Background
The family Baculoviridae is composed of insect-specific DNA viruses containing covalently closed, double-stranded DNA genomes ranging from 80 to 180 k bp with 90 to 180 open reading frames (ORFs). This viral family is divided into four genera (
Alphabaculovirus,
Betabaculovirus,
Gammabaculovirus and
Deltabaculovirus) that include lepidopteran-specific baculoviruses, lepidopteran-specific granuloviruses, hymenopteran-specific baculoviruses, and dipteran-specific baculoviruses, respectively [
1]. The viral life cycle presents a biphasic infection process generating progeny with two different phenotypes: budded viruses (BVs), which are produced at the initial stage of the multiplication cycle that are responsible for systemic infection inside the insect host [
2,
3] and occlusion-derived viruses (ODVs) produced in the late stage of the cycle that are required for the primary infection that takes place in the midgut epithelium cells of the insect host [
4,
5]. Finally, mature ODVs are occluded in a protein matrix to form polyhedra that protect the ODVs from the environment [
6].
The
Bombyx mori nucleopolyhedrovirus (BmNPV)
orf64 (
Bm64) encodes a gene product 110 amino acids in length [
7]. Its homologs are present in all of the sequenced baculovirus genomes and are assigned as a baculovirus core gene [
8,
9]. A recent proteomic study determined the protein composition of ODVs of HearNPV and concluded that the homolog of Bm64 was associated with ODVs [
10]. Recently, the function of the
Bm64 homologue
Autographa californica multiple nucleopolyhedrovirus (AcMNPV)
ac78 was analyzed [
11,
12]. Tao et al. demonstrated that Ac78 was localized in the BV and ODV envelopes and was required for BV production and ODV formation [
12]. A similar phenotype was detected during the investigation of the
Bm64 homologue
Helicoverpa armigera nucleopolyhedrovirus
ha72. HA72 was demonstrated to be required for BV production and ODV embedding. Moreover, the IPLKL motif at the N terminus was shown to play an important role in its function [
13]. More recently, Li et al. found that Ac78 was not essential for BV production and ODV formation [
11], which was a contradictory result. To date, there is no consensus concerning the function of the Bm64 homologue in the viral infection cycle (Additional file
1: Table S1).
Although interruption of
Bm64 resulted in a single-cell infection phenotype [
14], the function of
Bm64 in viral infection was not determined in detail. To investigate the role of
Bm64 during BmNPV replication, we generated a
Bm64-deletion virus (vBm
64KO) in
Escherichia coli through homologous recombination. The
Bm64-deletion decreases BV production but has little effects on viral DNA replication and very late protein expression. Electron micrographs revealed that mature ODVs were detected in the nuclei of vBm
64KO-transfected cells.
Per os infection assay results showed that the polyhedra of vBm
64KO were unable to infect silkworm 5th instar larvae. Our results suggested that Bm64 played an important role in BV production and
per os infection but was not required for viral DNA replication or ODV maturation.
Discussion
All baculoviruses sequenced to date contained homologues of 37 core genes, suggesting that these genes performed key functions in the baculovirus life cycle [
8,
18,
19]. In this study, we investigated the role of a recently identified core gene (BmNPV
Bm64). We found that
Bm64 played important roles in BV production and
per os infection but was not required for viral genome replication or mature ODV formation.
Homologues of
Bm64 are found in all baculoviruses, suggesting that this protein is required for a function utilized by all members of the
Baculoviridae [
20]. A Bm64 homologue was detected in the envelope of both ODVs and BVs [
10]. At least 5 other proteins in addition to Bm64 are specifically localized to the envelopes of BVs and ODVs, including Ubiquitin, Ac68, E25, PIF-4, and E18 [
10]. BV production and ODV formation are not affected by the deletion Ac68 and PIF-4 [
21,
22]. In contrast, a
ubiquitin mutant virus caused a 5-10-fold reduction in BV production, and E25 and E18 were required for efficient BV production and ODV formation [
16,
23].
The role of
Bm64 in the context of BmNPV infection in BmN cells was analyzed using the
Bm64 knockout bacmid. End-point dilution and qPCR assays demonstrated that vBm
64KO had a defect in BV production. Electron microscopy showed that nucleocapsids produced by vBm
64KO were morphologically indistinguishable from those observed for either vBm or vBm
64RE (Fig.
4), and mature enveloped ODVs were found in vBm
64KO -transfected cells. These results indicated that Bm64 played an important role in BV production but was not required for the formation of mature ODVs.
After nucleocapsids replicate in the nuclei of infected cells, they need to exit in order to spread the infection. They have been suggested to rapidly egress from the nucleus to the cytoplasm and obtain the envelope from the cytoplasmic membrane [
18]. Many viral proteins were shown to be essential for this process. Some were required for the egress of the nucleocapsids from the nucleus (e.g., Ac66 [
24] and Ac88 [
25]). Others that were not required for nucleocapsid egress from the cells affected the viral titer (e.g., Ac109 [
26] and Ac34 [
27]). Finally, some genes were involved in the transfer of the nucleocapsids to the cytoplasm (e.g., P78/83 [
28]). During the baculovirus infection cycle, nucleocapsids undergo intracellular motility driven by actin polymerization; the motility requires at least the viral P78/83 protein and the host Arp2/3 complex [
28].
The subcellular localization of Bm64 demonstrated that this protein was primarily distributed in the ring zone of infected nuclei during viral infection (Fig.
5). A recent study demonstrated that
ac78 was required for nucleocapsid egress from the nucleus [
12]. Many proteins are localized to the ring zone of infected nuclei, such as Ac76 [
29], P33 [
13], Ac93 [
19], and E25 [
30]. The ring zone is very important for nucleocapsid envelopment and egress from the nucleus. Ac78 was demonstrated to interact with P33 in the ring zone; both Ac78 and P33 are BV envelope components, suggesting that BVs obtain these ring zone-localized proteins from the nucleus [
13]. The ODV envelope proteins P74, PIF-1, PIF-2, and PIF-3 form a complex on the ODV envelope [
31] and are not required for ODV formation and ODV embedding into polyhedra [
32], indicating that these proteins are nonessential for the recognition between nucleocapsids and intranuclear microvesicles or between ODVs and polyhedra. Consistent with the previous study,
per os infectivity assays demonstrated that Bm64 was required for the BmNPV oral infection process, indicating that Bm64 played an important role in ODV primary infection [
11].
Our results agree with the findings of Li et al. that
ac78 (
Bm64 homolog) plays an important role in BV production efficient ODV occlusion [
11]. However, deletion of
ac78 resulted in a more severe defect for AcMNPV BV infection. A comparison of the predicted amino acid sequences of Bm64 homologues showed that the conservation was very low (Additional file
2: Figure S1) [
13], suggesting that the functions of Bm64 homologues during viral infection might differ. The characteristics of baculovirus core genes were demonstrated to be conserved, but they might have different functions in the viral infection cycles.
Methods
Bacmid, virus, and cells
The
E. coli strains BW25113 containing the plasmid pKD46 and BW25141 harboring the plasmid pKD3 (encoding the chloramphenicol resistance gene) were kindly provided by Mary Berlyn (Yale university). The
E. coli strain DH10H (containing a helper plasmid pMON7124) and DH10BmBac (containing a BmNPV bacmid and a helper plasmid pMON7124) were constructed previously in our lab [
33]. BmN cells were cultured at 27 °C in TC-100 insect medium supplemented with 10 % fetal calf serum (Gibco, USA).
Total RNA preparation, RT-PCR and 5’ rapid amplification of cDNA ends (5’RACE) analysis
BmN cells were infected with BmNPV at a multiplicity of infection (MOI) of 5 50 % tissue culture infective doses (TCID50). At various time points post-infection (p.i.), total cellular RNA was isolated according to the manufacturer’s instructions (RNeasy mini kit, Qiagen, Germany). Reverse transcription-PCR (RT-PCR) was performed with an EasyScript First-Strand cDNA Synthesis SuperMix kit (Transgen, China) using 2.0 μg of total RNA as the template for each time point. Synthesis of first-strand DNA complementary to the mRNA (cDNA) was performed using the avian myeloblastosis virus reverse transcriptase and oligo(dT) primers according to the manufacturer’s instructions. The Bm64-specific primers Bm64-F (5’-ATGAATTTGGACGTGCCATAC-3’) and Bm64-R (5’-CTCGATTAACCACAATGAACGTCTAGAGC-3’) were used for PCR amplification to detect the Bm64 transcripts.
To characterize Bm64, its temporal expression was examined by 5’RACE analysis. The 5’RACE procedure was performed using the SmarterTM RACE cDNA Amplification Kit (Clontech, USA) with 1 μg of purified total RNA isolated from BmNPV-infected cells at 48 h p.i.. A Bm64-specific primer (Bm64-RACE, 5’-GCTTGCTCCTGTTTGAGTTCAG-3’) was used for cDNA synthesis and PCR amplification following the manufacturer’s instructions. The PCR products were gel purified and cloned into the pGEMT-easy vector (Promega, Madison, USA).
Generation of the Bm64-knockout BmNPV bacmid
A
Bm64-knockout BmNPV bacmid was generated as previously described [
16]. A chloramphenicol resistance gene (
Cm) was amplified using Bm64KO-F (5’-
GACACGTTGCTCGTCGTGTTGTTATAGCCCACCATCATGTCGTCTATTGGGTGTAGGCTGGAGCTGCT-3’) and Bm64KO-R (5’-
ACATGAATTTGGACGTGCCATACTATCGGTTGGGCAACCACGAAAAG
CATATGAATATCCTCCTTAG -3’) with pKD3 as the template. These primers contained 50 and 47 bp sequences homologous to the upstream and downstream flanking regions (underlined sequences) of
Bm64, respectively; a stop codon (black box) was also introduced. The
Cm cassette PCR fragment was gel purified using a QIAquick PCR purification kit (Qiagen, USA) and electroporated into
E. coli BW25113 cells containing the BmNPV bacmid. The electroporated cells were incubated at 37 °C for 3 h in 1 ml of SOC medium (2 % Bacto tryptone, 0.5 % Bacto yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl
2, 10 mM MgSO
4, and 20 mM glucose) and plated onto agar medium containing 7 μg/ml chloramphenicol and 50 μg/ml kanamycin. The plates were incubated at 37 °C overnight. Colonies resistant to both chloramphenicol and kanamycin were selected and confirmed with the primers Bm64-R (5’- CTCGATTAACCACAATGAACGTCTAGAGC -3’) and Cm-F (5’-TTGTTACACCGTTTTCCATGAGC-3’) to detect the correct insertion of the
Cm in the region of the
Bm64 locus.
The recombinant bacmids confirmed by PCR and sequencing were selected and designated bBm64KO. The identified bBm64KO was extracted and electro-transformed into E. coli DH10βH to generate DH10Bm64KO cells containing both the Bm64-deleted bacmid and the helper plasmid.
Construction of the Bm64 knockout, repair, and positive control BmNPV bacmids
The
Bm64 knockout, the repair and the positive control BmNPV bacmids containing
polyhedrin and
gfp (enhanced green fluorescence protein gene) were constructed by site-specific transposition as previously described [
34]. The pFast-PH-GFP (containing
polyhedrin and
gfp) was constructed as described and transformed into electrocompetent DH10BmBac or DH10Bm
64KO cells to generate the
Bm64 knockout bacmid (vBm
64KO) or the positive control bacmid (vBm), respectively.
To construct a repair bacmid (vBm
64RE), a 531 bp fragment containing the Bm64 gene with its native promoter was amplified using the primers Bm64RE-F (5’-GAAGGCCTCAAGTGTTTGCGCAACGCAAC-3’) and Bm64RE-R (5’-GCTCTAGACGTTCATTGTGGTTAATCGAG-3’). The repair fragments were cloned into the pFast-PH-GFP plasmid to generate pFast-PH-Bm64RE-GFP. pFast-PH-Bm64RE-GFP was used to transpose the parental knockout bacmids to generate the
Bm64 repair bacmid (vBm
64RE). To confirm vBm
64RE by PCR, we used the primer Bm64CF-R (5’-GTTCGCTGGTGATATCATCGTTGAG -3’) located in the deletion sequence of vBm
64KO. vBm
64RE was confirmed with Bm64RE-F/Bm64CF-R. Bacmid DNA was extracted and quantified as described previously [
35].
Viral growth curve analysis and plaque assay
BmN cells (1.0 × 10
6) were transfected with 1.0 μg of each bacmid (vBm, vBm
64KO, or vBm
64RE). At 36 and 96 h p.t., the progression of viral infection was monitored by fluorescence microscopy. A viral plaque assay was performed as previously described [
36]. Briefly, BmN cells were plated at a density of 1 × 10
6 cells/35-mm-diameter well of a six-well plate. The cells were transfected with 10 ng of vBm, vBm
64KO, or vBm
64RE bacmid DNA. Then, the monolayers were overlaid with 1 % low-melting-point agarose for cell culture (Gibco, USA) in complete Grace’s medium. The plaques were photographed and measured 72 h p.t..
Analysis of the viral growth curve
To evaluate the viral replication of vBm, vBm64KO, and vBm64RE, BmN cells were infected in triplicate with each virus (vBm, vBm64KO, or vBm64RE) at an MOI of 3. After 1 h of incubation, the cells were washed twice and the medium was replaced with fresh TC100 medium. Supernatants were collected at the indicated time points (6, 12, 24, 48, 72, and 96 h p.i.), and the titers were determined by an end point dilution assay on BmN cells.
TCID
50 was used to determine the infectious virions, whereas quantitative real-time PCR (qPCR) was performed to confirm the baculovirus stocks as previously described [
37]. Briefly, an aliquot of each supernatant (250 μl) was processed using a viral DNA kit (Omega, USA). A 2.0 μl aliquot of each purified DNA sample was mixed with 10 μl of SYBR® Premix ExTaq (TaKaRa, Japan) and the qPCR primers in a 20 μl reaction volume. The PCR was performed using the 7300 Real-Time PCR system (ABI, USA) under the following conditions: 95 °C for 30 s and 45 cycles of 95 °C for 5 s and 60 °C for 31 s.
Quantitative real-time PCR (qPCR) DNA replication assay
To detect viral DNA replication, a qPCR assay was performed as previously described [
38]. BmN cells were infected with vBm, vBm
64KO, or vBm
64RE at an MOI of 1 and harvested at different time points. Total DNA was extracted with the Classic Genomic DNA Isolation Kit (Sangon, Canada). Q-PCR was performed with a 500 nM concentration of each primer using the 7300 Real-Time PCR system (ABI, USA) under the following conditions: 95 °C for 30 s and 45 cycles of 95 °C for 5 s and 60 °C for 31 s.
Transmission electron microscopy (TEM)
BmN cells (5 × 10
6 cells) were infected with vBm, vBm
64KO, or vBm
64RE at an MOI of 5. At the indicated time point post-infection, the cells were collected and centrifuged at 5000 rpm for 5 min. Then, the cells were fixed, dehydrated, embedded, sectioned, and stained as previously described [
16]. The samples were visualized with a TEM Model JEM-1230 at an accelerating voltage of 120 kV.
Construction of GFP fusion recombinant bacmids and microscopy determination
To monitor the localization of Bm64 in BmNPV-infected BmN cells, GFP was fused at the N-terminus of Bm64 under the control of the
Bm64 promoter (pBm64) to create a GFP-Bm64 fusion protein. A recombinant fusion bacmid (vBm
GFP-Bm64) and a control bacmid (vBm
GFP) were constructed as previously described [
30]. The
Bm64 promoter was PCR-amplified using the primers Bm64pro-F (5’-GACCATGGCAAGTGTTTGCGCAACGCAAC-3’) and Bm64pro-R (5’-CGGAATTCCCACGTCCAAATTCATGTTTACAAC-3’). The enhanced green fluorescent protein (
egfp) was amplified with the primers EGFP-F (5’-AAGCTTCGCCACCATGGTGAGCAAG-3’) and EGFP-R (5’-GGTACCCTTGTACAGCTCGTCCATG-3’), while
Bm64 was amplified with Bm64-F (5’-GGTACCATGAATTTGGACGTGCCATAC-3’) and Bm64-R (5’- AAGCTTCGTTCATTGTGGTTAATCGAG -3’). BmN cells (1 × 10
6) were transfected with 1 μg of vBm
GFP-Bm64 or vBm
GFP DNA. At 96 h p.t., the supernatants were collected, and the BV titers were determined by an endpoint dilution assay. For microscopy analysis, BmN cells (5 × 10
5) were infected with vBm
GFP-Bm64 or vBm
GFP at an MOI of 1. At 36 and 72 h p.i., the cells were examined with a microscope to analyze the GFP fluorescence.
Purification of ODVs for western blot analysis
The polyhedra were prepared from the infected cells as previously described [
31]. Polyhedra were suspended in DAS buffer (0.1 M Na
2CO
3, 166 M NaCl, and 10 mM EDTA, pH 10.5), and the solution was neutralized with 0.5 M Tris–HCl (pH 7.5). After removing the insoluble debris, the ODVs were collected by centrifugation at 50,000 × g for 60 min at 4 °C and resuspended in 0.1× TE at 4 °C.
Protein samples were separated by SDS-polyacrylamide gel electrophoresis (PAGE) with a 12 % acrylamide separating gel. For Western blot analysis, the gels were electroblotted onto nitrocellulose (NC) membranes. Proteins on the membranes were blocked in 25 mM Tris-base (pH 7.4) with 140 mM NaCl, 2.7 mM KCl, 0.05 % Tween-20 (TBS-T) and 5 % milk. For immune detection, the membranes were incubated for 2 h at room temperature with the primary anti-E25 rabbit polyclonal antibody (1:1000). The secondary antibody was added, and the blots were incubated for 2 h prior to three washes in TBS-T. The secondary goat anti-rabbit IgG antibody conjugated with horseradish peroxidase (Amersham Biosciences, Germany) was diluted 1:2000 in TBS-T with 5 % milk. Blots were detected using an enhanced chemiluminescence system (ECL; Thermo, USA) according to the manufacturer’s instructions and analyzed with Image J (
http://rsb.info.nih.gov/ij).
In vivo infectivity assays
The infectivity of the ODVs in vivo was examined by orally inoculating newly molted 5th instar
Bombyx mori larvae with the polyhedra of vBm, vBm
64KO, or vBm
64RE. The polyhedra were purified from transfected BmN cells, and the oral infectivity bioassays were performed as previously described [
22]. A cohort of 30 larvae was used for each treatment, and the treatment was repeated in triplicate. Infected larvae were reared with fresh mulberry until all larvae pupated or died. At 4 days post-molt, the blood of the
Bombyx mori larvae was collected and observed under a microscope to detect the virus infection.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
LC performed the molecular genetic studies and drafted the manuscript. YS participated in the sequence alignment and performed the virus replication assays. RY and WH participated in the TEM assays. XW participated in the design of the study and performed the statistical analysis. GS conceived of the study, participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.