Background
Several cell types including basal cells and submucosal gland duct cells have been shown to function as stem/progenitor cells in proximal murine airways [
1]. In distal murine airways, the abundant club cell (Clara) (previously known as the Clara cell) is believed to function as a ‘facultative progenitor cell’ that can contribute to re-epithelialisation of the airways after injury [
2]. The club cell has been described as being functional flexible, or ‘plastic’, because it loses its characteristic differentiated phenotype while it is renewing the injured epithelium and has been described as ‘undifferentiated’ during this period. Subsequently, re-differentiation occurs and club cell functions are restored. However, the precise phenotype of reparative epithelial cells, such as club cells, while they are in the process of actively repairing tissues has received little attention to date. Such cells are poorly characterised in any tissue type, including the airways. During epithelial wound repair, surviving epithelial cells are required to become migratory in order to re-epithelialise damaged tissues. We have shown previously that an airway epithelial cell migration phase precedes a proliferation phase in the airway epithelium
in vivo following acute lung injury and that increased bone morphogenetic protein (BMP) signalling is an early event during re-epithelialisation [
3]. However, wound repair processes in the airways, and the signals that control them, remain poorly understood.
Myofibroblasts play a key role in tissue repair [
4]. These are contractile cells and express α-smooth muscle actin (α-SMA). During repair, myofibroblasts secrete a temporary injury matrix of extracellular matrix (ECM) components. Epithelial cells migrate over the injury matrix and divide to replace damaged cells. During the remodelling stage, myofibroblasts promote contraction of the wound. While myofibroblasts play a key role in both normal and abnormal wound repair in the lungs, the source of these cells is unclear. It is thought that local mesenchymal cells, bone marrow progenitor cells and lung epithelial cells can all give rise to myofibroblasts, the latter through EMT [
5]. EMT occurs during development and carcinogenesis and has been proposed as a contributory mechanism in fibrotic diseases [
5]. During EMT, epithelial cells lose many of their characteristic properties and acquire features typical of mesenchymal cells. Protein expression is altered to allow cells to become less tightly attached to each other and more migratory. Transcriptional downregulation of epithelial cell-cell adhesion molecules occurs, and loss of E-cadherin in particular is considered a hallmark of EMT. Typically, cytokeratin intermediate filaments are replaced by vimentin and often α-SMA is expressed. In addition to development, cancer and fibrosis, an EMT-like process may occur during normal epithelial wound healing although this concept has been mentioned only sporadically in the literature [
6].
Transforming growth factor-β1 (TGF-β1) is considered the prototype inducer of EMT and has been widely studied in this capacity [
7,
8]. Bone morphogenic proteins (BMPs) are highly conserved members of the TGF-β superfamily of cytokines and are involved in a number of processes throughout the body including morphogenesis, cell proliferation, differentiation, apoptosis and EMT [
9]. BMP4 is an important regulator of lung morphogenesis during development and gremlin, a regulator of BMP signalling, negatively regulates BMP4 during lung branching morphogenesis [
10,
11]. However, few studies have addressed the role of BMP signalling in adult lungs in health, regeneration or disease. We have shown previously that increased bone morphogenetic protein (BMP) signalling is an early event in regenerating airway epithelial cells (AECs)
in vivo following acute injury [
5]. We have also shown that BMP4 down-regulates E-cadherin and stimulates migration of primary AECs
in vitro indicating that BMP signalling may play a role in epithelial cell migration during normal wound healing in the airway epithelium.
Our group made the first report of an EMT process in AECs when we demonstrated that BMP4 induces EMT in human BEAS-2B cells [
12]. Others have since shown that TGF-β1 induces EMT in primary AECs and that EMT may be enhanced in asthmatic airways [
13,
14]. Inflammation and elevated TGF-beta1 has been shown to result in dysregulated airway epithelial repair and fibrosis in a lung allograft via EMT [
15]. Evidence of EMT in AECs in fibrotic lungs during obliterative bronchiolitis has also been reported [
13]. However, EMT in pulmonary fibrosis remains controversial [
16]. In the present study, we examined the phenotypic changes that airway epithelial cells undergo during wound healing in order to determine whether an EMT-like process, rather than de-differentiation
per se, occurs. EMT has been reported in a study of human skin wound healing, with a role demonstrated for BMP2 [
17]. This, along with our own data on the effects of BMPs on lung cells, led us to hypothesise that BMP ligands may be key regulators of this process. We report that AECs undergo an EMT-like process during wound repair, with downregulation of E-cadherin and increased expression of α-SMA and vimentin, and that BMP signalling plays a role in the process.
Methods
Primary AEC isolation
Ethical approval for this work involving animals was granted by the Biological Sciences Research Ethics Subcommittee, NUI Maynooth. Normal primary mouse AECs were harvested from female C57BL/6 J mice as described previously [
18] with modifications described in [
19]. In brief, lungs were removed from euthanized (sodium pentabarbitol overdose) mice, perfused with saline and digested with trypsin. Lungs were then chopped and filtered and suspensions were centrifuged at low speed to obtain clumps of airway epithelial cells. Because the cells are isolated in clumps, cell counting using a hemocytometer is not feasible. To ensure equal seeding densities, an aliquot of cell isolate was taken before seeding and an absorbance value (A450) was obtained using the Cell Titer 96 AQueous One Solution Cell Proliferation Assay (Promega Corp, Madison, Wisconsin, USA). Cell suspensions were diluted appropriately based on A450 values to obtain equal seeding densities.
Wound closure assay
The wound closure assay is a modification of the Platypus Technologies Oris Cell Migration Assay (Platypus Technologies, Abingdon, UK). Each well of an Oris 96-well plate was prepared as follows: the centre area of the well was coated with 50 ng/ml fibronectin, allowed to dry for 2 hr and a stopper was then placed in the well to cover the fibronectin; the outer ring of the well was then coated with 50 ng/ml collagen and incubated overnight at 4°C; excess collagen was removed and primary mouse AECs were seeded in serum-containing medium (SCM) (1:1 Hams F12:M199 (Gibco, Glasgow, UK), 10% fetal bovine serum, 2 mM L-glutamine (Gibco), 100 U/ml penicillin and 100 μg/ml streptomycin (Gibco)) into this outer area. After 2 days, SCM was replaced with defined serum-free medium (SFM) (1:1 Hams F12:M199 (Gibco), 2 mM l-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, 100 U/ml insulin-transferin-selenium (Gibco), 100 ng/ml hydrocortisone (Sigma-Aldrich, Dublin, Ireland) and 10 ng/ml epidermal growth factor (R&D Systems, Minneapolis, USA)). On day 5, plugs were removed and medium was replaced with fresh SCM. After 24 hr, cells were stained with 0.1% crystal violet stain (Sigma-Aldrich). The Oris ‘detection mask’ was used to visualize the wound area with a microscope. A photomicrograph of the entire wound area taken and from this, the total number of migrated cells in each wound was counted using Adobe Photoshop CS3 Extended Cell Count software. To achieve full epithelialisation of the wound area, plugs were removed at day 3 and cells were allowed to grow for a further 4 days in SCM.
Treatment of AECs with BMP2, 4, 7, noggin and gremlin
Freshly isolated AECs were seeded onto Oris 96 well migration plates (Nunc, Roskilde, Denmark) in SCM. At day 2, medium was replaced with SFM. After 24 hr, supernatant was removed and fresh SFM was added containing appropriate concentrations of recombinant BMP2, 4 and 7 (Immunotools, Germany; R&D Systems, Minneapolis, USA) recombinant noggin (Peprotech, Rocky Hill, NJ, USA) or recombinant gremlin (Sigma-Aldrich).
Immunofluorescence
Cultured cells were fixed with pre-chilled methanol. Tissue sections and cells were incubated with primary antibodies overnight at 4°C followed by appropriate Alexa Fluor® 488-labeled secondary antibodies (Molecular Probes, Invitrogen, Paisley, UK) for 30 min at room temperature. Nuclei were counterstained with DAPI (Sigma-Aldrich). Primary antibodies used were: α-SMA (Sigma-Aldrich), p-Smad1/5/8, (Cell Signalling Technology), E-cadherin (clone 36, BD Biosciences, Oxford, UK) and vimentin (Sigma-Aldrich). Secondary antibody only controls were carried out and representative images are shown in Additional file
1: Figure S1.
RT-PCR
Semi quantitative RT-PCR for BMP2, BMP4 and BMP7 was carried out as described previously [
6]. GAPDH was used as the housekeeper control. Primer sets are shown in Table
1.
Table 1
RT-PCR primer sets
BMP2
| 5- CAGCATGTTTGGCCTGAAG −3 | 5- AAGTTCCTCCACGGCTTCTT-3 |
BMP4
| 5-CGTAGTCCCAAGCATCAC-3 | 5-ACAACATGGAAATGGCAC-3 |
BMP7
| 5- GGCTTCTCCTACCCCTACAA −3 | 5- GAACTCCCGATGGTGGTATC-3 |
GAPDH
| 5-CTGCACCACCAACTGCTTAG-3 | 5-CCAGGAAATGAGCTTGACAAA-3 |
Western blotting
Western blotting and densitometric analyses were carried out as previously described [
12]. Primary antibodies used were: actin (clone 20–33, Sigma-Aldrich) and α-SMA (Sigma-Aldrich).
Discussion
The process of airway regeneration after injury and during disease remains poorly understood. In particular, the mechanisms underlying re-epithelialisation are unclear. In the field of airway stem and progenitor cell biology it is generally thought that, in murine bronchiolar regions, club cells function as a reparative cell population [
6]. Following injury, these cells are believed to become ‘un-differentiated’ after which they proliferate and re-differentiate in order to re-epithelialise the airway wall. However, the precise phenotype of these ‘un-differentiated’ cells has not been characterised. Our data suggests that in fact, instead of being un-differentiated, these reparative cells temporarily acquire an EMT-like phenotype in order to carry out re-epithelialisation. This remains consistent with the reported loss of epithelial-related protein expression in these cells. We suggest that following re-epithelialisation of the damaged area, a mesenchymal-epithelial transition (MET) occurs to restore the differentiated epithelium.
In addition, we propose that BMPs play a key role in this wound-related EMT process, mirroring the important role of these proteins in lung development [
20]. Several studies have identified a correlation between BMP signalling and EMT during embryonic development, fibrosis and cancer [
21‐
23]. We now show that BMP induced EMT may also occur in airway regeneration processes. BMP2, BMP4 and BMP7 are important morphogens and are critical to a variety of developmental processes. BMP2 and BMP4 are 92% identical. Homozygous deletions of BMP2 and BMP4 in mice result in embryonic lethality involving abnormal heart development and a failure of mesoderm formation respectively, both involving EMT [
24]. BMP7 also plays a key role in development [
25]. While specific roles for BMP2 and BMP7 in lung development have not yet been described, BMP4 regulates airway branching and influences proximal-to-distal differentiation of airway epithelial cells in developing lungs [
26]. Gremlin is expressed in pulmonary endothelial cells and has been shown to block BMP-stimulated wound healing in these cells [
27]. The roles of these signalling molecules in adult lungs have not been widely studied however. We hypothesised that BMPs 2, 4 and 7 may play key roles in directing lung repair and regeneration after injury and we reported previously that BMP signalling is an early event
in vivo in adult airway epithelial cells following acute lung injury [
3]. We have also previously show that BMP4 induces morphological and phenotypic changes in AECs similar to EMT, including down regulation of E-cadherin, and that cell migration is also increased by BMP4 [
3,
12].
In the present study, we aimed to utilise an epithelial restoration assay to investigate specific aspects of BMP signalling in AECs during regeneration. The demonstration of nuclear localisation of p-Smad1/5/8 in migrating AECs
in vitro here concurs with our previous finding of increased nuclear p-Smad1/5/8 in AECs
in vivo in the early stages of regeneration after acute lung injury [
3]. This activation of BMP signalling pathways was early and transient, both in our previous
in vivo study and in the present study. We believe that BMP signalling is a key early event in regeneration, but is tightly controlled. The BMP signalling pathway can regulate itself by negative feedback control by directly transcriptionally upregulating inhibitor Smads 6 and 7 [
28]. Chronic injury may overwhelm this negative feedback, leading to sustained Smad signalling and resulting in a more permanent EMT and ultimately fibrosis. In our studies, control wells with serum containing media showed enhanced cell migration compared with BMP ligands. Clearly factors such as fibroblast growth factors, FGF, TGF-β1 and possibly additional BMP ligands are likely to be present in serum and play a role in cell migration also.
A small number of other studies have examined BMP signalling pathway components in lung tissue. Smad activation has been reported in AECs during allergic inflammation [
29,
30]. However, the source of BMP ligands in the lungs, and the role of BMP-mediated signalling in AECs, has been unknown. We now demonstrate that autocrine BMP signalling occurs in AECs, possibly via BMP4 and BMP7 which we show are expressed in these cells, and that a function of this signalling is the enhancement of cell migration. Interestingly, levels of BMP2 mRNA were low, suggesting differential roles for BMP2 and BMP4 in AECs. We have also demonstrated that exogenous BMP2, BMP4 and BMP7 are capable of enhancing migration of AECs. Therefore, we can postulate that during airway regeneration
in vivo, the source of BMP4 and BMP7 ligands is likely to include AECs themselves while other cell types are likely to be the source of BMP2. It has recently been reported that BMP2 is expressed in smooth muscle and vascular endothelial cells of blood vessels in vascular and skeletal tissues, but not by lymphatic vessels or macrophages [
31]. Muscle and endothelial cells may also be sources of BMP2 in the lungs. Reports of the role of BMP7 in adult epithelial tissues have been somewhat contradictory. BMP7 has been reported to reverse TGF-β1-induced fibrotic effects
in vitro in organs such as the heart, colon and kidneys [
32]. In contrast, BMP7 does not reverse TGF-β1-induced EMT in human renal epithelial cells [
33] and no inhibitory effect was observed in bleomycin-induced lung or skin fibrosis models [
32,
34]. Our data suggest that BMP7 promotes an EMT-like response in AECs.
In some circumstances, the wound repair process can become disregulated. During situations of chronic inflammation or recurrent injury, excess accumulation of ECM components at the site of injury can lead to permanently remodelled tissue. While myofibroblasts play a key role in both normal and abnormal wound repair in the lungs, the source of these cells is unclear. It is thought that local mesenchymal cells, bone marrow progenitor cells and lung epithelial cells can all give rise to myofibroblasts, the latter through EMT [
4]. However, the extent to which each of these three cell populations contributes to myofibroblast recruitment, and whether these contributions differ in normal versus abnormal repair is unknown. Our data suggests that repairing AECs may be a source of these myofibroblasts. Furthermore we suggest that a paradigm in the fibrosis field could be adjusted also. It has been proposed that severe/chronic injury and/or inflammation in the airways and other tissues causes epithelial cells to undergo EMT that contributes to fibrosis [
35,
36]. Instead, we speculate that chronic/severe injury or inflammation may not directly induce EMT in epithelial cells to cause fibrosis. Rather, EMT occurs as a normal repair process during the initial injury but fails to reverse via MET because of the chronic injury conditions, leading to a permanent EMT that results in airway fibrosis. This is consistent with the view of fibrosis as a permanent injury state, but with the difference that the initial EMT event is a normal injury response. The problem may arise when the subsequent MET is delayed or inhibited by persistent injury/inflammation. If this is correct, strategies to treat fibrosis could address encouragement of MET. Further studies are required to fully characterise the extent to which EMT occurs in AECs during wound healing and to determine whether MET occurs once re-epithelialisation is complete.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
NMcC carried out the AEC isolations, developed the wound closure assay, carried out the migration and BMP assays and drafted the manuscript. EM designed and carried out the RT-PCR assays and analysis thereof. SOD conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.