Background
BRAT1 (BRCA1-associated ATM activator-1) was isolated as BRCA1 binding protein, interacting with the BRCT domain of BRCA1 [
1]. Biochemical analysis indicated that pathogenic forms of the BRCT domain of BRCA1 protein (e.g. M1775R) do not bind to BRAT1, suggesting BRCA1/BRAT1 interaction is important for BRCA1’s tumor-suppressive functions. Mechanisms of sensing and repairing DNA lesions are well conserved among the species, and ATM, ATR and DNA-PK are essential for this mechanism [
2]. Subsequent studies have shown that BRAT1 also binds to ATM and DNA-PKs, implicating the broad role of BRAT1 in DNA repair as well as in DNA damage response in general [
1,
3,
4].
Previous studies have also illustrated BRAT1 acts as a regulator of cell growth and apoptosis. When BRAT1 was knocked down in mouse embryonic fibroblasts (MEFs) and human osteosarcoma cell (U2OS), a constitutive level of apoptosis was increased [
1]. Interestingly, these studies have shown that ionizing radiation (IR) does not further induce apoptosis of these BRAT1 knockdown cells.
Recent genetic mapping and exome sequencing analysis identified that insertion mutations in the BRAT1 coding exon are pathogenic and cause lethal neonatal rigidity and multifocal seizure syndrome (RMFSL) [
5,
6]. This disease is a lethal, neonatal, neurologic disorder characterized by episodic jerking, lack of psychomotor development, axial and limb rigidity, frequent multifocal seizures, and dysautonomia. Infants show poorly responsive focal jerks of the tongue, face and arms in a nearly continuous sequence throughout life. These results indicate the clinical relevance of BRAT1 pathways.
Mitochondria are critical organelles with important roles in cellular energy metabolism, which produces ATP via tricarboxylic acid (TCA) cycle and oxidative phosphorylation (OXPHOS) [
7]. Also, mitochondria plays a key role in program cell death (apoptosis) as major site, where pro- and anti-apoptotic proteins interact and activates, so-called, mitochondria-dependent intrinsic apoptosis [
8]. Mitochondrial failure by chemical or under disease condition induces increased reactive oxygen species (ROS) generation and mitochondrial membrane potential loss, leading to sequential apoptotic pathways, such as release of cytochrome c and activation of caspases [
9]. Recent studies suggested that ROS generation and inhibition in mitochondrial functions are critical steps in chemical or knockdown-induced apoptosis of cancer cells [
10‐
12]. In contrast, since Warburg discovered metabolic alterations in cancer cells (Warburg effect, the increase in aerobic glycolysis and the dependency on glycolytic pathway for ATP generation) [
13,
14], a mitochondrial malfunction in respiration systems, due to mitochondrial DNA mutations/deletions, has been known as one of typical phenotypes in tumor tissues and cells [
15,
16].
Recently, our previous studies showed the potential roles of BRAT1 not only in DNA damage responses, but also cell growth and apoptosis [
1,
17]. In current study, we found that BRAT1 is involved in cellular growth properties including cell proliferation and tumor growth, and required for mitochondrial homeostasis, describing new roles of BRAT1 in cell growth and metabolism, and providing novel strategies for cancer treatment.
Methods
Cells and reagents
HeLa (human cervical carcinoma), U2OS (osteosarcoma), and MDA-MA-231 (human adenocarcinoma) cells were purchased from American Type Culture Collection (ATCC, Manassas, VA). All of these cells were cultured in DMEM media (Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (FBS, Invitrogen) and antibiotics. For starvation experiments, FBS were deprived for 24 h. Hydroxyurea (HU), Neocarzinostatin (NCS), and 2-Dexyl-D-glucose (2DG) were purchased from Sigma (St. Louis, MO). SC79, Akt activator was provided by Dr. Hongbo R. Luo (Harvard Medical School, Boston, MA). MitoTracker (mitochondrion-selective probe), MitoSOX (mitochondrial superoxide indicator), and CM-H2DCFDA (general oxidative stress indicator) were obtained from Invitrogen. JC-1 (mitochondrial membrane potential dye) was purchased from eBioscience (San Diego, CA).
Plasmid and BRAT1 knockdown stable cell lines
Sure Silencing shRNA plasmids for human C7orf27 were purchased from SABiosciences (Valencia, CA). To avoid nonspecific targeting and increase efficiency, 4 independent target sequences and 1 nonspecific sequences (NC) were used as follows: #1: CCAGGACCCTGAGAGTTATGT, #2: TCTCTTCCTGAGGGACAAGAT, #3: GAGTTACTACCAGGGCTCTTT, #4: GCAGTTCCTCAGAGAGCTGTT, and NC: GGAATCTCATTCGATGCATAC. U2OS, HeLa, and MDA-MA-231 cells were transfected with shRNA plasmids using Lipofectamine 2000 transfection reagent (Invitrogen) according to manufacturer’s instruction. Cells were then cultured for 2 weeks in 3 μg/ml puromycin (Calbiochem, Billerica, MA) and single cell colonies were picked for analysis for BRAT1 expression by western blot.
Immunoblotting and protein assays
Cells were treated for the indicated time, and then lysed in ice-cold lysis buffer (50 mM Tris–HCl (pH 7.6), 150 mM NaCl, 1 mM EDTA (pH 8.0), 20 mM NaF, 1 mM Na3VO4, 1% NP40, 0.5 mM dithiothreitol) in the presence of protease-inhibitor mix (leupeptin, aprotinin, and Phenylmethylsulfonyl fluoride, 10 μg/ml, respectively). After centrifugation (12000 g, 10 min), soluble supernatants were prepared and protein concentrations were calculated using the Bio-Rad protein assay kit. Total cell lysate (20 μg) was loaded and separated by 6.0% SDS polyacrylamide gels. Transfer to a PVDF membrane (Immobilon-P, Millipore) was done using semidry transfer method (Trans-Blot, Bio-Rad) in 25 mM Tris, 192 mM glycine, and 10% methanol for 1 h at 20 V. Membranes were blocked in 5% nonfat dried milk in Tris-buffered saline (TBS)/0.1% Tween 20 and incubated with primary antibodies and horseradish peroxidiseconjugated secondary antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) followed by enhanced chemiluminescence detection. Primary antibodies used in this study were anti-Akt, anti-Erk (Santa Cruz Biotechnology), anti-BRAT1 (abcam, Cambridge, MA), anti-mTOR (Cell Signalling Technology, Danvers, MA). Also specific anti- phosphorylation antibodies were used against phospho Akt (Ser473, Thr308), phosphor-mTOR (Ser2448) and phosphor-Erk (Thr202/Tyr204) (Cell Signaling). Anti-actin antibody (Santa Cruz Biotechnology) was used to validate protein amount.
Cell cycling and apoptosis analysis using flow cytometer
Both control and BRAT1 knockdown cells were exposed to vehicle (DMSO), or NCS (1 μg/ml) or HU (5 μM) for 24 h. Cell cycle arrest was assessed by ploidy analysis after DNA staining with propidium iodide using flow cytometer (FACSCalibur, BD Biosciences, Franklin Lakes, NJ) as previously described [
18]. Apoptosis was determined by annexinV/PI double staining kits (BD Biosciences) according to manufacturer’s instruction. For experiment involving glucose starvation, cells were grown in DMEM with or without glucose for indicated days, and stained with PI. 2DG-induced apoptosis was determined compared with that in PBS-treated cells after 24 h treatment. The data were analyzed with CellQuestPro software (BD Biosciences).
Wound healing and migration assay
Cells were treated with mitomycin C (30 μg/ml) for 30 min before a wound was made. The injury lines were created on 100% confluent monolayers of cells by scraping a gash using a micropipette tip. After being washing with PBS, cells were cultured in 10% complete DMEM for 46 h to be monitored wound healing. Photographs were taken at 22 h and 46 h under 40× magnifications using a SPOT Insight mosaic microscope camera (SPOT Imaging Solutions, Sterling Heights, MI) attached to Leica DM IRB microscope (Buffalo Grove, IL). For migration assay, control and BRAT1 knockdown MDA-MA-231 cells were suspended with 0.3 ml plain DMEM and then seed into 8.0 μm migration filters (BD FALCON) placed in 24-well plates. Complete DMEM medium 0.6 ml was added to the lower chamber. The plates were then incubated at 37°C for 16 h. Cells on the upper membrane surface were removed using a cotton tip, and migrated cells (on lower membrane surface) were fixed and stained by Diff-Quick stain kit (Siemens, Malvern, PA). The migration rate was determined by counting cells on lower side of membrane. Photographs were taken under 10× magnifications using Olympus DP70 digital camera (Center Valley, PA) attached to a Leica MZ 12 s microscope.
Female athymic nude mice were purchased from Jackson lab (Bar Harbor, Maine), and housed in specific pathogen-free conditions. A total 2 × 106 control and BRAT1 knockdown cells were subcutaneously injected into the flanks of nude mice. Mice were checked daily to examine tumor development, and tumor size was recorded at indicated days. Mice were euthanized and final tumors were isolated from mice, and then photographs were taken. These procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Roswell Park Cancer Institute.
Cell proliferation assays
For direct cell number detection, cell were detached at indicated day by 0.1% Trypsin/EDTA solution (Invitrogen), and washed with PBS. Cell suspensions were mixed with an equal volume of 0.4% trypan blue (VWR, Radnor, PA), and viable cells (trypan blue negative cells) were counted. In some experiments, cell proliferation/viability was measured by an MTT assay (BMR Service, Buffalo, NY) according to manufacturer’s instruction. In brief, cell medium was aspirated and then 0.3 ml MTT working solution was added into 24 well. After 30 min incubation at 37oC, MTT solution was aspirated, and cells were incubated with 0.3 ml DMSO for 2 min. The DMSO extracts were transferred to a 96-well plate and absorbance was measured with micro-plate reader at a wavelength of 540 nm.
ROS detection and measurement of mitochondrial membrane potential
For measurement of mitochondrial ROS, cells were cultured in complete DMEM containing 5 μM Mitosox for 10 min at 37°C, protected from light. Cells were washed three times with warm PBS, and then mounted with mounting medium with DAPI (Vector lab, Burlingame, CA). Fluorescent images were captured using Nikon TE2000-E inverted microscope equipped with a Roper CoolSnap HQ CCD camera (Melville, NY, USA). For detection of cellular ROS, cells were incubated with 5 μM CM-H2DCFDA for 1 h at 37°C, and then subjected to fluorescence microscopy. For quantitative assay, cells were detached by 0.1 trypsin/EDTA solution after incubation in Mitosox or CM-H2DCFDA working solution. Cell suspensions were analyzed by flow cytometry. To determine mitochondrial membrane potential, cells were stained with JC-1(2.5 μg/ml) for 10 min at room temperature and then analyzed by flow cytometry.
Determination of Pyruvate dehydrogenase (PDH) activity and measurement of mitochondrial and intracellular ATP
PDH activity of control and BRAT1 knockdown cells was analyzed by Pyruvate Dehydrogenase assay kit (BMR Service). Membrane fraction was collected from cell lysates and re-suspended for assay. PDH activity was measured as O.D at 492 nm using microplate reader. Protein assay was performed to determine sample protein concentration before analysis. To measure of mitochondrial ATP, mitochondria were isolated by mitochondria isolation kit for cultured cells (Pierce Biotechnology, Rockford, IL). Total cell lysate for intracellular ATP was prepared by adding sterile water into wells. Mitochondrial and total ATP level were detected using ATP assay kit (BMR Service) according to manufacturer’s instruction. Luminescence was measured by Veritas microplate luminometer (Promega, Madison, WI) and ATP concentration of each sample was normalized to the protein concentration.
Measurement of glucose consumption and lactate accumulation
Glucose assay kit and L-lactate assay kit (BMR service) were used to measure concentration of glucose and lactate in media from control and BRAT1 knockdown cultures. Culture media were prepared at indicated days and glucose and lactate levels were measured according to manufacturer’s instructions. Absorbance was measure at 492 nm and water (glucose) and DMSO (lactate) were used to detect base lines.
Statistical analysis
Data are expressed as mean values ± standard deviation (SD); p values were calculated with an unpaired two-tailed Student’s t-test.
Discussion
It has been implicated that BRAT1 might be a regulator for ATM and DNA-PK activation in response to DNA damage induced by ionizing radiation (IR) or chemicals [
4]. Interestingly, silencing of BRAT1 increased constitutive apoptosis and reduced cell growth. In this study, we determined a role for BRAT1 in proliferation and mitochondrial functions. After confirming suppressed BRAT1 expression, we found reduced BRAT1 expression in multiple cell lines induces growth retardation, increased apoptosis, and reduced tumor growth in vivo (Figures
1 and
2). This data suggests that BRAT1 has play a role in tumorigenesis, but further studies will be needed to identify BRAT1 role for whole tumor progress, including metastasis of specific tumor models.It was interesting that BRAT1 knockdown cells used inefficient glucose, leading to fast reduction in pH. We first found acidic extracellular pH through phenol red color (Figure S1). Although BRAT1 knockdown decreased cell proliferation, higher glycolysis and increased lactate accumulation were observed in BRAT1 knockdown culture media (Figure
3A), suggesting that glucose metabolism was modulated in correlated with reduced expression of BRAT1. To support this notion, we showed the glucose deprivation and blocking glycolysis by 2DG induce more severe apoptosis in BRAT1 knockdown cells than in control hela cell (Figure
3B and C). However, our data suggests that increased dependency on glucose is not direct reason of growth retardation and constitutive apoptosis as shown in BRAT1 knockdown cells (Figure
3D).
Several possibilities could be suggested why glucose consumption might be increased in BRAT1 knockdown cells. These mechanisms may include mitochondrial malfunction and oncogenic signaling, such Ras and Akt [
31,
36]. Mitochondrial oxidative phosphorylation and cytoplasmic glycolysis are two main metabolic pathways by which ATP is generated for energy supply [
37]. Mitochondrial malfunction has been implicated to be responsible for increased glycolysis [
16]. Impaired mitochondrial function also causes pyruvate accumulation in cancer cells [
38]. Therefore, we reasoned that high glucose consumption might be due to mitochondrial malfunction. Data in Figure
4 shows that 4 different analyses revealed aberrant mitochondrial functions and metabolic pathways. In other words, elevated level of ROS, lower mitochondrial membrane potential, impaired PDH activity, and decreased production of ATP from mitochondria in BRAT1 knockdown cells clearly describe that BRAT1 has play a critical role in mitochondrial functions.
It was reported that mitochondrial respiration defects lead to activation of Akt survival pathway through a mechanism mediated by NADH, describing how metabolic alteration in cancer cells gain a survival advantage [
15]. Also recent work suggested that mitochondrial stress leads to increased expression, activation, and nuclear localization of Akt [
36]. Because our data showed a series of mitochondrial-originated stresses, we expected that Akt pathway might be constitutively activated in BRAT1 knockdown cells. However, both basal and serum-induced activation of Akt were reduced in BRAT1 knockdown cells (Figure
5A and
5B), suggesting that knockdown-induced cellular and mitochondrial stress is not able to activate Akt. Further, Erk phosphorylation was also decreased in these cells. Akt and Ekr-mediated signaling pathways are critical steps for a wide variety of cellular processes, including cell survival, growth, proliferation, metabolism and migration [
29,
30]. Thus, we couldn’t detect any stress-induced Akt or Erk activation in BRAT1 knockdown cells, instead, results implicates that BRAT1is involved in Akt/Erk-mediated growth regulation. SC79 can enhance Akt-PDK1 interaction, leading to enforced phosphorylation at Thr308 and Ser473 of Akt [
35]. Using SC79, we confirmed Akt activation can moderately restore cell growth and ROS level (Figure
5C and
5D). Although SC79 treatment was able to induce Akt phosphorylation in knockdown cells, the level of phosphorylation was less than control, suggesting that the upstream of Akt might be impaired by suppressed expression of BRAT1. It is interesting further study to investigate whether BRAT1 is involved in PI3K/mTOR/Akt signaling pathway, leading to optimal growth and keeping metabolic homeostasis of mitochondria.
So far, BRAT1 has been the only DNA damage response protein, which regulates reaction stability of ATM/DNA-PK, leading to genomic stability after DNA damaging stress. However, this protein seems to account for proliferation and cellular metabolism in correlated with mitochondrial functions. Genetic investigation of patients with mutated BRAT1 suggests that BRAT1 plays a role on neuronal development [
5]. They found deletion mutant of BRAT1 in patient, however it remains to be clear how this mutation affect disease development.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
ES performed experiments and animal handing. TO made contributions to the conception and design of experiments. ES and TO wrote the manuscript. Both author read and approved the final manuscript.