Skip to main content
Erschienen in: Respiratory Research 1/2017

Open Access 01.12.2017 | Research

Changes in vasoactive pathways in congenital diaphragmatic hernia associated pulmonary hypertension explain unresponsiveness to pharmacotherapy

verfasst von: Daphne S. Mous, Marjon J. Buscop-van Kempen, Rene M. H. Wijnen, Dick Tibboel, Robbert J. Rottier

Erschienen in: Respiratory Research | Ausgabe 1/2017

Abstract

Background

Patients with congenital diaphragmatic hernia (CDH) have structural and functional different pulmonary vessels, leading to pulmonary hypertension. They often fail to respond to standard vasodilator therapy targeting the major vasoactive pathways, causing a high morbidity and mortality. We analyzed whether the expression of crucial members of these vasoactive pathways could explain the lack of responsiveness to therapy in CDH patients.

Methods

The expression of direct targets of current vasodilator therapy in the endothelin and prostacyclin pathway was analyzed in human lung specimens of control and CDH patients.

Results

CDH lungs showed increased expression of both ETA and ETB endothelin receptors and the rate-limiting Endothelin Converting Enzyme (ECE-1), and a decreased expression of the prostaglandin-I2 receptor (PTGIR). These data were supported by increased expression of both endothelin receptors and ECE-1, endothelial nitric oxide synthase and PTGIR in the well-established nitrofen-CDH rodent model.

Conclusions

Together, these data demonstrate aberrant expression of targeted receptors in the endothelin and prostacyclin pathway in CDH already early during development. The analysis of this unique patient material may explain why a significant number of patients do not respond to vasodilator therapy. This knowledge could have important implications for the choice of drugs and the design of future clinical trials internationally.
Abkürzungen
CDH
Congenital diaphragmatic hernia
cGMP
Cyclic guanosine monophosphate
ECE-1
Endothelin converting enzyme 1
eNOS
Endothelial nitric oxide synthase
ET
Endothelin
ET-1
Endothelin 1
ETA
Endothelin receptor A
ETB
Endothelin receptor B
IHC
Immunohistochemistry
LH
Lung hypoplasia
NO
Nitric oxide
PDE5
Phosphodiesterase 5
PGI2
Prostacyclin
PH
Pulmonary hypertension
PRKG1
Protein kinase G1
PRKG2
Protein kinase G2
PTGER1
Prostaglandin-E receptor
PTGIR
Prostaglandin-I2 receptor
PTGIS
Prostaglandin-I2 synthase
qPCR
Quantitative real-time polymerase chain reaction
TBXA2r
Thromboxane receptor
TBXAS1
Thromboxane synthase
TXA2
Thromboxane

Background

Pulmonary hypertension (PH) is the leading cause of morbidity and mortality in patients with congenital diaphragmatic hernia (CDH) [1]. The altered development of the pulmonary vasculature and the disordered pulmonary vascular remodeling [2] in combination with the imbalance of vasoactive mediators caused by endothelial dysfunction result in the arrest of pulmonary vascular growth in these patients. Current treatment of CDH patients is not evidence based [3] and is derived from studies in adults, leading mainly to off-label and unlicensed use of drugs. Current knowledge is based on compassionate use and case reports, while some patients with CDH were included in trials that were underpowered for definitive conclusions. Even international therapy guidelines are based on consensus only (level 3 evidence) [4]. In 2012, experts evaluated the current antenatal and postnatal management of CDH and emphasized the importance of optimal management of PH in these patients [5]. Worldwide, PH treatment is mainly directed against the receptors of the endothelin (ET) and prostacyclin (PGI2) pathways or the conversion of cyclic guanosine monophosphate (cGMP) in the nitric oxide (NO) pathway (Fig. 1a). In spite of these targeted treatments, it is still largely unknown how the different components of these pathways are expressed in lungs of unaffected individuals and CDH patients.
Previous studies reported increased levels of both the endothelin A (ETA) and B (ETB) receptors in human CDH as well as in the nitrofen rat model [6, 7]. Endothelin-1 (ET-1) is a potent vasoconstrictor [8] and is increased in lung tissue of patients with pulmonary hypertension. Moreover, high plasma levels of circulating ET-1 associated with the severity of PH in human CDH [9]. NO reduces the affinity of the ETA receptor for ET-1 and may therefore terminate the ET-1 mediated signaling [10]. NO is synthesized by different NO synthases (NOS): endothelial NOS (eNOS), inducible NOS (iNOS) and neuronal NOS (nNOS), which are all expressed in the lung. However, only eNOS and, to some extent, iNOS, are expressed in the pulmonary vasculature and modulate pulmonary vascular tone [11, 12]. Some human and rat CDH studies showed a decrease in eNOS [13, 14]. However, we and others showed either no differences, or even an increased expression of eNOS in both human and rat CDH [1519]. PGI2 is an important mediator of vasodilation, acting through the prostaglandin-I2 receptor (PTGIR) [20]. Several prostacyclin receptor agonists have been used in the treatment of persistent pulmonary hypertension of the newborn with variable effects [2123]. Limited data are available about the use of these drugs in patients with CDH, but the few available case reports show contrasting results [2426]. An overview of the current data for human and the rat model is provided (Tables 1 and 2).
Table 1
Overview of studies in human CDH
Our group
Others
Increased expression of ETA and ETB (protein level)
- Increased ET-1 (plasma levels and protein level) -[43]
Increased expression of ECE-1 (protein level)
- Increased ET-1 (plasma levels) [9]
- Increased expression of ETA and ETB (RNA and protein level) [6]
No differences in eNOS expression [16]
- Increased expression of eNOS in arteriolar endothelium and alveolar epithelium (protein level) [17]
- No differences in eNOS expression (protein level) [19]
- Decreased expression of eNOS (protein and RNA level) [14]
Decreased expression of Ptgir (protein level)
- No information about prostaglandin I2
Table 2
Overview of studies in experimental rat CDH
Our group
Others
Increased expression of ETA (RNA and protein level) and ETB (RNA level)
- Increased expression of ETA and ETB (RNA and protein level) [7]
Increased expression of ECE-1 (RNA level)
- Increased expression of ET-1 after 1 and 6 h of ventilation (RNA level) [18]
- Increased response of arterioles to ET-1 [44]
Increased expression of eNOS (RNA and protein level)
- Increased expression of eNOS (RNA and protein level) [15]
- Increased expression of eNOS after 1 h of ventilation (RNA level) [18]
- Decreased expression of eNOS (RNA and protein level) [13]
Increased expression of Ptgir (RNA level) and decreased expression of Tbxas1 (RNA level)
- Increased levels of prostaglandin I2 and an increased ratio of prostaglandin I2 and thromboxane (protein level) [34]
Since CDH patients respond poorly to current treatment strategies, we hypothesized that these effects might be due to an aberrant expression of important vasoactive factors. Here, we are the first to analyze the expression of the direct targets of the most commonly used vasodilator drugs, as well as some of the important members of the three major vasoactive pathways. Using unique patient lung material, we show an increased expression of both endothelin receptors and the rate-limiting endothelin converting enzyme (ECE-1), as well as a decreased expression of the prostaglandin-I2 receptor in human CDH. Moreover, we found changes in the expression of these and other important factors of the pathways in rat CDH (Fig. 1b).

Methods

Human lung samples

Human lung samples were retrieved from the archives of the Department of Pathology of the Erasmus Medical Center, Rotterdam. In our high-volume, leading center of the EURO consortium [4], approximately 15 to 20 CDH patients a year are born, which ensures a large experience in the treatment of this disease. Paraffin-embedded lung samples, lacking severe hemorrhage or necrosis, were selected of controls, of CDH patients and of patients with lung hypoplasia or pulmonary hypertension unrelated to CDH. Only lung material of patients with a severe left-sided CDH and a survival of less than 7 h were selected to prevent secondary sequelae. Patient characteristics are described in Table 3.
Table 3
Patient characteristics
Disease
GA
Sex
Age of death
Cause of death
Control
18 + 0
Male
Abortion
24 + 6
Female
Minutes
Prematurity
26 + 5
Female
1 h
Prematurity
33 + 0
Male
Minutes
Developmental delay
38 + 3
Male
Minutes
Asphyxia
38 + 5
Male
1.5 h
Anencephaly
40 + 0
Female
18 h
Asphyxia
CDH
17 + 6
Male
Abortion
21 + 4
Male
Abortion
36 + 2
Male
Some hours
Respiratory failure
36 + 2
Female
Some hours
Respiratory failure
37 + 2
Male
7 h
Respiratory failure
38 + 0
Male
2 h
Respiratory failure
40 + 0
Female
Some hours
Respiratory failure
LH
22 + 3
Male
Abortion
28 + 5
Female
15 min
Respiratory failure
41 + 0
Male
30 min
Respiratory failure
PH
34 + 3
Female
4 days
PPHN
37 + 1
Male
4 days
Respiratory failure
GA gestational age (weeks + days), CDH congenital diaphragmatic hernia, LH lung hypoplasia, PH pulmonary hypertension, PPHN persistent pulmonary hypertension of the newborn

Animal model

The well-established animal model was used, where in short pregnant Sprague-Dawley rats received either 100 mg nitrofen dissolved in 1 ml olive oil or just 1 ml olive oil by gavage on gestational age day E9.5 [27]. Nitrofen induces left-sided CDH in approximately 70% of the offspring, while all pups have pulmonary hypertension. At day E21 pups were delivered by caesarean section and euthanized by lethal injection of pentobarbital.

Immunohistochemistry staining

Immunohistochemistry (IHC) was performed on 5 μm thick paraffin sections of lungs of both rats and humans according to standard protocols, using the Envision™ detection system (Dako Cytomatic, Glostrup, Denmark) [28]. Briefly, sections were deparaffinized with xylene and rehydrated in gradual series of ethanol, after which antigen retrieval was performed by boiling samples in 10 mM Tris (pH 9.0), 1 mM EDTA. Primary and Horse Redox Peroxidase conjugated secondary antibodies were diluted in antibody dilution buffer (DAKO) with 0,5% Tween-20, and the peroxidase was detected with diamino-benzidine tetrahydrochloride (Fluka, Buchs, Switzerland). Validated primary antibodies used for IHC were Endothelin receptor A (ETA; 1:5000 (rat) 1:100 (human); Alamone, Jerusalem, Israel), Endothelin receptor B (ETB; 1:2500 (rat) 1:500 (human); Alamone), Endothelin Converting Enzyme (ECE-1; 1:500 (human); Abcam, Cambridge, MA, USA), endothelial nitric oxide synthase (eNOS; 1:400 (rat); Thermo Fisher Scientific, Waltham, MA, USA) and prostaglandin-I2 receptor (Ptgir; 1:1000 (rat) 1:500 (human); Cayman Chemical, Ann Arbor, Michigan, USA). Negative controls were performed by omitting the primary antibody.

Quantitative real-time polymerase chain reaction (qPCR)

RNA isolation of whole lungs of rat pups, cDNA synthesis and subsequent qPCR analysis was performed as previously described [28]. The gene-specific primers used are listed in Table 4. Actb was used as reference gene.
Table 4
Primer sequences
Gene
Sequence (forward 5′- 3′)
Sequence (reverse 5′- 3′)
Eta
AACCTGGCAACCATGAACTC
ATGAGGCTTTTGGACTGGTG
Etb
CAGGATTCTGAAGCTCACCCTTT
TCCAAAACCAGCAAAAAACTCA
Et-1
TGTGCTCACCAAAAAGACAAGAA
GGTACTTTGGGCTCGGAGTTC
Ece-1
GCAAGAACATAGCCAGCGAG
CTCCGAGTATCTTCATCCATCC
eNos
CATACTTGAGGATGTGGCTG
CCACGTTAATTTCCACTGCT
Sma
TGACCCAGATTATGTTTGAGAC
AGAGTCCAGCACAATACCAG
Ptgis
CATCAAACAGTTTGTGGTCCT
CAAAGCCATATCTGCTAAGGT
Ptgir
CACGAGAGGATGAAGTTTACCA
AATCCTCTGATCGTGAGAGGC
Tbxas1
AGACTCAGGTTCCACTTCAG
TCACACCTGCCTTCTATGTC
Tbxa2r
ACTGTGAGGTGGAGATGATGG
CAGGATGAAGACCAGCAAGG
Actb
AGATGACCCAGATCATGTTTGAG
GTACGACCAGAGGCATACAG

Statistical analyses

Data are presented as means (SD) for normally distributed variables. Univariate analyses were performed using independent samples t-tests for normally distributed variables. The analyses were performed using SPSS 21.0 for Windows (Armonk, NY, USA: IBM Corp.). All statistical tests were two-sided and used a significance level of 0.05.

Results

We analyzed the expression of receptors which are targeted during treatment, as well as other critical factors of the different vasoactive pathways, in order to unravel the unresponsiveness of CDH patients to current vasodilator therapies. Therefore, a unique set of lung material of CDH patients was used and the data were verified using the more dynamical nitrofen rat model.

Human

Besides the use of inhaled NO (iNO), current treatment is based on targeting the receptors in both the prostacyclin and endothelin pathway. Therefore, we analyzed the expression of the critical proteins of both pathways in human lung samples of control and CDH patients by immunohistochemistry. Human control lung samples showed little expression of the main target of the prostacyclin therapy, the important prostacyclin receptor PTGIR, in the fetal period. This sharply increased later during gestation at the preterm and term age. However this significant increase was absent in CDH (Fig. 2). The ETA receptor, which induces vasoconstriction and cell proliferation, was expressed in the small (25–50 μm) and larger (>50 μm) vessels as well as in the very small capillaries (<25 μm) in CDH. In contrast, the distribution of the ETA receptor in control lungs was limited to the small and larger vessels only (Arrowheads in Fig. 3a). The ETB receptor, involved in vasodilation through the release of NO and PGI2 (Fig. 1), was expressed both in the bronchial epithelium and in some of the larger vessels (>50 μm) in CDH (Arrowheads in Fig. 3a). However, the expression of ETB in control lungs was found only in the bronchial epithelium (Fig. 3a). Next, we analyzed the expression of ECE-1, a membrane-bound metalloprotease that converts big-endothelin into the biologically active compound ET1 and it is a rate-limiting factor in the ET pathway. Early during gestation, in the fetal period, ECE-1 is minimally expressed in the vessels of the human control lung samples, with an increase at preterm and term age. Increased expression of this enzyme at both fetal, preterm and term age was observed in CDH (Fig. 3b), indicating a potential increased bio-availability of active ET-1 already at the fetal stage of development.
To exclude that the differences in expression patterns of the crucial prostacyclin – and endothelin receptors and the rate-limiting factor ECE-1 was solely an effect of lung hypoplasia (LH) or PH, we performed immunohistochemistry on lungs of patients with LH and PH with other cause than CDH. The PTGIR receptor expression was reduced in both LH and PH (Fig. 4a). Increased expression of ETA was detected in the smallest vessels in lungs of both LH and PH (Arrowheads in Fig. 4b), whereas increased expression of ETB was only observed in both small and very small vessels of lungs of PH patients (Arrowheads in Fig. 4c). ECE-1 was not expressed differently in both LH and PH lung samples (Fig. 4d).

Rat

In order to validate these interesting human data, we evaluated the expression patterns of the proteins of these three pathways in the nitrofen rat model. This was supplemented with RNA and protein expression analysis of related factors. Real-time qPCR showed that the mRNA expression of both the Eta and Etb receptors was significantly higher in lungs of E21 pups with CDH compared to those of control pups. We also analyzed the expression of the ETA and ETB ligand, Et-1, but no significant differences were found between the groups. However, the mRNA encoding the rate-limiting factor Ece-1 was significantly increased in CDH compared to control, confirming the human data (Fig. 5a). Next, we analyzed the protein expression pattern of the ET receptors with immunohistochemistry. The ETA receptor was expressed in the small capillaries of both groups at E15 until E21 with a stronger expression level in CDH. At E21 only CDH lungs showed expression of the ETA receptor in the larger vessels (>50 μm) (Fig. 5b). The ETB receptor was expressed in the bronchial epithelium of all lungs without significant differences between control and CDH at all ages (Fig. 5c). There was a significant higher mRNA expression of eNos in CDH rats compared to control in relation to all cells as well as in relation to only the smooth muscles cells (Fig. 6a) or endothelial cells (data not shown). This increased expression was clearly detectable with immunostaining in the larger and smaller (<50 μm) vessels at E21. However, no obvious differences were noted earlier during development (E15 till E19) (Fig. 6b). Although there was no difference in expression of prostaglandin-I2 synthase (Ptgis) between control and CDH rat pups, there was a slight increase in the expression of Ptgir and the prostaglandin-E1 receptor (Ptger1) in CDH at the mRNA level in both the whole lung as well as compared to the number of smooth muscle cells. In contrast, the expression of thromboxane synthase (Tbxas1), the enzyme converting prostaglandin H2 into thromboxane A2, which is in turn critical for vasoconstriction, was clearly reduced in CDH, whereas the thromboxane receptor (Tbxa2r) did not show significant differences (Fig. 7a). However, immunostaining showed no clear differences in expression of PTGIR in the vessels between both groups (Arrowheads in Fig. 7b).

Discussion

This is the first combined study showing the aberrant expression of different important factors in the endothelin, NO and PGI2 pathways in CDH patients (Fig. 1b) and human patients with LH or PH unrelated to CDH, possibly explaining why a large number of patients do not respond to the current vasodilator therapy. We focused our research on direct targets of the most frequent used drugs to investigate the effectiveness of the current approach and combined this with the analysis of some key factors of the different pathways.
Since our unique human CDH material is scarce and a limiting factor, since only specimens of newborns who lived for a short period were analyzed to prevent secondary morphological changes, supplemental analyses were done on lung tissue of the nitrofen rat model.
In line with previous studies in both human and rat, we found a significant increased expression of the ETA and ETB receptor, important targets of vasodilator therapy, in human CDH patients and the rat model [6, 7, 29]. However, we are the first to show an increased expression of the crucial ECE-1 enzyme in both human pulmonary vessels of CDH patients and whole lung homogenates of nitrofen treated rat pups. ECE-1 converts big ET-1 into the active form of ET-1 and is the rate-limiting step in the production of ET-1 [30]. Although there was no apparent difference in total ET-1 in CDH pups, the higher expression of ECE-1 in lungs of CDH pups may lead to an increase in the active form of ET-1.
Previously, we and others showed no apparent differences in the NO pathway [16, 19]. In contrast to other studies [13, 14, 19, 29], we found an increased expression of eNOS in CDH rats in this study. This may be explained by the decreased NO availability, or by the process of eNOS uncoupling. In case of decreased bioavailability of the cofactor tetrahydrobiopterin (BH4), eNOS produces superoxide instead of NO [31]. This superoxide leads to oxidative stress, which has been observed in vessels of patients with PH [32]. The enhanced activation of the ETA receptor, as mentioned before, might lead to the increase in superoxide production through the induction of reactive oxygen species (ROS) and can thereby induce SMC proliferation and vasoconstriction. Thus, eNOS uncoupling leads to a reduction in NO bioavailability without a necessary change in the amount of eNOS [31]. Furthermore, we have shown a slight increase in expression of the cGMP-specific phosphodiesterase 5 (Pde5) in the NO pathway in nitrofen treated rat pups previously. However, no differences were found in its phosphorylation or its downstream targets, protein kinase G1 (Prkg1) and Prkg2 [27].
The increased expression of PTGIR in control lungs during gestation could result from the gradual increase of placental PGI2 toward term [33]. The decreased expression in CDH may be a sign of reduced activation of this pathway. In contrast to our human results, we found no differences in the expression of Ptgir in CDH rat pups and an increase of this receptor on mRNA level. Since PGI2 is a potent vasodilator and thromboxane A2 (TXA2) a potent vasoconstrictor, the increased expression of Ptgir and decreased expression of Tbxas1 was unexpected. However, this aberrant balance between PGI2 and TXA2 in CDH was already previously described by our group [34]. We showed an increased level of 6-keto-PGF, the stable metabolite of PGI2, and an increased ratio of 6-keto-PGF and TXA2 in both lung homogenates and broncho-alveolar lavage (BAL) fluid of nitrofen treated rat pups. The discrepancy between the increased mRNA expression of Ptgir in CDH lungs and the absence of differences at the protein level is most likely caused by the difference in sensitivity between qPCRs and IHC. Furthermore, the different results in human and rat could be explained by the fact that we only used the most severe cases of human CDH where the rat model covers all cases.
Current treatment of CDH patients with PH is not evidence based [3] and most patients respond poorly to the used medication. Inhaled NO (iNO) is most commonly used as a first line drug, but its use varies significantly among different centers internationally [35]. In contrast to the promising results of iNO in patients with persistent pulmonary hypertension of the newborn [36], studies in CDH have failed to show its efficacy [35, 37], as no trials have been performed to evaluate the potential role of iNO specifically in CDH patients. Apart from iNO therapy there are some case reports on the use of sildenafil and prostacyclins in CDH patients with variable results [25, 26, 38, 39]. However, administration of enteral sildenafil in neonates leads to highly variable plasma concentrations because of variable gut absorption and/or limited hepatic clearance [40]. The recent availability of intravenous sildenafil may change its application [41], but solid pharmacokinetic data on optimal dosage are still to be published. Treatment with endothelin receptor antagonists is even a bigger problem since these drugs are only available in oral form, while data of its use in newborns are virtually absent concerning dosage absorption and safety. The fact that the current therapy should be considered mainly as” trial and error” and is effective in the minority of patients with CDH strengthens our results that there are possibly more pathways affected. Furthermore, the severity of PH in CDH patients has been known as an important predictor of the outcome and further evaluation of current therapies has been recommended by experts in the field [5]. Future treatment should become more personalized in this group of patients using pathway directed clinical trials and risk stratification [42].
Although the nitrofen rat model is well established, there are still differences in embryonic maturation between rat and human, which may have affected the results. Furthermore, ideally, we would like to be able to directly correlate the findings of aberrant expression of the different vasoactive pathways with the individual response of patients to specific vasoactive drugs. However, given the overall limitations of these types of studies and the lack of material of patients who did respond to one of the three therapies, this remains impossible as repeated lung biopsies would be needed to accomplish this.

Conclusions

In conclusion, our study shows the aberrant expression of specific vasodilator drug targets and crucial, rate-limiting factors in human CDH and the nitrofen rat model in both the endothelin, NO and PGI2 pathway already early during development. Since PH is still a major problem and the most important cause of morbidity and mortality in CDH patients nowadays while current treatment strategies are disappointing, a good insight in these pathways is needed for specific and patient directed targeting of pharmacotherapy.

Acknowledgements

Not applicable.

Authors’contributions

Concept and design of study, D.S.M., D.T. and R.J.R. Acquisition, analysis and interpretation of data, D.S.M., M.J.B., D.T. and R.J.R. Drafting of manuscript, D.S.M., D.T. and R.J.R. Review of manuscript for important intellectual content, D.S.M., R.M.H.W., D.T. and R.J.R. Final approval of manuscript, D.S.M., M.J.B., R.M.H.W., D.T. and R.J.R. Study supervision, D.T. and R.J.R. All authors read and approved the final manuscript.

Funding

This study was supported in part by the Sophia Foundation for Medical Research grant number 678.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Human lung samples were retrieved from the archives of the Department of Pathology of the Erasmus Medical Center, Rotterdam, following approval by the Erasmus MC Medical Ethical Committee. According to Dutch law following consent to perform autopsy, no separate consent is needed from parents to perform additional staining of tissues.
All animal experiments were approved by an independent animal ethical committee and according to national guidelines.
Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Lally KP. Congenital diaphragmatic hernia - the past 25 (or so) years. J Pediatr Surg. 2016;51:695–8.CrossRefPubMed Lally KP. Congenital diaphragmatic hernia - the past 25 (or so) years. J Pediatr Surg. 2016;51:695–8.CrossRefPubMed
2.
Zurück zum Zitat Sluiter I, Reiss I, Kraemer U, Krijger R, Tibboel D, Rottier RJ. Vascular abnormalities in human newborns with pulmonary hypertension. Expert Rev Respir Med. 2011;5:245–56.CrossRefPubMed Sluiter I, Reiss I, Kraemer U, Krijger R, Tibboel D, Rottier RJ. Vascular abnormalities in human newborns with pulmonary hypertension. Expert Rev Respir Med. 2011;5:245–56.CrossRefPubMed
3.
Zurück zum Zitat Puligandla PS, Grabowski J, Austin M, Hedrick H, Renaud E, Arnold M, Williams RF, Graziano K, Dasgupta R, McKee M, et al. Management of congenital diaphragmatic hernia: a systematic review from the APSA outcomes and evidence based practice committee. J Pediatr Surg. 2015;50:1958–70.CrossRefPubMed Puligandla PS, Grabowski J, Austin M, Hedrick H, Renaud E, Arnold M, Williams RF, Graziano K, Dasgupta R, McKee M, et al. Management of congenital diaphragmatic hernia: a systematic review from the APSA outcomes and evidence based practice committee. J Pediatr Surg. 2015;50:1958–70.CrossRefPubMed
4.
Zurück zum Zitat Snoek KG, Reiss IK, Greenough A, Capolupo I, Urlesberger B, Wessel L, Storme L, Deprest J, Schaible T, van Heijst A, et al. Standardized Postnatal Management of Infants with Congenital Diaphragmatic Hernia in Europe: The CDH EURO Consortium Consensus - 2015 Update. Neonatology. 2016;110:66–74.CrossRefPubMed Snoek KG, Reiss IK, Greenough A, Capolupo I, Urlesberger B, Wessel L, Storme L, Deprest J, Schaible T, van Heijst A, et al. Standardized Postnatal Management of Infants with Congenital Diaphragmatic Hernia in Europe: The CDH EURO Consortium Consensus - 2015 Update. Neonatology. 2016;110:66–74.CrossRefPubMed
5.
Zurück zum Zitat Kotecha S, Barbato A, Bush A, Claus F, Davenport M, Delacourt C, Deprest J, Eber E, Frenckner B, Greenough A, et al. Congenital diaphragmatic hernia. Eur Respir J. 2012;39:820–9.CrossRefPubMed Kotecha S, Barbato A, Bush A, Claus F, Davenport M, Delacourt C, Deprest J, Eber E, Frenckner B, Greenough A, et al. Congenital diaphragmatic hernia. Eur Respir J. 2012;39:820–9.CrossRefPubMed
6.
Zurück zum Zitat de Lagausie P, de Buys-Roessingh A, Ferkdadji L, Saada J, Aisenfisz S, Martinez-Vinson C, Fund X, Cayuela JM, Peuchmaur M, Mercier JC, Berrebi D. Endothelin receptor expression in human lungs of newborns with congenital diaphragmatic hernia. J Pathol. 2005;205:112–8.CrossRefPubMed de Lagausie P, de Buys-Roessingh A, Ferkdadji L, Saada J, Aisenfisz S, Martinez-Vinson C, Fund X, Cayuela JM, Peuchmaur M, Mercier JC, Berrebi D. Endothelin receptor expression in human lungs of newborns with congenital diaphragmatic hernia. J Pathol. 2005;205:112–8.CrossRefPubMed
7.
Zurück zum Zitat Dingemann J, Doi T, Ruttenstock E, Puri P. Upregulation of endothelin receptors a and B in the nitrofen induced hypoplastic lung occurs early in gestation. Pediatr Surg Int. 2010;26:65–9.CrossRefPubMed Dingemann J, Doi T, Ruttenstock E, Puri P. Upregulation of endothelin receptors a and B in the nitrofen induced hypoplastic lung occurs early in gestation. Pediatr Surg Int. 2010;26:65–9.CrossRefPubMed
8.
Zurück zum Zitat Davenport AP, Hyndman KA, Dhaun N, Southan C, Kohan DE, Pollock JS, Pollock DM, Webb DJ, Maguire JJ. Endothelin. Pharmacol Rev. 2016;68:357–418.CrossRefPubMedPubMedCentral Davenport AP, Hyndman KA, Dhaun N, Southan C, Kohan DE, Pollock JS, Pollock DM, Webb DJ, Maguire JJ. Endothelin. Pharmacol Rev. 2016;68:357–418.CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Keller RL, Tacy TA, Hendricks-Munoz K, Xu J, Moon-Grady AJ, Neuhaus J, Moore P, Nobuhara KK, Hawgood S, Fineman JR. Congenital diaphragmatic hernia: endothelin-1, pulmonary hypertension, and disease severity. Am J Respir Crit Care Med. 2010;182:555–61.CrossRefPubMedPubMedCentral Keller RL, Tacy TA, Hendricks-Munoz K, Xu J, Moon-Grady AJ, Neuhaus J, Moore P, Nobuhara KK, Hawgood S, Fineman JR. Congenital diaphragmatic hernia: endothelin-1, pulmonary hypertension, and disease severity. Am J Respir Crit Care Med. 2010;182:555–61.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Michael JR, Markewitz BA. Endothelins and the lung. Am J Respir Crit Care Med. 1996;154:555–81.CrossRefPubMed Michael JR, Markewitz BA. Endothelins and the lung. Am J Respir Crit Care Med. 1996;154:555–81.CrossRefPubMed
11.
Zurück zum Zitat Fagan KA, Tyler RC, Sato K, Fouty BW, Morris KG Jr, Huang PL, McMurtry IF, Rodman DM. Relative contributions of endothelial, inducible, and neuronal NOS to tone in the murine pulmonary circulation. Am J Phys. 1999;277:L472–8. Fagan KA, Tyler RC, Sato K, Fouty BW, Morris KG Jr, Huang PL, McMurtry IF, Rodman DM. Relative contributions of endothelial, inducible, and neuronal NOS to tone in the murine pulmonary circulation. Am J Phys. 1999;277:L472–8.
12.
Zurück zum Zitat Hoehn T, Stiller B, McPhaden AR, Wadsworth RM. Nitric oxide synthases in infants and children with pulmonary hypertension and congenital heart disease. Respir Res. 2009;10:110.CrossRefPubMedPubMedCentral Hoehn T, Stiller B, McPhaden AR, Wadsworth RM. Nitric oxide synthases in infants and children with pulmonary hypertension and congenital heart disease. Respir Res. 2009;10:110.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat North AJ, Moya FR, Mysore MR, Thomas VL, Wells LB, Wu LC, Shaul PW. Pulmonary endothelial nitric oxide synthase gene expression is decreased in a rat model of congenital diaphragmatic hernia. Am J Respir Cell Mol Biol. 1995;13:676–82.CrossRefPubMed North AJ, Moya FR, Mysore MR, Thomas VL, Wells LB, Wu LC, Shaul PW. Pulmonary endothelial nitric oxide synthase gene expression is decreased in a rat model of congenital diaphragmatic hernia. Am J Respir Cell Mol Biol. 1995;13:676–82.CrossRefPubMed
14.
Zurück zum Zitat Solari V, Piotrowska AP, Puri P. Expression of heme oxygenase-1 and endothelial nitric oxide synthase in the lung of newborns with congenital diaphragmatic hernia and persistent pulmonary hypertension. J Pediatr Surg. 2003;38:808–13.CrossRefPubMed Solari V, Piotrowska AP, Puri P. Expression of heme oxygenase-1 and endothelial nitric oxide synthase in the lung of newborns with congenital diaphragmatic hernia and persistent pulmonary hypertension. J Pediatr Surg. 2003;38:808–13.CrossRefPubMed
15.
Zurück zum Zitat Hofmann A, Gosemann JH, Takahashi T, Friedmacher F, Duess JW, Puri P. Imbalance of caveolin-1 and eNOS expression in the pulmonary vasculature of experimental diaphragmatic hernia. Birth Defects Res B Dev Reprod Toxicol. 2014;101:341–6.CrossRefPubMed Hofmann A, Gosemann JH, Takahashi T, Friedmacher F, Duess JW, Puri P. Imbalance of caveolin-1 and eNOS expression in the pulmonary vasculature of experimental diaphragmatic hernia. Birth Defects Res B Dev Reprod Toxicol. 2014;101:341–6.CrossRefPubMed
16.
Zurück zum Zitat de Rooij JD, Hosgor M, Ijzendoorn Y, Rottier R, Groenman FA, Tibboel D, de Krijger RR. Expression of angiogenesis-related factors in lungs of patients with congenital diaphragmatic hernia and pulmonary hypoplasia of other causes. Pediatr Dev Pathol. 2004;7:468–77.CrossRefPubMed de Rooij JD, Hosgor M, Ijzendoorn Y, Rottier R, Groenman FA, Tibboel D, de Krijger RR. Expression of angiogenesis-related factors in lungs of patients with congenital diaphragmatic hernia and pulmonary hypoplasia of other causes. Pediatr Dev Pathol. 2004;7:468–77.CrossRefPubMed
17.
Zurück zum Zitat Sood BG, Wykes S, Landa M, De Jesus L, Rabah R. Expression of eNOS in the lungs of neonates with pulmonary hypertension. Exp Mol Pathol. 2011;90:9–12.CrossRefPubMed Sood BG, Wykes S, Landa M, De Jesus L, Rabah R. Expression of eNOS in the lungs of neonates with pulmonary hypertension. Exp Mol Pathol. 2011;90:9–12.CrossRefPubMed
18.
Zurück zum Zitat Shinkai T, Shima H, Solari V, Puri P. Expression of vasoactive mediators during mechanical ventilation in nitrofen-induced diaphragmatic hernia in rats. Pediatr Surg Int. 2005;21:143–7.CrossRefPubMed Shinkai T, Shima H, Solari V, Puri P. Expression of vasoactive mediators during mechanical ventilation in nitrofen-induced diaphragmatic hernia in rats. Pediatr Surg Int. 2005;21:143–7.CrossRefPubMed
19.
Zurück zum Zitat Shehata SM, Sharma HS, Mooi WJ, Tibboel D. Pulmonary hypertension in human newborns with congenital diaphragmatic hernia is associated with decreased vascular expression of nitric-oxide synthase. Cell Biochem Biophys. 2006;44:147–55.CrossRefPubMed Shehata SM, Sharma HS, Mooi WJ, Tibboel D. Pulmonary hypertension in human newborns with congenital diaphragmatic hernia is associated with decreased vascular expression of nitric-oxide synthase. Cell Biochem Biophys. 2006;44:147–55.CrossRefPubMed
20.
Zurück zum Zitat Gao Y, Raj JU. Regulation of the pulmonary circulation in the fetus and newborn. Physiol Rev. 2010;90:1291–335.CrossRefPubMed Gao Y, Raj JU. Regulation of the pulmonary circulation in the fetus and newborn. Physiol Rev. 2010;90:1291–335.CrossRefPubMed
21.
Zurück zum Zitat De Jaegere AP, van den Anker JN. Endotracheal instillation of prostacyclin in preterm infants with persistent pulmonary hypertension. Eur Respir J. 1998;12:932–4.CrossRefPubMed De Jaegere AP, van den Anker JN. Endotracheal instillation of prostacyclin in preterm infants with persistent pulmonary hypertension. Eur Respir J. 1998;12:932–4.CrossRefPubMed
22.
Zurück zum Zitat Kelly LK, Porta NF, Goodman DM, Carroll CL, Steinhorn RH. Inhaled prostacyclin for term infants with persistent pulmonary hypertension refractory to inhaled nitric oxide. J Pediatr. 2002;141:830–2.CrossRefPubMed Kelly LK, Porta NF, Goodman DM, Carroll CL, Steinhorn RH. Inhaled prostacyclin for term infants with persistent pulmonary hypertension refractory to inhaled nitric oxide. J Pediatr. 2002;141:830–2.CrossRefPubMed
23.
Zurück zum Zitat Sood BG, Delaney-Black V, Aranda JV, Shankaran S. Aerosolized PGE1: a selective pulmonary vasodilator in neonatal hypoxemic respiratory failure results of a phase I/II open label clinical trial. Pediatr Res. 2004;56:579–85.CrossRefPubMedPubMedCentral Sood BG, Delaney-Black V, Aranda JV, Shankaran S. Aerosolized PGE1: a selective pulmonary vasodilator in neonatal hypoxemic respiratory failure results of a phase I/II open label clinical trial. Pediatr Res. 2004;56:579–85.CrossRefPubMedPubMedCentral
24.
Zurück zum Zitat De Luca D, Zecca E, Vento G, De Carolis MP, Romagnoli C. Transient effect of epoprostenol and sildenafil combined with iNO for pulmonary hypertension in congenital diaphragmatic hernia. Paediatr Anaesth. 2006;16:597–8.CrossRefPubMed De Luca D, Zecca E, Vento G, De Carolis MP, Romagnoli C. Transient effect of epoprostenol and sildenafil combined with iNO for pulmonary hypertension in congenital diaphragmatic hernia. Paediatr Anaesth. 2006;16:597–8.CrossRefPubMed
25.
Zurück zum Zitat Olson E, Lusk LA, Fineman JR, Robertson L, Keller RL. Short-term Treprostinil use in infants with congenital diaphragmatic hernia following repair. J Pediatr. 2015;167:762–4.CrossRefPubMedPubMedCentral Olson E, Lusk LA, Fineman JR, Robertson L, Keller RL. Short-term Treprostinil use in infants with congenital diaphragmatic hernia following repair. J Pediatr. 2015;167:762–4.CrossRefPubMedPubMedCentral
26.
Zurück zum Zitat Skarda DE, Yoder BA, Anstadt EE, Lally PA, Greene T, McFadden M, Rollins MD. Epoprostenol does not affect mortality in neonates with congenital diaphragmatic hernia. Eur J Pediatr Surg. 2015;25:454–9.PubMed Skarda DE, Yoder BA, Anstadt EE, Lally PA, Greene T, McFadden M, Rollins MD. Epoprostenol does not affect mortality in neonates with congenital diaphragmatic hernia. Eur J Pediatr Surg. 2015;25:454–9.PubMed
27.
Zurück zum Zitat Mous DS, Kool HM, Buscop-van Kempen MJ, Koning AH, Dzyubachyk O, Wijnen RM, Tibboel D, Rottier RJ. Clinically relevant timing of antenatal sildenafil treatment reduces pulmonary vascular remodeling in congenital diaphragmatic hernia. Am J Physiol Lung Cell Mol Physiol. 2016;311:L734–42.CrossRefPubMed Mous DS, Kool HM, Buscop-van Kempen MJ, Koning AH, Dzyubachyk O, Wijnen RM, Tibboel D, Rottier RJ. Clinically relevant timing of antenatal sildenafil treatment reduces pulmonary vascular remodeling in congenital diaphragmatic hernia. Am J Physiol Lung Cell Mol Physiol. 2016;311:L734–42.CrossRefPubMed
28.
Zurück zum Zitat Rajatapiti P, van der Horst IW, de Rooij JD, Tran MG, Maxwell PH, Tibboel D, Rottier R, de Krijger RR. Expression of hypoxia-inducible factors in normal human lung development. Pediatr Dev Pathol. 2008;11:193–9.CrossRefPubMed Rajatapiti P, van der Horst IW, de Rooij JD, Tran MG, Maxwell PH, Tibboel D, Rottier R, de Krijger RR. Expression of hypoxia-inducible factors in normal human lung development. Pediatr Dev Pathol. 2008;11:193–9.CrossRefPubMed
29.
Zurück zum Zitat Makanga M, Maruyama H, Dewachter C, Da Costa AM, Hupkens E, de Medina G, Naeije R, Dewachter L. Prevention of pulmonary hypoplasia and pulmonary vascular remodeling by antenatal simvastatin treatment in nitrofen-induced congenital diaphragmatic hernia. Am J Physiol Lung Cell Mol Physiol. 2015;308:L672–82.CrossRefPubMedPubMedCentral Makanga M, Maruyama H, Dewachter C, Da Costa AM, Hupkens E, de Medina G, Naeije R, Dewachter L. Prevention of pulmonary hypoplasia and pulmonary vascular remodeling by antenatal simvastatin treatment in nitrofen-induced congenital diaphragmatic hernia. Am J Physiol Lung Cell Mol Physiol. 2015;308:L672–82.CrossRefPubMedPubMedCentral
30.
Zurück zum Zitat Kuruppu S, Smith AI. Endothelin converting Enzyme-1 phosphorylation and trafficking. FEBS Lett. 2012;586:2212–7.CrossRefPubMed Kuruppu S, Smith AI. Endothelin converting Enzyme-1 phosphorylation and trafficking. FEBS Lett. 2012;586:2212–7.CrossRefPubMed
31.
Zurück zum Zitat Roe ND, Ren J. Nitric oxide synthase uncoupling: a therapeutic target in cardiovascular diseases. Vasc Pharmacol. 2012;57:168–72.CrossRef Roe ND, Ren J. Nitric oxide synthase uncoupling: a therapeutic target in cardiovascular diseases. Vasc Pharmacol. 2012;57:168–72.CrossRef
32.
Zurück zum Zitat Bowers R, Cool C, Murphy RC, Tuder RM, Hopken MW, Flores SC, Voelkel NF. Oxidative stress in severe pulmonary hypertension. Am J Respir Crit Care Med. 2004;169:764–9.CrossRefPubMed Bowers R, Cool C, Murphy RC, Tuder RM, Hopken MW, Flores SC, Voelkel NF. Oxidative stress in severe pulmonary hypertension. Am J Respir Crit Care Med. 2004;169:764–9.CrossRefPubMed
33.
Zurück zum Zitat Walsh SW. Eicosanoids in preeclampsia. Prostaglandins Leukot Essent Fatty Acids. 2004;70:223–32.CrossRefPubMed Walsh SW. Eicosanoids in preeclampsia. Prostaglandins Leukot Essent Fatty Acids. 2004;70:223–32.CrossRefPubMed
34.
Zurück zum Zitat Ijsselstijn H, Zijlstra FJ, Van Dijk JP, De Jongste JC, Tibboel D. Lung eicosanoids in perinatal rats with congenital diaphragmatic hernia. Mediat Inflamm. 1997;6:39–45.CrossRef Ijsselstijn H, Zijlstra FJ, Van Dijk JP, De Jongste JC, Tibboel D. Lung eicosanoids in perinatal rats with congenital diaphragmatic hernia. Mediat Inflamm. 1997;6:39–45.CrossRef
35.
Zurück zum Zitat Putnam LR, Tsao K, Morini F, Lally PA, Miller CC, Lally KP, Harting MT. Congenital diaphragmatic hernia study G: evaluation of variability in inhaled nitric oxide use and pulmonary hypertension in patients with congenital diaphragmatic hernia. JAMA Pediatr. 2016;170(12):1188–1194.CrossRefPubMed Putnam LR, Tsao K, Morini F, Lally PA, Miller CC, Lally KP, Harting MT. Congenital diaphragmatic hernia study G: evaluation of variability in inhaled nitric oxide use and pulmonary hypertension in patients with congenital diaphragmatic hernia. JAMA Pediatr. 2016;170(12):1188–1194.CrossRefPubMed
36.
Zurück zum Zitat Roberts JD Jr, Fineman JR, Morin FC 3rd, Shaul PW, Rimar S, Schreiber MD, Polin RA, Zwass MS, Zayek MM, Gross I, et al. Inhaled nitric oxide and persistent pulmonary hypertension of the newborn. The inhaled nitric oxide study group. N Engl J Med. 1997;336:605–10.CrossRefPubMed Roberts JD Jr, Fineman JR, Morin FC 3rd, Shaul PW, Rimar S, Schreiber MD, Polin RA, Zwass MS, Zayek MM, Gross I, et al. Inhaled nitric oxide and persistent pulmonary hypertension of the newborn. The inhaled nitric oxide study group. N Engl J Med. 1997;336:605–10.CrossRefPubMed
37.
Zurück zum Zitat Inhaled nitric oxide and hypoxic respiratory failure in infants with congenital diaphragmatic hernia. The Neonatal Inhaled Nitric Oxide Study Group (NINOS). Pediatrics. 1997;99:838–45.CrossRef Inhaled nitric oxide and hypoxic respiratory failure in infants with congenital diaphragmatic hernia. The Neonatal Inhaled Nitric Oxide Study Group (NINOS). Pediatrics. 1997;99:838–45.CrossRef
38.
Zurück zum Zitat Bialkowski A, Moenkemeyer F, Patel N. Intravenous sildenafil in the management of pulmonary hypertension associated with congenital diaphragmatic hernia. Eur J Pediatr Surg. 2015;25:171–6.CrossRefPubMed Bialkowski A, Moenkemeyer F, Patel N. Intravenous sildenafil in the management of pulmonary hypertension associated with congenital diaphragmatic hernia. Eur J Pediatr Surg. 2015;25:171–6.CrossRefPubMed
39.
Zurück zum Zitat Noori S, Friedlich P, Wong P, Garingo A, Seri I. Cardiovascular effects of sildenafil in neonates and infants with congenital diaphragmatic hernia and pulmonary hypertension. Neonatology. 2007;91:92–100.CrossRefPubMed Noori S, Friedlich P, Wong P, Garingo A, Seri I. Cardiovascular effects of sildenafil in neonates and infants with congenital diaphragmatic hernia and pulmonary hypertension. Neonatology. 2007;91:92–100.CrossRefPubMed
40.
Zurück zum Zitat Ahsman MJ, Witjes BC, Wildschut ED, Sluiter I, Vulto AG, Tibboel D, Mathot RA. Sildenafil exposure in neonates with pulmonary hypertension after administration via a nasogastric tube. Arch Dis Child Fetal Neonatal Ed. 2010;95:F109–14.CrossRefPubMed Ahsman MJ, Witjes BC, Wildschut ED, Sluiter I, Vulto AG, Tibboel D, Mathot RA. Sildenafil exposure in neonates with pulmonary hypertension after administration via a nasogastric tube. Arch Dis Child Fetal Neonatal Ed. 2010;95:F109–14.CrossRefPubMed
41.
Zurück zum Zitat Steinhorn RH, Kinsella JP, Pierce C, Butrous G, Dilleen M, Oakes M, Wessel DL. Intravenous sildenafil in the treatment of neonates with persistent pulmonary hypertension. J Pediatr. 2009;155:841–7. e841CrossRefPubMed Steinhorn RH, Kinsella JP, Pierce C, Butrous G, Dilleen M, Oakes M, Wessel DL. Intravenous sildenafil in the treatment of neonates with persistent pulmonary hypertension. J Pediatr. 2009;155:841–7. e841CrossRefPubMed
42.
Zurück zum Zitat Akinkuotu AC, Cruz SM, Abbas PI, Lee TC, Welty SE, Olutoye OO, Cassady CI, Mehollin-Ray AR, Ruano R, Belfort MA, Cass DL. Risk-stratification of severity for infants with CDH: prenatal versus postnatal predictors of outcome. J Pediatr Surg. 2016;51:44–8.CrossRefPubMed Akinkuotu AC, Cruz SM, Abbas PI, Lee TC, Welty SE, Olutoye OO, Cassady CI, Mehollin-Ray AR, Ruano R, Belfort MA, Cass DL. Risk-stratification of severity for infants with CDH: prenatal versus postnatal predictors of outcome. J Pediatr Surg. 2016;51:44–8.CrossRefPubMed
43.
Zurück zum Zitat Kobayashi H, Puri P. Plasma endothelin levels in congenital diaphragmatic hernia. J Pediatr Surg. 1994;29:1258–61.CrossRefPubMed Kobayashi H, Puri P. Plasma endothelin levels in congenital diaphragmatic hernia. J Pediatr Surg. 1994;29:1258–61.CrossRefPubMed
44.
Zurück zum Zitat Coppola CP, Au-Fliegner M, Gosche JR. Endothelin-1 pulmonary vasoconstriction in rats with diaphragmatic hernia. J Surg Res. 1998;76:74–8.CrossRefPubMed Coppola CP, Au-Fliegner M, Gosche JR. Endothelin-1 pulmonary vasoconstriction in rats with diaphragmatic hernia. J Surg Res. 1998;76:74–8.CrossRefPubMed
Metadaten
Titel
Changes in vasoactive pathways in congenital diaphragmatic hernia associated pulmonary hypertension explain unresponsiveness to pharmacotherapy
verfasst von
Daphne S. Mous
Marjon J. Buscop-van Kempen
Rene M. H. Wijnen
Dick Tibboel
Robbert J. Rottier
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
Respiratory Research / Ausgabe 1/2017
Elektronische ISSN: 1465-993X
DOI
https://doi.org/10.1186/s12931-017-0670-2

Weitere Artikel der Ausgabe 1/2017

Respiratory Research 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.