Background
Asthma is a chronic inflammatory disorder of the airways characterized by structural changes of the airway wall, collectively named remodelling. Airway remodelling is characterized by subepithelial fibrosis, with thickening of the subepithelial basement membrane, fibroblast and myofibroblast accumulation, increased expression of fibrogenic growth factors, and augmented extracellular matrix (ECM) deposition in the subepithelial areas of the proximal airways [
1‐
3]. Other features of airway remodelling include an increase in airway smooth muscle (ASM) mass caused by hypertrophy and hyperplasia, goblet cell hyperplasia, and angiogenesis [
1‐
3]. Resident lung fibroblasts and myofibroblasts are the primary source of ECM proteins which are released under the influence of growth factors such as Transforming Growth Factor
(TGF)-β superfamily members [
4,
5].
The TGF-β superfamily of ligands comprises more than 35 members in mammals, including TGF-β
1-3, activins and Bone Morphogenetic Proteins
(BMPs), which are the largest subgroup of structurally and functionally related proteins of this family [
6]. TGF-β contributes to airway remodelling in asthma via induction of a multitude of responses in lung resident cells. These include apoptosis of epithelial cells, dysregulation of epithelial cell adhesion properties leading to damage of the epithelial cell layer [
7], and enhancement of goblet cell proliferation and mucus hyper-secretion [
5,
8]. TGF-β also induces differentiation of fibroblasts into myofibroblasts and their subsequent proliferation, as well as collagen and other ECM protein production including tenascin-C (Tn-C) and fibronectin by these cells [
9‐
11]. Tn-C is a purported marker of reactivation of the epithelial-mesenchymal trophic unit (EMTU) in asthma. Transient increase of Tn-C in the asthmatic airway following allergen challenge has been identified [
12], and increased production of fibronectin by myofibroblasts may promote epithelial-mesenchymal transition
in-vivo [
13]. TGF-β also enhances proliferation of ASM cells and contributes to increased ASM mass [
14,
15]. Anti-TGF-β treatment has been found to prevent these airway remodelling changes in a murine model of chronic allergen challenge model [
8,
16].
The BMPs are a large class of multifunctional growth factors and are a major developmental signalling pathway critical for embryogenesis and tissue generation in organs such as the kidney and lung [
17]. However, they are also essential during postnatal life, and regulate cell proliferation, differentiation, apoptosis, angiogenesis, and secretion of ECM components [
17,
18]. BMP-7 is thought to have inhibitory effects since it is able to counteract TGF-β1-induced fibrotic effects
in vitro and to reverse established fibrosis in organs as diverse as the kidney, heart and colon [
19‐
26]. However, these antifibrotic effects may be tissue and indeed cell specific since BMP-7 has no effect in a bleomycin-induced lung fibrosis model or on skin fibrosis [
27], and does not reverse TGF-β1-induced epithelial-to-mesenchymal transition in human renal proximal tubule epithelial cells [
28]. In contrast, little is known about the role of BMP-4
in vitro or
in vivo in lung remodelling although previous studies have shown that BMP-4 inhibits proliferation and promotes myocyte differentiation of lung fibroblasts [
29,
30]. We recently demonstrated for the first time the presence of BMP-4 and BMP-7 as well as their receptors in the airways of adult asthmatics [
31]. In this study, BMP receptor expression was down-regulated in asthmatic airways compared to healthy controls which may impede repair responses, although allergen provocation increased expression of BMP-7, activated BMP signalling and increased receptor expression in the asthmatic airways, all of which may contribute to repair [
31]. The cellular targets and regulatory mechanisms activated by the BMPs remain to be determined and nothing is known about their function in the adult lung.
We hypothesised that BMP-4 and BMP-7 may regulate airway remodelling by inhibiting TGF-β1 effects in lung fibroblasts. Our results indicate that BMP-4, but not BMP-7, inhibits TGF-β1 induced cell proliferation of normal human lung fibroblasts (NHLF) and also blocks the production of ECM proteins by these cells. Both BMP-4 and BMP-7 inhibited the differentiation of fibroblasts into myofibroblasts and blocked the release of matrix metalloproteinase (MMP)-13, whereas only BMP-7 was able to inhibit TGF-β1-induced MMP-2 activity. In conclusion, BMP-4 acts as a potent negative regulator of TGF-β1 whereas BMP-7 is only partially effective in our in vitro model of fibroblast activation.
Methods
Normal human lung fibroblast culture and stimulation
Primary adult human lung fibroblasts obtained from healthy, non-smoking donors, (NHLF, Lonza Rockland Inc, Rockland, ME, USA) were seeded in 12-well plastic culture dishes (Sigma-Aldrich, Gillingham, Dorset, UK) and grown at 37°C in a humidified 5% CO
2 atmosphere in fibroblast growth medium (FGM, Lonza Rockland Inc, Rockland, ME, USA) supplemented with 0.5 ml recombinant human fibroblast growth factor-B, 0.5 ml insulin, 0.5 ml gentamicin sulphate amphotericin-B and 2% foetal bovine serum (FBS). Once they reached 80% confluence, NHLF were stimulated for 24 h, 48 h and 72 h with either 5 ng/ml TGF-β1 or 100 ng/ml human recombinant BMP-4 or BMP-7 (R&D Systems Europe Ltd., Abingdon, UK). Cells were also stimulated with 5 ng/ml TGF-β1 in combination with either 100 ng/ml BMP-4 or BMP-7. Those concentrations are based on previously published data obtained in other cell types [
24,
32]
Assessment of NHLF viability and proliferation
The effect of TGF-β1 and BMPs on NHLF viability was determined by colorimetric MTT based assay (Cell Proliferation Kit I [MTT]; Roche Diagnostics Ltd, West Sussex, UK) according to the manufacturer's instructions. Briefly, NHLF were seeded in 96-well plates (Sigma-Aldrich, Dorset, UK) and stimulated as described above for 24, 48, and 72 h in FGM with or without 2% FBS. Cells were labelled by 4 h incubation in MTT labelling agent at 37°C and then solubilisation solution was added overnight. The plates were read on a Microplate reader photometer at 600-nm wavelength. Three independent experiments were conducted. For proliferation experiments, fibroblasts were stimulated as above for 36 h with addition of [3H]-thymidine (1 μCi/ml) for the final 6 h of incubation. Incorporation of [3H]-thymidine was terminated by washing the cells twice with PBS. Cells were then lysed with 0.1 N NaOH, and radioactivity (degradation/minute) measured by a scintillation counter and used as an index of DNA synthesis and fibroblast proliferation, five independent experiments were conducted.
RNA isolation and reverse transcription
Confluent NHLF that had been stimulated for 24 h were recovered in 350 μl lysis buffer RLT contained in the RNeasy Mini Kit (Qiagen, West Sussex, UK) supplemented with 1% 2-βmercaptoethanol (Sigma-Aldrich, Gillingham, Dorset, UK) and then stored at -80°C. Total RNA was isolated using this same kit according to manufacturer's instructions. Reverse transcription was performed for 2 h at 37°C using Moloney murine leukemia virus reverse transcriptase (Promega UK, Southampton, UK) and 1 μg total RNA in 50 μl volume.
Real-time quantitative PCR
Real-time quantitative PCR was performed using the SYBRGreen JumpStart
Taq Ready Mix detection kit (Sigma-Aldrich, Gillingham, Dorset, UK). In all assays, cDNA was amplified using a standardized program (2 min JumpStart
Taq Polymerase activation step at 94°C; 40 cycles of 30 s at 94°C and 1 min at 60°C). All assays were performed in a volume of 20 μl, and primers were used at a final concentration of 0.33 μM. Reactions were conducted using the PCR ABI 7500 apparatus (Applied Biosystems, Warrington, UK). For a more accurate and reliable normalization of the results, the intensity of gene expression was normalized to the geometrical mean of the levels of transcripts encoding the 3 most stable housekeeping genes: ubiquitin-C (
UBC), succinate dehydrogenase (
SDHA), and ribosomal protein 13a (
RPL13a) [
33]. Normalization and calculation were assessed using the GeNorm method [
33]. Primers were designed using Primer Express 2 Software (Applied Biosystems, Warrington, UK) and were synthesized by Invitrogen Life Technologies Ltd. (Paisley, UK). Primer sequences and basal gene expression in unstimulated NHLF are described in Table
1.
Table 1
Real-time primer sequences and basal levels of transcript expression in normal human lung fibroblasts
NM_001105 | ALK-2 | CGGGAGATGACCTGTAAGACCCCG | GGGCCGTGATGTTCCTGTTAC | 25.00 ± 0.70 |
NM_004329 | ALK-3 | CAGAAACCTATTTGTTCATCATTTCTCG | ATCCCAGTGCCATGAAGCATAC | 21.97 ± 0.82 |
NM_001203 | ALK-6 | CGAATGGGGTGTAGGTCTTTATTACATTCG | CCCATTCCTCATCAAAGAAGATCA | 26.50 ± 0.93 |
NM_001204 | BMPRII | CGGTTTCCACCTCATTCATTTAACCG | ACAGAGACTGATGCCAAAGCAAT | 24.93 ± 0.42 |
NM_000088 | COL1a1 | CTTTGCATTCATCTCTCAAACTTAGTTTT | CCCCGCATGGGTCTTCA | 19.03 ± 0.69 |
NM_001845 | COL4a1 | CTAATCACAAACTGAATGACTTGACTTCA | AAATGGCCCGAATGTGCTTA | 19.87 ± 0.95 |
X02761 | Fibronectin | TGGACCAGAGATCTTGGATGTTC | CGCCTAAAACCATGTTCCTCAA | 21.70 ± 0.79 |
X56160 | Tenascin C | GGTCCACACCTGGGCATTT | TTGCTGAATCAAACAACAAAACAGA | 17.00 ± 0.92 |
NM_001613 | αSMA | CCGACCGAATGCAGAAGGA | ACAGAGTATTTGCGCTCCGAA | 20.60 ± 0.10 |
NM_021009 | UBC | CACTTGGTCCTGCGCTTGA | TTTTTTGGGAATGCAACAACTTT | 17.50 ± 1.35 |
NM_012423 | RPL13A | CCTGGAGGAGAAGAGGAAAGAGA | TTGAGGACCTCTGTGTATTTGTCAA | 19.65 ± 0.31 |
NM_004168 | SDHA | TGTGTCCATGTCATAACTGTCTTCATA | AAGAATGAAGCAAGGGACAAAGG | 19.00 ± 0.91 |
Determination of total soluble collagen, tenascin C and fibronectin in cell supernatant
The levels of total soluble collagen, tenascin C and fibronectin were assessed in supernatants from NHLF stimulated for 48 h, and 72 h with TGF-β1 and BMP-4 or BMP-7 as described. Soluble collagen was measured by Sircol assay (Biocolor Ltd., County Antrim, UK) and tenascin C and fibronectin by ELISA (Human Tenascin-C Large kit from Immuno-Biological Laboratories, Gunma, Japan and Fibronectin ELISA reagent kit from Technoclone Ltd., Surrey, UK). The threshold of detection was 2.5 μg/ml for total soluble collagen, 0.38 ng/ml for tenascin C and 250 ng/ml for fibronectin.
MMP activation and production
MMP-1 and MMP-2 activation was quantified by gelatin zymography. Proteins of cell supernatants were separated on a 10% acrylamide/0.1% gelatin gel (Invitrogen Life Technologies Ltd., Paisley, UK). After electrophoresis, the gel was washed twice for 30 min in a buffer containing 2.7% Triton X-100 at room temperature and incubated for 48 h in 50 mM Tris-base, 40 mM HCl, 200 mM NaCl, 5 mM CaCl2, 0.02% Brij 35, at 37°C. The gels were then stained with Coomassie brilliant blue and analysed. Bands were quantified by densitometry with ImageJ software. Levels of MMP-13 were quantified in supernatants from NHLF stimulated for 72 h by ELISA (Collagenase-3 ELISA Kit from Merck Chemicals Ltd. Nottingham, UK). The threshold of detection was 32 pg/ml.
αSMA immunostaining
To determine whether BMPs can counteract TGF-β1-induced myofibroblast formation, NHLF were grown on chamber slides (ICN, Basingstoke, U.K) for 3 days until ~70% confluent and cells were stimulated as described above for 72 h, washed with PBS and fixed with 4% paraformaldehyde. Following permeabilization in PBS containing 0.1% saponin, endogenous peroxidases were removed by 45 min incubation in peroxidase blocking solution (DAKO, Glostrup, Denmark) and avidin and biotin were blocked using the avidin/biotin blocking kit (Vector Laboratories Inc., Burlingame, UK). The slides were then stained with a rabbit polyclonal anti-SMA antibody (Ab) diluted in PBS containing 0.1% saponin and 10% normal human serum for 1 h at room temperature (2 μg/ml, Abcam, Cambridge, UK). After washes in PBS, slides were incubated with a biotinylated goat anti-rabbit Ab (6.5 μg/ml; Stratech Scientific Unit, Newmarket Suffolk, UK) for 45 min at room temperature. A third layer of soluble complexes of StreptABComplex/HRP (DAKO, Glostrup, Denmark) was incubated for an additional 30 min and developed with peroxidase substrate kit DAB (Vector Laboratories Inc., Burlingame, California, USA). Fibroblasts were counterstained with Harris' hematoxylin (VWR, Leicestershire, UK) and mounted in faramount aqueous mounting medium (DAKO, Glostrup, Denmark). Images were acquired using a Leica TCS SP confocal microscope (Heidelberg, Germany). Substitution of the primary Ab with an irrelevant isotype-matched Ab of the same species was used as a negative control.
Western blotting
Confluent NHLF were stimulated as before then harvested using RIPA buffer (Invitrogen) following the manufacturer's instructions. Protein concentration was determined using the BCA protein assay (Pierce), against a bovine serum albumin standard curve.
15 μg protein samples were separated on 10% Bis-Tris gels in MOPS SDS Running Buffer (Invitrogen), transferred to polyvinylidene difluoride membrane (Bio-Rad) and probed with a rabbit polyclonal anti-α-SMA Ab (1/1000 dilution; AbCam). Immunoblots were then incubated with peroxidase-conjugated goat anti-rabbit IgG (1/2000 dilution, DakoCytomation) and developed using the ECL + Western blotting detection system (Amersham). Blots were stripped and re-probed with a mouse monoclonal anti-vimentin antibody (1/2000 dilution, Sigma), to ensure equal protein loading.
The connective tissue growth factor (CTGF) promoter- (pCT-sb, 2 μg) Luciferase plasmid and Renilla luciferase control reporter vector (phRL-TK, 5 ng) were transfected into NHLF, seeded in 6-well plates, with PrimeFect I DNA Transfection Reagent (1:10 dilution, Lonza Rockland Inc, Rockland, ME, USA) diluted in serum free FGM. Transfection medium was changed after 24 h to 0.2% FBS containing 5 ng/ml TGF-β1 alone, or 100 ng/ml BMP-4 or BMP-7 alone or 5 ng/ml TGF-β1 and 100 ng/ml BMP-4 or BMP-7. After 24 h, luciferase activity was measured by the dual luciferase assay system (Promega UK, Southampton, UK) according to manufacturer's instruction using a TopCount.NXT microplate luminescence counter (PerkinElmer Life, Milano, Italy). Firefly luciferase activity was normalized by the activity of the Renilla luciferase under the control of thymidine kinase promoter of phRL-TK. Results are given as relative light units. MFB-F11 cells (mouse fibroblasts isolated from
Tgfb1
-/-
mice stably transfected with TGF-β responsive Smad-binding elements coupled to a secreted alkaline phosphatase reporter gene, SBE-SEAP plasmid [
34]) were seeded at 4 × 10
4 cells/well in 96-well plates. After 4 h in DMEM containing 10% FBS, cells were incubated with TGF-β1 and/or BMP-4 and BMP-7 as described for 24 h in 100 μl of serum free DMEM. All the conditions were tested in duplicate. SEAP activity was measured in 10 μl culture supernatant using Great EscAPe SEAP Reporter System 3 (Clontech Laboratories, Inc., California, USA) according to the manufacturer's instructions with a microplate luminescence counter.
Statistical analysis
Data were analyzed using Prism 4.0 for Windows (GraphPad Software Inc.) using Friedman test and Wilcoxon post test. The results are expressed as means ± SEM for the indicated number of experiments. The Spearman rank-order method was assessed to determine correlations between the different molecules studied.
Discussion
In the current study, we determined the ability of two Bone Morphogenetic Proteins, BMP-4 and BMP-7, to modulate the profibrotic effects of TGF-β1 on NHLF. We found that BMP-4 and BMP-7 are able to regulate the synthesis and production of ECM proteins, MMPs and α-SMA in primary lung fibroblasts. BMP-4 inhibits TGF-β1-induced cell proliferation and ECM protein release. Both BMP-4 and BMP-7 decreased MMP-13 release in TGF-β1-stimulated cells. In contrast, only BMP-7 inhibited myofibroblast differentiation and activation of MMP-2 induced by TGF-β1. We have also shown that TGF-β1 can act directly on the BMP pathways by increasing expression of the mRNA encoding ALK-6 and BMPRII.
The ECM is known to be involved in a variety of cellular processes, including morphogenesis, lung remodelling, and modifications in cell shape that occur during differentiation of a number of lung structural cells [
5,
36]. As a result, changes in the composition of the ECM can profoundly affect the behaviour of cells and lead to airway remodelling in lung fibrotic diseases, including asthma. The increase in ECM deposition results from either increased production or decreased breakdown of matrix products. Deregulation of the proteolytic-antiproteolytic network and inappropriate secretion of various MMPs by stimulated lung structural cells is thought to be involved in the pathophysiology of asthma [
37]. The contribution of TGF-β1 to ECM accumulation, and to fibroblast differentiation and proliferation has been widely reported [
5,
35,
38,
39]. Its action is mainly driven by activation of CTGF, resulting in stimulation of fibroblast proliferation, myofibroblast differentiation and collagen synthesis [
40,
41]. In this study, we confirmed the ability of TGF-β1 to induce production of the ECM proteins collagen types I and IV, fibronectin and tenascin C, and to induce myofibroblastic differentiation. However, we did not observe TGF-β1-induced fibroblast proliferation as previously reported by some groups [
9,
42,
43] but those data might be considered controversial since the effect of TGF-β1 on fibroblast proliferation is dependent on its concentration [
44]. The increased expression of αSMA correlates with the release of collagen and activation of MMP-1, the major enzyme involved in degradation of native collagen, which is in accordance with the data showing that myofibroblasts are the major source of collagen type I in the lung [
45]. Finally we confirmed the ability of TGF-β1 to activate both the CTGF promoter and Smad-binding elements (SBE) contained in the promoter region of more than 500 target genes responding to TGF-β1 [
34].
In most models and cell types, BMP-7 opposes TGF-β1-mediated ECM protein production
in vivo and
in vitro [
19‐
26]. BMP-7 regulates the ECM breakdown in human chondrocytes by downregulating MMP-13 [
46]. Nevertheless, two recent studies have shown that BMP-7 fails to inhibit TGF-β mediated fibrosis in the lung, skin and renal tubular epithelial cells [
27,
28]. In our model, BMP-7 did not counteract the increase in ECM proteins induced by TGF-β1. However, we have shown for the first time in lung fibroblasts that BMP-7 reduces not only the basal fibroblast-related expression of MMP-13 but also the induced expression of this protein following stimulation by TGF-β1. MMP-13, an interstitial collagenase, is the principal enzyme involved in the initiation of collagen breakdown. MMP-2 can serve as an activator of other MMPs, namely MMP-13 [
47]. Thus, the downregulation of TGF-β1-induced MMP-2 activity by BMP-7 is in accordance with the inhibition shown for MMP-13. BMP-7 could contribute to a reduction in airway remodelling by inhibiting some MMPs without affecting ECM protein release. BMP-7 was also able to counteract TGF-β1-induced fibroblast differentiation. This potential regulatory function of BMP-7 confirms its ability to contribute to resolution of lung remodelling since increased numbers of myofibroblasts and fibroblast differentiation are major features of airway remodelling.
The role of BMP-4 in degradation and remodelling of the ECM remains unclear, particularly in the lung. In fact, little is known about the properties of BMP-4 either
in vivo or
in vitro in the lung or other tissues. A regulatory effect of BMP-4 on MMP-13 release in human adipocytes has been reported [
48] as well as an inhibition of cell proliferation and an upregulation of αSMA expression in foetal lung fibroblasts [
30], but nothing is known of its effects on adult lung fibroblasts. Here, we demonstrate for the first time that BMP-4 is able to counteract the increase in ECM protein release induced by TGF-β1 in NHLF. We also reported that BMP-4 not only reduces the basal fibroblast-related expression of MMP-13 but also its expression induced by TGF-β1. The contribution of BMP-4 to the reduction of airway remodelling could result from a direct modulation of the production of ECM proteins as well as MMP-13. In our study, BMP-4 had no direct effect on fibroblast proliferation. This is in contrast to the study of Jeffery
et al. which reported inhibition of fibroblast proliferation but their study was performed on foetal fibroblasts which possess a higher intrinsic capacity for self-renewal than adult cells. The differential response of NHLF to BMP-4 and BMP-7 may also be a function of the signalling pathways utilized or, alternatively, the regulation of different transcriptional repressors or activators. It is likely that BMP-4 and BMP-7 act via different pathways to regulate ECM accumulation. BMP-7 selectively binds to receptors distinct from those of BMP-4: BMP-4 binds and activates ALK-3 and ALK-6 whereas BMP-7 preferentially binds to ALK-2 and ALK-6 [
49‐
51]. Furthermore, the actions of the BMPs, at least BMP-7, may be tissue or cell type specific since the inhibitory effects of BMP-7 on remodelling are less pronounced in the lung than other tissues.
Conclusions
Evidence from animal models suggests that airway remodelling in asthma may be prevented or reversed using agents which target TGF-β [
8,
52]. Therefore, modulation of TGF-β or its activity represents a potential therapeutic target for asthma and other fibrotic diseases. We were the first to report dysregulation of BMP and BMPR expression in asthma [
31]. Others have shown an up-regulation of Gremlin, an inhibitor of BMP-4 signaling pathways, in idiopathic pulmonary fibrosis and have suggested that this increased expression of Gremlin may be a key event in the persistence of myofibroblasts in the lung interstitium [
53]. Taken together, these data lend weight to the argument that BMP-4 plays a crucial role in the regulation of lung fibroblasts in disease. Our current study has determined that BMP-7 can also exert some functional effects on TGF-β1-driven profibrotic processes in normal lung fibroblasts. These BMPs appear to be attractive targets for therapeutic intervention in asthmatic disease although the blockade of TGF-β1 by only one of these molecules may not be sufficient to totally inhibit activity. A better understanding of how BMPs act
in vitro on lung structural cells and
in vivo in animal models of asthma could potentially lead to the amelioration of airway remodelling and consequently a decrease of asthma symptoms.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
SP carried out the majority of experimental work and drafted the manuscript. GAC carried out the western blotting. ABK participated in the design and coordination of the study. CML conceived of the study, participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.