Introduction
Negative immune regulators such as Programmed Death-1 (PD-1) and Cytotoxic T Lymphocyte Antigen 4 (CTLA-4) are part of a large network of immune checkpoints that are tightly regulated in order to limit exaggerated immune responses and prevent autoimmunity [
1]-[
4]. However, in some instances such as persistent antigenic stimulation during chronic HIV or other viral infections, these negative regulators accumulate progressively on the cell surface of total and Ag-specific T and B cells [
5]-[
9]. Expression and engagement of these negative regulators with their cognate ligands down modulate cell functions in a hierarchical manner with cell proliferation and IL-2 production being lost at earlier stages whereas IFNγ and TNFα are lost at later stages in what is referred to as immune exhaustion [
10],[
11].
PD-1, a central negative regulatory molecule was one of the early studied mediators of immune exhaustion in chronic infectious diseases, particularly HIV-1 infection [
6],[
7] and in animal viral chronic infectious models [
12]. A large body of evidence indicates that loss of function is not simply associated with PD-1 expression alone. Other characteristics such as the level of PD-1 expression and/or its co-expression with other negative modulators may better identify functionally impaired T-cells [
13],[
14]. Co-expression of CD160 with PD-1, 2B4 and KLRG1 on HCV-specific CD8
+ T-cells was associated with diminished cell functions and an intermediate differentiation stage [
15]. Similarly, co-expression of CD160 and PD-1 was also shown to define a subset of HIV-specific CD8
+ T-cells with advanced dysfunction characterized by up-regulation of different inhibitory pathways and down-regulation of the NF-
ΚB transcriptional node [
14].
CD160 is a glycosylphosphatidylinositol (GPI)-anchored protein member of the Ig superfamily with a restricted expression profile that is limited to CD56
dim CD16
+ NK cells, NKT-cells, γδ T-cells, cytotoxic CD8
+ T-cells lacking the expression of CD28, a small fraction of CD4
+ T-cells and all intraepithelial lymphocytes [
16]-[
18]. Binding of CD160 to both classical and non-classical MHC I enhances NK and CD8
+ CTL functions [
19]-[
22]. However, engagement of CD160 by the Herpes Virus Entry Mediator (HVEM) was shown to mediate inhibition of CD4
+ T-cell proliferation and TCR-mediated signaling [
23].
HVEM protein is a bimolecular switch that binds both co-stimulatory LT-α/LIGHT and co-inhibitory receptors BTLA/CD160 (Reviewed by del Rio et al., [
24]). The binding of LIGHT on T-cells to HVEM, a co-stimulatory cell surface protein expressed by immature DCs and activated T-cells, induces potent inflammatory signals and a Th1-mediated response [
25]; in turn, the binding of LIGHT to HVEM on T-cells elicits activation and survival signals through the induction of NF-
ΚB and AP1 [
26],[
27]. In contrast, binding of HVEM to BTLA expressed by T-cells engages a potent negative signaling pathway involving both SHP-1 and SHP-2 phosphatases and effectively attenuates TCR activation [
28],[
29]. During chronic HIV infection,
ex vivo blockade of the HVEM network with polyclonal antibodies to HVEM enhances HIV-specific CD8
+ T-cell functions, such as cell proliferation and cytokine production [
14]. The functional effects of HVEM binding is probably influenced by several factors in addition to the interacting partner, such as cell types, strength of stimulation and expression kinetics of the receptor/ligand pairs. Consequently, the interpretation of results based exclusively on HVEM-directed blockade may benefit from additional exploration involving the interacting ligand(s).
As CD160 expression was shown to be specifically up-regulated on CD8+ T-cells during the chronic phase of HIV infection, we aimed in the current study to assess the targeting of CD160 receptor on HIV-specific responses. We evaluated the interaction of the two CD160 isoforms CD160-GPI and CD160-TM with HVEM ligand, as well as the impact of targeting CD160, in combination with anti-PD-1, to provide a beneficial pharmacological effect on HIV-specific CD8+ T-cells in response.
Materials and methods
Cloning of human CD160-GPI and CD160-TM isoforms
The complete CD160 cDNA sequence was synthesized in vitro (DNA2.0) and codon-optimized for human expression. To generate the CD160-GPI and the CD160-TM expression plasmids, the CD160 sequence was first PCR amplified using the following oligonucleotides: GATTGCAGATCTGCCACCATGCTTCTTGAACCTGGTCGCGGTTG (sense), CTGACGCTCGAGCTACAAAGCCTGCAACGCGACCAGCGAAGTTACC (antisense, CD160-GPI), CTGACGCTCGAGCTAGTGGAACTGATTCGAGGACTCTTG (antisense, CD160-TM). The PCR fragments were then digested with Bgl II and Xho I and inserted into the Bam HI/Xho I digested pcDNA3.1/neo(+) vector (Invitrogen), downstream of the CMV promoter. Note that Bgl II and Bam HI produce compatible ends.
Production of stable cell lines
CHO-K1 (ATCC, CCL-61) stable cell lines expressing human CD160-GPI or CD160-TM were generated by lipofection of the CD160 expression vectors (pcDNA3.1) into naïve CHO-K1 cells using Lipofectamine 2000 (Invitrogen). Transfected cells were incubated at 37°C-5% CO2 in presence of 800 μg/ml Geneticin and, after a selection of 10–14 days, resistant T-cell colonies were isolated and transferred into 48-well tissue culture plate. Following incubation at 37°C-5% CO2 to allow for cell growth, cell surface expression of CD160 was evaluated with a time-resolved fluorescence assay (see below for details) using an anti-CD160 (R&D Systems, MAB6700) and an anti-mouse Eu-N1 (Perkin Elmer, AD0124). Cell clones expressing high levels of CD160-GPI or CD160-TM were expanded.
Jurkat stable cell lines expressing CD160-GPI or CD160-TM were also generated by transfecting Jurkat-NFAT-Luc cells (stably transfected with pGL4.30 NFAT-luciferase with NFAT enhancer element, Promega, and maintained with hygromycin selection) with pcDNA3.1/neo(+) vector encoding the respective CD160 isoform. The CD160-GPI form was amplified with the following PCR primers; sense: CTAGCTAGCGAGCCATGCTTCTTGAACCTGGTCGCGGTTG, anti-sense: ATAGTTTAGCGGCCGCTCACAACGCCTGCAACGCGACCAGCGAAGTTACC, and inserted into the compatible plasmid vector via the underscored Nhe I and Not I restriction sites. The CD160-TM form was PCR amplified using the CD160-GPI forward primer in combination with the following Not I-encoding anti-sense primer: ATAGTTTAGCGGCCGCTCACTAGTGGAACTGATTCG, and inserted into an Nhe I-Not I restricted pcDNA3.1 vector. Jurkat-CD160 positive clones were selected with Geneticin as described above.
Time-Resolved Fluorescence (TRF) assay
A TRF assay was used to evaluate the capacity of different antibodies to inhibit the binding of recombinant human HVEM-Fc fusion protein (R&D systems, 356-HV/CF) to cells expressing either CD160-GPI or CD160-TM. In this assay, naïve CHO-K1 cells (used for background controls) or CHO-K1 cells expressing CD160 were trypsinized and diluted in F-12 media (Invitrogen) containing 10% FBS (Hyclone). Cells (40,000 per well) were then aliquoted in poly-D-lysine treated white 384-well tissue culture plates and incubated for 20 h at 37°C-5% CO2. After incubation, supernatant was removed and cells were washed once with 100 μl of TRF wash buffer (50 mM Tris pH 7.5, 0.05% Tween, 0.2% BSA, 150 mM NaCl). Ten μl of either CD160 or HVEM antibodies diluted in NaPO4 buffer (50 mM NaPO4 pH 6.6, 150 mM NaCl, 2% FBS) were added to each well, except for the background and the no-inhibition controls which received 10 μl of NaPO4 buffer, followed by the addition of 40 μl of 1.25 μg/ml HVEM-Fc, also diluted in NaPO4 buffer. The plate was then incubated for 1 h at RT and the wells were washed 3 times with 100 μl of TRF wash buffer. Following this wash step, 50 μl of 0.25 μg/ml anti-human Eu-N1 (Perkin Elmer, 1244–330) diluted in DELFIA assay buffer (Perkin Elmer, 1244–111) was added to each well and the plate was incubated for 1 h at RT. The wells were then washed as above (3 times 100 μl TRF wash buffer) and 50 μl of DELFIA enhancement solution (Perkin Elmer, 1244–105) were added. After an incubation of 20 min at RT, the fluorescence signal was monitored using a Wallac Victor microplate reader (excitation at 340 nm and emission at 615 nm). The antibodies tested in this assay included CD160 mAb clone CL1-R2 (MBL International), CD160 mAb clone 688327 (R&D), polyclonal anti-HVEM (R&D) and monoclonal anti-HVEM clone 94801 (R&D).
RNA isolation from cells and quantification
The “RNeasy Kit” (Qiagen) was used to isolate RNA from cells. The total RNA concentration was determined using the “Quant-iT RiboGreen® RNA Assay Kit” from Invitrogen. The RNA concentration of the samples was determined from the standard curve generated using the ribosomal RNA standards.
Real-time qRT-PCR assays
The “TaqMan EZ RT-PCR kit” (Applied Biosystems; ABI) was used to perform real-time (RT)-PCR reactions on a 7500 Real Time PCR System (ABI). Quantification of cellular CD160 TM RNA from primary T-cells was performed with specific primers (forward: 5’-CCCAAGCAATGAGGGTGCTATT-3’, and reverse 5’-GGACATCCTTTCCAACCTTCTC-3’) and the 5’(FAM)-TCTGCCACCTTGGTTATTCTCCAGG-(BHQ)3’ probe (Integrated DNA Technologies; IDT). Quantification of cellular CD160-GPI RNA was performed with forward: 5’-CAACACCTTGAGTTCAGCCATA-3’; and reverse primers 5’-GACCAGCATTACCCAGACCTT-3’ and the 5’(FAM)-TGAAGGCACTCTCAGTTCAGGCTTC-(BHQ)3’ probe (IDT). The quantification of cellular CD160-GPI RNA was also performed with the “TaqMan® Gene Expression Assays” (ABI) containing gene-specific probes and primer sets. Quantification of codon-optimized CD160-GPI RNA over-expressed in Jurkat cells was performed using the following sense and anti-sense primers: 5’-GGCCATCGTGGACATTCAGT-3’; 5’-GTGCCACACCGTACAGATAAGG-3’ with a 5’(FAM)-CCGGAGGTTGCATCAACATTACAAGC-(BHQ)3’ probe. The following forward and reverse primers were used to quantify codon-optimized CD160 TM RNA: 5’-CAAGGCGGAGGAGACTGGAG-3’; 5’-GTGGAACTGATTCGAGGACTCT-3’ with the 5’(FAM)-TCACGAGGCCGGGAGAAATGTTA-(BHQ)3’ probe (IDT). The Ct values obtained for the RNA assay samples were used to interpolate an RNA copy number based on the standard curve, and the RNA copy number was normalized (by RiboGreen RNA quantification of the RNA extracted from cells and by GAPDH copy number) and expressed as quantity of copy number/μg of total RNA. The quantification of cellular GAPDH RNA transcripts was performed with the following forward and reverse primers (5’-CCTGCACCACCAACTGCTTAG-3’;, 5’-TGAGTCCTTCCACGATACCAA-3’, respectively) and the 5’(FAM)-CCCTGGCCAAGGTCATCCATG A-(BHQ)3’ probe (IDT). GAPDH RNA copy number was normalized by RiboGreen RNA quantification of the RNA extracted from cells. Serial dilutions of cellular or codon-optimized CD160-TM RNA were used to generate a standard for gene-specific expression analysis and to determine changes in transcript levels.
Antibodies
FACS analyses used anti-CD3 (V-500), anti-CD4 (BV-605), anti-CD8 (APC-H7), anti-CD25 (A700), anti-CD134 (FITC), anti-PD-1 (eFlour 605), anti-CD45RA (ECD) anti-CCR7 (PE-Cy7), anti-CD27 (eFluor 780) and anti-CD160 clone BY55 (A647) from BD. Blocking assays used mouse monoclonal anti-CD160 clone CL1-R2 (custom purified from MBL International), mouse monoclonal anti-CD160 clone 688327, mouse monoclonal anti-HVEM clone 94801 and goat polyclonal anti-HVEM (R&D systems). PD-1 monoclonal antibody clone 5C4 (human IgG4 background) was obtained from sequence ID in patent application US20090217401; binding specificity for PD-1 and functional capacity of this antibody was characterized and confirmed (data not shown).
Subjects
HIV-negative and HIV-1-infected subjects provided written informed consent and studies were approved by the Royal Victoria Hospital (Montreal, QC, Canada) and Boehringer-Ingelheim Institutional Review Boards. The study population of HIV subjects is shown in Table
1.
Table 1
Study population and clinical characteristic of each individual HIV infected subject
A-KBC-1035/M | Chronic infection (No ART)* | 02:02 | 29:02 | 15:03 | 58:02 | 02:10 | 06:02 | 2003 | 3.9 | 306 | 540 |
B-RPJ-1038/M | Chronic infection (No ART) | 03:01 | 68:01 | 27:05 | 38:01 | 01:02 | 12:03 | 2003 | 2.25 | 289 | 961 |
C-NF-1042/M | Therapy failing | 03:01 | 03:01 | 40:01 | 40:02 | 02:02 | 03:04 | 2002 | 4.97 | 393 | 697 |
D-ST-1041/M | Successfully Treated | 68:01 | 68:01 | 53:01 | 58:02 | 04:01 | 06:02 | 2000 | <1.7 | 597 | 1377 |
Primary cell preparation
PBMCs from subjects were obtained by leukapheresis and isolated by density gradient centrifugation (Lymphocyte Separation Medium; Wisent, St-Bruno, QC) and cryopreserved in 10% dimethyl sulfoxide (Hybri-Max DMSO; Sigma-Aldrich, St Louis, MO); 90% Heat-Inactivated Fetal Bovine Serum (HI-FBS) (PAA Laboratories, Etobicoke, ON).
HLA typing
DNA for molecular HLA-typing was prepared from whole blood using the QIAamp DNA blood kit (Qiagen Inc., Mississauga, ON, Canada). Subjects were typed for HLA class I antigen expression (A, B, and C alleles) by sequence-based typing using kits from Atria Genetics (South San Francisco, CA). Assign software was used to interpret sequence information for allele typing (Conexio Genetics, Perth, Australia).
Stimulation of primary CD4+ and Jurkat cells
Primary CD4+ T-cells were isolated from total PBMCs by magnetic bead separation using EasySep CD4 negative selection kit (StemCell). Purity of isolated CD4+ cells was consistently > 98%. Primary CD4+ cells were stimulated with plate-bound anti-CD3 clone UCHT1 (BD) at 1 μg/ml and anti-CD28 clone CD28.2 (BD) at 0.5’μg/ml and either human HVEM-mouse Fc fusion (R&D Systems) at a concentration of 0.2 μg/ml or its matched mouse isotype control antibody. Jurkat T-cells were activated with Dynal beads (according to the supplier’s protocol, Pan Mouse IgG, Invitrogen) coated with anti-CD3 clone UCHT1 and anti-CD28 clone CD28.2 and either anti-CD160 monoclonal antibody clone CL1-R2 (MBL International), human HVEM-mouse Fc fusion, or their matched isotype control mouse IgGs. Stimulation was performed at a ratio of 4 beads/cell.
Tetanus toxoid stimulation assay
Total PBMCs from healthy donors were thawed in RPMI-1640 medium containing 10% heat-inactivated human serum (GemCell). Cells were washed twice with medium and suspended at a final concentration of 1.5 × 106 cells/ml. Tetanus toxoid (List Biological Laboratories) was added at a concentration of 2.5’μg/ml. Blocking monoclonal antibodies against CD160, custom-purified clone CL1-R2 (MBL International) and polyclonal HVEM antibodies (R&D) or their matched isotype controls were used at 10 μg/ml. Cells were incubated for 5 to 7 days and then IFNγ was measured in the supernatant by ELISA using OptEIA Kit (BD) according to the supplier’s protocol.
Design of peptide-pool matrices and IFNγ ELISPOT assay
The HIV peptide sets used for the CFSE and IFNγ ELISPOT assays were 15 amino acids (aa) with 11 aa overlaps. The peptides were obtained from the NIH AIDS Research and Reference Reagent Program (NARRRP, Rockville, MD). Lyophilized peptides (n = 769) spanning all HIV-1 gene products were dissolved at a concentration of 10 mg/mL in DMSO and stored at −80°C. These included 123 Gag, 249 Pol, 49 Nef, 27 Rev, 23 Tat, 46 Vif, 22 Vpr, 19 Vpu and 211 Env 15-mers corresponding to consensus clade B sequence. Pools containing 1 to 16 peptides were prepared and organized into matrices of Gag, Pol, Nef, Env and accessory (Acc) gene peptide-pools such that each peptide was present in two pools within each matrix. IFNγ secretion by HIV-specific cells was quantified using the standard ELISPOT assay. Spots were counted with the CTL ImmunoSpot 6 Analyzer (Immunospot, Cleveland, OH) and results were expressed as spot forming cells per million PBMCs (SFCs/106 PBMCs) following subtraction of negative controls. The threshold for IFNγ ELISPOT positivity was set to a minimum of 50 SFC/106 PBMCs following background subtraction with a minimum of 10 spots and at least two fold over background values.
carboxyfluorescein diacetate succinimidyl ester (CFSE) dilution assay
Thawed PBMC were resuspended in PBS 1X and labeled with 0.6 μM CFSE (Molecular Probes, Eugene, Oregon). CFSE labeled PBMCs were stimulated with 2 μg/ml of HIV consensus B peptides identified in the ELISPOT assay; Gag7876 (EKIRLRPGGKKKYKL) for subjects NF-1042 and KBC-1035, Gag937 (IYKRWIILGLNKIVR) for subject RJP-1038 and Pol5683 (TAVQMAVFIHNFKRK) for subject ST-1041, in RPMI-1640 containing 10% human AB serum (Gemini, Burlington, ON). Stimulation with media alone served as a negative control, whereas stimulation with 25’ng/ml of Staphylococcol enterotoxin B (SEB) (Sigma-Aldrich) and 2 μg/ml of CEFT (CMV, EBV, Influenza and Tetanus peptides) were used as positive control stimulations. Monoclonal antibodies directed against immune checkpoint molecules (PD-1, CD160 or HVEM) along with their corresponding isotype controls were added to the culture conditions at 5’μg/ml. All stimulatory conditions were tested in quadruplicates. Following six days of incubation at 37°C and 5% CO2, cells were monitored for viability with the Trypan blue exclusion test and further stained for cell surface markers using Live/Dead (Molecular Probes), αCD3, αCD8 (ebioscience), and αCD4 mAbs (BD Biosciences, Mississauga, ON). PBMCs were acquired using a BD LSRII flow cytometer and analyzed with FlowJo software version 9.4.11 (FlowJo LLC, Ashland, Oregon).
Statistical analysis
Statistical analysis and graphical presentation was performed using GraphPad Prism 4 (GraphPad software, San Diego, CA), FlowJo 9.1 (Treestar) and FACSDiva V6 (BD Biosciences). Two-tailed paired t test was used to assess differences in the relative frequency of CD4+CD160+ T-cells before and after TCR stimulation from the same donors and in the IL-2 production following triggering with HVEM-Fc. The non-parametric Kruskal-Wallis and Dunn’s tests were used to analyze data on the enhancement of T cell activation as shown in Figure legends.
Discussion
CD160 belongs to the broad family of T-cell co-regulators. In our efforts to generate a screening assay for selecting antibody candidates with the capacity to block HVEM binding to CD160 and to functionally impact T-cell activation, we over-expressed the two known isoforms of CD160 (GPI and TM) in Jurkat cells harboring a luciferase reporter gene. HVEM ligand enhanced TCR-mediated activation only in cells expressing the CD160-GPI isoform and not the CD160-TM isoform. The lack of HVEM-mediated activation of CD160-TM may, in part, be due to the weak interaction between these proteins as suggested by our binding assays. However, as we could not confirm equal surface expression of CD160-TM, compared to CD160-GPI, due to the lack of CD160-TM specific antibodies, we cannot exclude the possibility that the low binding of HVEM-Fc to the CD160-TM expressing cells is due, at least in part, to a lower CD160-TM expression at the cell surface. Yet, similar levels of transcription were observed for both CD160-GPI and CD160-TM isoforms in the CHO-K1 cells, used for the binding assays, and in Jurkat cells, used for the functional assays. Furthermore, monoclonal and polyclonal antibodies to HVEM enhanced the binding of HVEM-Fc to the CD160-TM in the CHO-K1 cells, which suggests that CD160-TM was expressed to significant levels at the cell surface. Similar to antibody-mediated enhancement of HVEM-Fc binding to CD160, earlier observations were also reported for the binding of CD160 to MHC class I molecules [
19]. The anti-MHC I monomorphic antibody W6/32 mAb enhanced interaction between cells expressing CD160 and cells expressing the class I molecules suggesting that ligand multimerization may promote binding to CD160-TM (20). However, multimerization of HVEM may not be the only possible mechanism to induce HVEM binding to CD160-TM as potential antibody-mediated changes in the HVEM protein conformation may also play a role The distinction between CD160-GPI and CD160-TM with regard to the need for HVEM multimerization or antibody-mediated conformational change might explain the lack of HVEM-mediated effect on Jurkat-CD160-TM with bead-bound monomeric HVEM-Fc fusion. How the MHC I or HVEM ligands localize/multimerize or change their conformational structure under physiological conditions in order to promote binding to CD160, requires further investigations. HVEM is expressed as a monomer and upon binding to the homotrimeric LIGHT forms a trimeric multimer [
36],[
37]. Gonzalez
et al.[
37] suggest that BTLA is likely to bind to HVEM in the presence of LIGHT or LTα, whereby these latter receptors favor the formation of a trimeric HVEM. The regulation of HVEM association with CD160-TM through multimerization or conformational change and its impact on T-cell activation remains to be elucidated.
Triggering of CD160-GPI isoform over-expressed by the CD4
+ Jurkat T-cell line with monoclonal antibodies in our study was consistent with a positive co-stimulatory role. Similarly, CD160 stimulation was previously shown to enhance CD3-induced activation and proliferation of peripheral blood CD160
+ T cells [
33] and also CD4
+CD160
+ T cells isolated from inflammatory skin lesions [
32]. Though these results are in accordance with earlier reports that used the anti-CD160 CL1-R2 (IgG1) or the BY55 (IgM) [
33] clones, they contrast with recent work by Cai
et al., [
23] showing that triggering of CD160 on primary CD4
+ T-cells with the CD160 monoclonal antibody 5D.10A11 inhibits cell activation and cytokine production. These apparently discordant observations suggest that CD160 may differentially regulate either activating or inhibitory signaling pathways, which may depend on the type/clone of antibody or cognate ligand used to engage the target. Furthermore, the existence of two isoforms of CD160 (GPI and TM) in CD4
+ and CD8
+ T-cells with a possible differential expression and regulation of ligand binding may also account for the divergent reports on CD160 functions as the selectivity of 5D.10A11 antibody [
23] for the various CD160 isoforms and the resulting effect on TCR signaling have not been characterized. Of note, in our Jurkat-NFAT-Luciferase assay with CD160-TM expressing cells, HVEM-Fc did not elicit either a negative or positive effect and may reflect a requirement for HVEM multimerization or induced conformational changes to promote CD160-TM binding.
Our study also showed that the GPI isoform was up-regulated on rested T-cells (both CD4
+ and CD8
+)
ex vivo likely due to the culture conditions. This apparent up-regulation of CD160 on resting cells and the contribution of
ex vivo culture conditions such as the use of human serum require more investigation. Yet CD160 was down-regulated by TCR activation, which indicates that expression of CD160 on primary T-cells is more complex than initially thought. CD160-GPI is likely to undergo receptor shedding upon T-cell stimulation similar to the previously described mechanism for CD160 on NK cells stimulated with IL-15 [
38]. Although CD160-GPI and CD160-TM share the same extracellular domains, the GPI isoform does not contain a transmembrane domain. The two isoforms have differential binding characteristics for CD160 antibodies [
18] and they may also differ in their signaling capacity. The presence of these two isoforms of CD160 and their potential differential expression in T-cells requires further studies, particularly in the context of immune exhaustion. Indeed, our results showed that HVEM antibodies function differently in
ex vivo T-cell assays on samples isolated from HIV-infected subjects with higher viral loads compared to aviremic subjects. These antibodies restore HIV-specific CD8
+ T-cell proliferation in lymphocytes isolated from viremic subjects, but in contrast dampen the response in CD8
+ T-cells from aviremic subjects. This difference may be related to potential differential expression of the CD160 isoforms in viremic and aviremic subjects, meanwhile assuming that CD160-TM mediates a negative regulatory role in this context. Another potential setting could also be that the anti-HVEM antibodies may enhance binding of HVEM to the negative regulator BTLA that might be differentially expressed in aviremic
versus viremic subjects. However these different regulatory mechanisms need more investigations.
Our functional analyses suggest that a pharmacologic effect in HIV viremic subjects may be elicited through the co-targeting of both CD160 (through Ab-mediated activation) and PD-1 (through Ab-mediated blockade). In one notable instance where the CD160
+PD-1
+ DP HIV-specific CD8
+ T-cell subset was significantly higher in the HLA-B*2705 chronic infected subject compared to the HIV-uninfected control, the combined targeting of CD160 and PD-1 did not enhance response to HIV antigens. However, this subject had the largest breadth and magnitude of response to HIV peptides in agreement with earlier reports associating the HLA-B*2705 allele with protection from disease progression in HIV [
39],[
40] and virus clearance in HCV [
41]. In contrast to the B*2705 subject, the successfully treated subject showed low frequencies of the CD160
+PD-1
+ DP HIV-specific CD8
+ T-cell, which is likely associated with low levels of viremia (less than 40 RNA copies/ml) and consequently reduced immune activation [
14]. Similar to the B*2705 subject, combined targeting of CD160 and PD-1 in the successfully treated subject did not enhance HIV-specific T-cell proliferation and surprisingly, HVEM antibodies decreased cell proliferation likely by enhancing binding of HVEM to CD160-TM or BTLA [
28],[
29]. This finding shows that functional T-cells may lose their capacity to proliferate and suggest that chronicity of infection and viral load levels may be used as predictive markers to identify patients who may benefit from immunotherapeutic intervention that target immune checkpoint molecules.
Conclusions
In this study we used in vitro and ex vivo cellular assays to evaluate the targeting of CD160, relative to HVEM, as a co-target with PD-1 in immunopotentiating a response to HIV infection. Antibodies against CD160 and PD-1, used in combination, significantly enhanced HIV-specific CD8+ T-cell proliferation in response to HIV antigens from viremic subjects but showed no impact on CD8+ T-cell response from aviremic subjects. Therapeutic immunopotentiation through the specific targeting of negative and positive immune regulators on T-cells represents an interesting approach to complement current treatment regimens in HIV infection. To further our understanding on the HVEM/BTLA/LIGHT/CD160 network during disease, and to identify new correlates or predictive biomarkers in patients who may benefit from the combined Ab treatment with other targets, it would be interesting to analyze the differential expression of these molecules, including the two isoforms of CD160, in a longitudinal study that spans acute, chronic and treatment phases.
Authors’ contributions
ME designed the study, performed the experiments, analyzed the data and wrote the manuscript. CP, LP, PS and EW helped with the Jurkat assays and RNA quantification. YP, helped with the CFSE assays and writing of the methods section. J-FF, ILR, RCB and MGC helped with data interpretation and study design. GK designed the study, analyzed the data, supervised the work and wrote the manuscript. All authors read and approved the final manuscript.
Competing interests
All authors were employees of Boehringer Ingelheim Canada when this work was performed.