco) and cultured in a humidified 37 °C, 5% CO2 incubator.
Construction of the pEGFP-3C recombinant and mutant plasmids
The pEGFP N1 and pMD19-T simple/DHAV 3C plasmids were digested with
EcoR I and
BamH I (Takara) at 37 °C to generate fragments. The DNA sequence encoding DHAV 3C (181 aa, Table
1) was fused with the green fluorescent protein (GFP) sequence at the N-terminal through ligation. The newly synthesized pEGFP DHAV 3C plasmid was then used for site-directed mutagenesis to alter the catalytic triads of 3C such that the histidine at position 38 or the cysteine at position 144 was substituted with an alanine. The 3C sequence was cloned into the pcDNA 3.1/myc-His (−) vector for expression. All constructs were verified by DNA sequencing. The resulting plasmids, pEGFP-3C, pEGFP-3C-H38A, and pEGFP-3C-C144A, were used for the expression of the fusion proteins.
Evolutionary analysis of the picornaviral 3C protease
The protein sequences of the 3C protease were searched from GenBank in the National Center for Biotechnology Information (NCBI) database. There were eighty protein sequences of different single-stranded RNA viruses, including picornaviruses and dicistroviruses. The sequence alignment was performed by ClustalW in MEGA 7.0 software. The phylogenetic relationship between these protein sequences was analyzed by the maximum likelihood method using MEGA 7.0 software with 1000 bootstrap replicates and visualized with iTOL.
Transfection of plasmid DNA
DEF cells grew to 70–80% confluence in MEM at 37 °C before transfection with plasmid DNA. According to the manufacturer’s standard protocol, transfection was performed with Lipofectamine 2000 reagent (Invitrogen). After 24 h of transfection, the cells were washed with phosphate-buffered saline (PBS) three times and treated with 4′6-diamidino-2- phenylindole (DAPI; Beyotime).
Expression and purification of the DHAV 3C protease
The amplification of the 3C gene was performed after using DHAV RNA (DHAV-H; YP_007969882.1) as a template to perform reverse transcription. It was cloned into the
Nde I and
Hind III sites of the pET32a vector to construct the DHAV 3C protease linked with a hexahistidine tag at its N-terminus (primer sequences are shown in Table
2). The recombinant plasmid was sequenced for verification to ensure no mutations. Subsequently,
Escherichia coli BL21 cells were transformed with plasmids for expression. The positive BL21 cells were cultured in Luria-Bertani (LB) medium containing 100 mg/liter ampicillin at 37 °C. Protein expression was induced with isopropyl-β-D-thiogalactopyranoside (IPTG) at different concentrations for 12 h at 16 °C when the optical density at 600 nm (OD600) of the culture reached 0.6. Cells were harvested and then resuspended in lysis buffer [50 mM NaH2PO4·2H2O (pH 8.0) and 300 mM NaCl]. Subsequently, the cells were ultrasonically lysed on ice. After centrifugation at 10,000×g for 20 min at 4 °C, the supernatant of the lysate was loaded into an equilibrated nickel ion-agarose affinity chromatography. Ni-NTA was washed with lysis buffer containing imidazole at low concentrations (10 mM and 20 mM), and nonspecific proteins were removed by washing. Subsequently, the 3C protease was eluted with lysis buffer containing 100 mM imidazole. Then the purified 3C protease was concentrated at 4 °C to 2 mg/ml in a reaction buffer [150 mM NaCl, 20 mM Tris-HCl (pH 7.0), 5 mM DTT (pH 5.2), 1 mM EDTA, and 10% glycerol]. All 3C protein was stored at − 80 °C until use. Statistical analysis was performed with GraphPad Prism 5 software.
Table 2
Primers used in this study
pET32a-3C-F | CATATGATGCACCATCATCATCATCATAGCGGGCGGGTGAATTTCAGACATA |
pET32a-3C-R | AAGCTTTTATTGATTAAAAACTGGAAAGACCCTA |
3C-H48A-R | GTAAATTTAGACGCCCCAAATGTCA |
3C-H48A-F | TTTGGGGCGTCTAAATTTACACAAT |
3C-C144A-R | CAAGCACACCACCCGCGGAGCCAGG |
3C-C144A-F | GGCTCCGCGGGTGGTGTGCTTGTAG |
EGFP-3C-F | GAATTCTTATGAGCGGGCGGGTGAATTTCAGACATA |
EGFP-3C-R | GGATCCGGTTGATTAAAAACTGGAAAGACCCTA |
Western blot analysis
Recombinant proteins were separated by SDS-PAGE and transferred onto a polyvinylidene fluoride (PVDF) membrane. Subsequently, the PVDF membranes were blocked with 5% skim milk at 37 °C for 1 h and then incubated with rabbit anti-DHAV serum (1:500 dilution) at 4 °C overnight. Then, the membranes were washed with TBST (containing 0.1% Tween-20) three times and incubated with goat anti-rabbit antibody (Bio-Rad, 1:5000) at 37 °C for 1 h respectively. After that, the membranes were washed in PBST and treated with Western BLoT Chemiluminescence HRP Substrate (TaKaRa) for the detection of specific bands. The bacterial lysate of the empty vector was used as a control group.
Preparation of polyclonal antibody
The purified DHAV 3C protease was used to generate a polyclonal antibody. Approximately 20 μg 3C protein and an equal volume of Quick Antibody adjuvant (Biodragon-Immunotech) were mixed and then injected into 6-week-old female BALB/c mice. After 2 weeks, a booster immunization was needed in the same manner. Using an indirect enzyme-linked immunosorbent assay (ELISA), serum antibody titers were measured, and then anti-serum was collected from the eyeballs of mice and frozen at − 80 °C.
Indirect immunofluorescence microscopy (IFA)
DEF cells were grown to 50–70% confluence on glass coverslips as a monolayer before being infected with DHAV (1000 TCID50). The cells were fixed at appropriate intervals postinfection in 4% paraformaldehyde for 60 min and then rinsed with PBS. DEF cells were permeabilized with 0.2% Triton X-100 for 30 min at room temperature and incubated with 5% BSA blocking solution for 60 min followed by overnight incubation with anti-3C antibody. Then, the cells were incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG for 60 min. After that, the cells were washed in PBST and treated with DAPI (Beyotime). A confocal microscope (Nikon A1) was used to capture images.
Synthesis of substrate peptides
The synthetic peptide substrate that was tested with a high-performance liquid chromatography (HPLC)-based assay was purchased from TOP Biochem (Shanghai, China). The synthetic peptide substrates were attached with a fluorescence quenching pair, 5′-[(2-aminoethyl) amino] naphthalene-1-sulfonic acid (Edans) and p-(p-dimethylaminophenylazo) benzoic acid (Dabcyl) as a donor and a quencher moiety, respectively. Corresponding to the DHAV-H polyprotein processing site between 2C–3A, the fluorogenic peptide Dabcyl-ASFMNQSKVRRFE-Edans (96% purity) was designed.
In vitro cleavage assay
Fluorescence experiments were performed with Varioskan® Flash. The determination of the cleavage activity of the DHAV 3C protease was performed in 100 μl reaction buffer [150 mM NaCl, 20 mM Tris-HCl (pH 7.0), 5 mM DTT (pH 5.2), 1 mM EDTA, and 10% glycerol] containing 50 μl enzyme (10 μM) and 50 μl peptides (2 μM to 300 μM). Reaction mixtures were incubated in a black 96-well microplate at 37 °C. When the protease cleaved the quencher bond, the fluorophore separated from the fluorescence quencher moiety enabling fluorescence to be detected. The relative fluorescence reflected the degree of protease activity. The relationship between substrate concentration and the relative fluorescent unit (RFU) was measured with the Edans standard. The RFU measurements were collected using an excitation wavelength of 340 nm and an emission wavelength of 490 nm. Lineweaver-Burk’s method was applied to calculate Km and Vmax. The protease and substrate were incubated respectively at five different temperatures (4, 16, 30, 37, and 50 °C). In addition, the reaction sample was carried out at different pH values (5, 6, 7, 8, 9, and 10) or with different NaCl concentrations in buffer (50, 100, 150, 200, and 500 mM) to examine the optimal cleavage reaction conditions for the DHAV 3C protease. The fluorescence of the reaction was detected following incubation at 37 °C for 2 h. Triplicate reactions were carried out to identify the effects of temperature, NaCl concentration, and pH value on the activity of the DHAV 3C protease.
Discussion
Many picornaviruses are significant human and animal pathogens that cause considerable economic burdens. Viral proteases (2A protease and 3C protease) have been attractive targets for the development of antiviral drugs [
44,
45]. Proteases in the
Caliciviridae family (3C-like protease, 3CL protease) and
Coronaviridae family (3CL protease, papain-like protease) were shown to function similarly in proteolytic processing [
46,
47]. Conserved viral genes, including those encoding a 3C protease or 3CL protease, characterize the viruses in the picornavirus-like supercluster. Possessing common characteristics, for example, conserved active sites, the 3C proteases and 3CL proteases serve as conducive targets for the design of broad-spectrum and safe antiviral drugs [
48‐
50].
Sequence alignment suggests that the DHAV 3C protein possesses a 3C cysteine protease domain and a typical Cys-His-Asp catalytic triad. In this study, we applied FRET-based assays to determine the activity of DHAV 3C protease. When the peptide bond was cleaved by the 3C protease, it caused the separation of the fluorescence quencher moiety and fluorophore. Due to the disappearance of the FRET effect, the fluorescence of the fluorophore was detected. Hence, FRET-based assays have been applied successfully to monitor protease activity, and substrates that are recognized and cleaved are required for this assay. By testing autoprocessing sites (VP2-VP3, VP3-VP1, 2A-2C, 3A-3B, 3B-3C and 3C-3D), EV71 showed the most efficient enzyme activity towards the 3B-3C junction site. The EV71 3C protease showed the activity (
Km = 30 ± 2 μM,
Vmax = 85 ± 1.4 nM min
− 1) against the 3B-3C junction site [
38]. The 2C-3A junction could be rapidly hydrolyzed in poliovirus (PV)-infected HeLa cells. Based on the HPLC assay, the 2C-3A junction was the most efficient substrate for 3C protease of EV71 and CVA16. Subsequently, using FRET peptides confirmed that peptide containing 2A-3C junction was most efficiently cleaved with a
Km of 63.2 ± 3.6 μM [
44]. Therefore, the 2C-3A junction in the polyprotein of DHAV was used to design the fluorescence peptide. The DHAV 3C protease demonstrated the activity against the 2C-3A junction (
Km = 50.78 μM,
Vmax = 16.52 nmol/min). Here, we have report for the first time the substrate specificity and kinetic parameters of the DHAV 3C protease, which could provide basic information for antiviral development in the future. In addition, we have evaluated the inhibitory activity of AG7088 for the DHAV 3C protease. Further experiments are needed to detect other efficient substrates.
Our study shows that the DHAV 3C protease could localize to the nucleus of DEF cells, presumably due to the degradation of specific nucleoporins. This result is consistent with the observations of the 3C protease in other picornaviruses. The wild-type (WT) 3C protease sequence was altered with a histidine- or cysteine-to-alanine base substitution to create 3C protease mutants with greatly reduced catalytic activity. We observed fusion protease distribution throughout the cell except for some fluorescent signals in the cytoplasm of cells transfected with EGFP-3C-H38A and EGFP-3C-C144A. It was reported that when HeLa cells were transfected with EGFP-3C [containing a PV 3C gene sequence], EGFP expression was detected throughout the entire cells. Due to the generation of high quantities of free GFP in cells transfected with EGFP-3C, whether the 3C protease could localize to the nucleus was inconclusive [
51]. In a previous report, it was confirmed that 3D and 3CD precursor proteins could enter the nucleus in PV-infected cells. However, these proteins localized to the cytoplasm of uninfected cells [
51]. Furthermore, 2A
pro of PV was demonstrated to be responsible for the redistribution of 3CD to the nucleus [
52]. Subsequently, the HRV 3C protease was demonstrated to have a nuclear-targeting ability by causing the degradation of nuclear pore components [
53]. The localization of the 3C protease in the nucleus is important for host cell transcription shut-off induced by picornaviruses. Hence, this has significant implications for future research.
The 3C protease is one of the most attractive viral proteins involved in the virus-host interaction and serves as a significant target for designing anti-picornavirus drugs [
54]. More research on the protease activity of the viral 3C protease is still ongoing. For example, the 69th residue (Asp) of EV 3C has been identified as a novel and important site that is involved in protease activity and is a virulence determinant [
55]. Furthermore, the 3C protease of PV lost protease activity when the 70th residue (Leu) was mutated to proline [
56]. In this study, the 3C protease was obtained by prokaryotic expression, and its enzymatic activity was detected with a cleavage assay in vitro. Our results demonstrated the localization of the 3C protease in DHAV infected cells and transfected cells and its ability to move into the nucleus. These findings provide us with an important starting point to determine the function of the DHAV 3C protease.