Background
Neuropathic pain is a rather stubborn pain induced by nerve injury. It can persist for months to years, even after the primary injury has healed [
1]. Many studies focus on the molecular mechanisms are related to neuropathic pain. However, there is no medication currently available that treat neuropathic pain in a complete and definitive way. Accumulating evidence demonstrates that neuroinflammation in the peripheral and central nervous system (e.g., dorsal root ganglion (DRG) and spinal dorsal horn (SDH)) is involved in peripheral nerve injury-induced neuropathic pain [
2‐
4]. DRG neurons are responsible for the complication of neuropathic pain as they include mechanoceptor, thermoceptor, and pruritic sensor [
2]. Peripheral nerve injury activates nociceptive pathways and alters gene expression in DRG neurons, which may contribute to the development and maintenance of neuropathic pain.
Recent studies describe immune-related proteins of DRG and SDH are key players for peripheral and central sensitization of neuropathic pain [
5‐
8]. Toll/interleukin-1 receptors (TIRs) such as TLR4 and IL-1R are found not only expressed on immune cells but also on sensory neurons in DRGs and glial cells (microglia and astrocytes) in the SDH [
9‐
14]. Targeting toll-like receptors (TLRs) such as TLR4 expressed on spinal glial cells has been reported to relieve mice neuropathic pain [
5]. Our recent studies show that suppression of myeloid differentiation factor-88 adaptor protein (MyD88)-dependent signaling alleviates neuropathic pain induced by peripheral nerve injury in the rat [
15]. The MyD88 is involved in TIRs, mediates activation of TIRs, leads to the NF-κB activation, and induces proinflammatory mediators [
9,
16]. TIRs and its signaling pathway play important roles in the pathogenesis of neuropathic pain. The activation of TIRs also needs to recruit interleukin-1 receptor-associated kinase 1 (IRAK1) and tumor necrosis factor receptor-associated factor 6 (TRAF6) to activate NF-κB signaling pathway [
16].
Recent studies found the activation of NF-κB, and binding the promoters NF-κB-sensitive genes induce transcription of hundreds genes including NF-κB-dependent miRNAs such as miRNA146a-5p [
17,
18]. miRNA is a family of small endogenous non-coding RNA molecules that silence target mRNAs by binding to their 3′UTRs. The miRNAs of the DRG participate in nociceptive modulation in the somatosensory pain [
19]. miRNAs affect neuropathic pain by regulating key proteins in the pain progress, resulting in hyperalgesia and allodynia [
20]. Mounting evidence suggests that miRNA-146a-5p is involved in the innate immune response and can reduce inflammation by targeting both TRAF6 and IRAK1 in monocytes, macrophages, and astrocytes [
21‐
24]. Previous research demonstrated that spinal miRNA-146a could contribute to osteoarthritic pain of knee joints [
25]. Also, Lu et al. found that miRNA-146a of astrocytes could attenuate SNL-induced neuropathic pain by suppressing TRAF6 signaling in the spinal cord [
26]. However, the role of miRNA-146a-5p in DRG and SDH of nerve injury-induced neuropathic pain has not been fully investigated. How miRNA-146a-5p modulates the downstream target gene of DRG neurons in chronic constriction injury (CCI) is still unknown. TRAF6 and IRAK1 of TIR signaling may play an important role for neuroinflammation in DRG neurons of CCI model.
In the current study, we evaluated the expression of miRNA-146a-5p and its target genes, namely, IRAK1 and TRAF6, in the DRG of rats with CCI. We also intrathecally administered miRNA-146a-5p agonist (miRNA-146a-5p agomir) or antagonist (miRNA-146a-5p antagomir) to investigate the function of miRNA-146a-5p in modulating neuropathic pain. Our data demonstrated that miRNA-146a-5p can alleviate CCI-induced mechanical and thermal hyperalgesia through inhibition of IRAK1 and TRAF6 and may be the target for protection against chronic pain.
Methods
Animals
Male Sprague-Dawley (SD) rats weighing 200–250 g were acquired from Laboratory Animal Center of Peking Union Medical College Hospital, Chinese Academy of Medical Sciences. Animals were randomly assigned to treatment or control groups. These rats were bred in a specific pathogen-free environment in 12-h light-dark cycle. The rats were fed with rodent diet and water. These experiments were approved by the Institutional Animal Care and Use Committee in Chinese Academy of Medical Sciences.
Rat model of neuropathic pain
In accordance with the study of Bennett and Xie YK [
27], we performed CCI on rats anesthetized through intraperitoneal injection of sodium pentobarbital (40 mg/kg) under aseptic condition. After the sciatic nerve of the mid-thigh level on each side was exposed, four snug ligatures of chromic gut suture were loosely tied around the nerve with about 1-mm space between the knots. The sciatic nerves of sham animals were exposed without ligation.
Behavioral test
Eight rats were included in each group. Paw withdrawal threshold (PWT) in response to mechanical stimuli was used to access mechanical allodynia by using Von Frey filaments 1 day before operation and 1, 3, 5, 7, 14, and 21 days after the operation. Paw withdrawal latency (PWL) in response to radiant heat was used to evaluate thermal hyperalgesia. Three repeat measures were performed in each rat with a 5-min interval. This test was performed at 10 a.m. on day 1 preoperation and days 1, 3, 5, 7, 14, and 21 postoperation. At the end of behavior testing, the L4-L6 DRGs and SDH were chronologically harvested and rapidly frozen at − 80 °C.
Intrathecal catheter implantation and intrathecal injection
Eight rats were included in each group. A PE10 catheter (length, 15 cm) was intrathecally implanted using a previously described technique [
28,
29]. Briefly, rats were intraperitoneally anesthetized with 10% chloral hydrate (300 mg/kg). A partial laminectomy at L5/L6 was performed to position the intrathecal catheter, and the dural membrane was exposed. The catheter was inserted through a dural incision and passed by 2 cm into the intrathecal space. The catheter was secured with 4/0 silk threads to the bones and muscles. After implantation, all rats were allowed to recover for a minimum of 2 days prior to the experiments. Rats presenting motor weakness or signs of paresis upon recovery from anesthesia were killed. Proper location of the catheter was confirmed through hind limb paralysis after injection of 10 μL of 2% lidocaine.
Intrathecal drug was administered with a microinjection syringe connected to the intrathecal catheter. CCI rats were randomly divided for intrathecal injecting miRNA-146a-5p agomir (Ribobio, China), agomir control (Ribobio, China), miRNA-146a-5p anatagomir (Ribobio, China), or antagomir control (Ribobio, China). Each drug (5 nmol) was intrathecally administered in 20 μL volume on the surgery day and on days 4, 8, and 12 after CCI surgery.
Quantitative real-time PCR
Total RNA was isolated with TRIzol reagent (Invitrogen Life Technologies) and reverse-transcribed using a reaction mixture in accordance to the manufacturer’s instruction. RNA quality and quantity were determined with a NanoDrop spectrophotometer (ND-1000; NanoDrop Technologies), and RNA integrity was assessed through gel electrophoresis. Quantitative real-time PCR (qPCR) was performed on a StepOnePlus real-time PCR system (Applied Biosystems, ABI, CA, USA) using the SYBR Green qPCR Master Mix (ABI, CA, USA). Expression data were normalized to the expression of β-actin. The total RNA was reverse-transcribed to determine the miRNA expression, and the resulting cDNA was mixed with miRNA-specific Taqman primers (ABI, CA, USA) and Taqman Universal PCR Master Mix (ABI, CA, USA). U6 RNA was used as an endogenous control for data normalization of the miRNA level. These primers used for SYBR Green qPCR are shown in Table
1. Relative changes in expression were measured using the comparative threshold cycle (Ct) method and 2
−ΔΔCt as previously described; the results indicated the fold change of expression.
Table 1
Primer set list for qPCR
IRAKl | Forward | GCTCCCAGACCCATTCTGAG |
Reverse | CTCTGGGCTGGCTTGATGG |
TRAF6 | Forward | GCCCATGCCGTATGAAGAGA |
Reverse | ACTGAATGTGCAGGGGACTG |
β-actin | Forward | CACCCGCGAGTACAACCTTC |
Reverse | CCCATACCCACCATCACACC |
Fluorescent in situ hybridization
To examine expression of miR-146a in DRG neurons, in situ hybridization was used with locked nucleic acid probes specific for miR-146a. Rats were sacrificed under anesthesia. L4-L6 DRGs were fixed by 4% paraformaldehyde. After incubated in hybridization solution at room temperature for 2 h, the sections were incubated overnight in hybridization solution with 8 ng/μL of FAM (488) labeled probes for miR-146a-5p (5′-FAM-AACCC ATGGA ATTCA GTTCT CT-FAM-3′, Wuhan Servicebio technology) at 37 °C. The sections were washed in 2 × SSC at 37 °C for 10 min and in 0.5 × SSC at room temperature for 10 min. Slides were then coverslipped with VECTASHIELD Mounting Medium with DAPI.
Immunohistochemistry
After the rats were anesthetized with sodium pentobarbital, they were perfused transcardially with fresh 4% paraformaldehyde. L4-L6 DRGs were harvested, postfixed in 4% paraformaldehyde for 2 h, and then dehydrated in 30% sucrose overnight at 4 °C. The tissues were embedded in the optimal cutting temperature compound according to our previous studies. Frozen sections (each with 15 μm thickness) were used for immunohistochemistry analysis. The tissue sections were incubated with following primary antibodies. Then, tissue sections were incubated with the proper secondary antibodies or Alexa Fluor 594-conjugated isolectin B4 (IB4) (1:100, Invitrogen/Thermo Fisher Scientific, USA) for 1 h. Slides were then washed in PBS and coverslipped with VECTASHIELD Mounting Medium with DAPI. Table
2 lists the primary and secondary antibodies used for the immunofluorescence staining analysis.
Table 2
List of primary and secondary antibodies used for immunofluorescence staining
IRAK1 | Rabbit | Abcam | ab238 | 1:200 | Overnight 4 °C |
TRAF6 | Rabbit | Abcam | ab181622 | 1:200 | Overnight 4 °C |
pNF-kB (p65) | Rabbit | Abcam | ab86299 | 1:200 | Overnight 4 °C |
CGRP | Goat | LifeSpan BioSciences | LS-C122785 | 1:500 | Overnight 4 °C |
PGP9.5 | Guinea pig | Abcam | ab10410 | 1:100 | Overnight 4 °C |
Anti-rabbit IgG Alexa Fluor 488 | Donkey | Jackson ImmunoRresearch | 711-545-152 | 1:400 | 1 h RT |
Anti-goat IgG Alexa Fluor 594 | Donkey | Jackson ImmunoRresearch | 705-585-147 | 1:400 | 1 h RT |
Western blot
Total proteins from rat L4-L6 DRGs or SDH were extracted with lysis buffer (CWBio, Beijing, China). Briefly, 30 μg of each sample was resolved through sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred onto Immobilon-P polyvinylidene difluoride (GE). After blocking with 5% BSA for 1 h at room temperature, the membranes were incubated with an anti-IRAK1 antibody, anti-TRAF6 antibody, anti-pNF-κB (p65) antibody, and anti-β-actin antibody. The corresponding secondary antibodies were probed after washing the membranes. Final results were acquired using a western blot detection system (GE) with enhanced chemiluminescence reagents eECL Kit (CWBio, Beijing, China). Table
3 lists the primary and secondary antibodies used for the western blot analysis.
Table 3
List of primary and secondary antibodies used for western blot analysis
IRAK1 | Rabbit | Abcam | ab238 | 1:1000 | Overnight 4 °C |
TRAF6 | Rabbit | Abcam | ab181622 | 1:1000 | Overnight 4 °C |
pNF-κB (p65) | Mouse | Cell signaling technology | #13346 | 1:1000 | Overnight 4 °C |
β-actin | Mouse | ZSGB-BIO | TA-09 | 1:1000 | Overnight 4 °C |
Anti-rabbit IgG horseradish peroxidase (HRP) | Goat | ZSGB-BIO | ZDR-5306 | 1:3000 | 1 h RT |
Anti-mouse IgG horseradish peroxidase (HRP) | Goat | ZSGB-BIO | ZDR-5307 | 1:3000 | 1 h RT |
Statistical analysis
Data are expressed as mean and standard errors (mean ± SEM). Statistical analyses were performed using SPSS software (vision 17.0). Differences between two groups were analyzed using Student’s t test. One-way ANOVA followed by Bonferroni’s post hoc tests was used to determine statistical differences among western blot and qPCR. Two-way ANOVA followed by Bonferroni’s post hoc tests was used to analyze the behavioral data. P < 0.05 was considered statistically significant.
Discussion
Neuropathic pain is a common type of chronic pain that affects the life quality of patients. The exact molecular mechanism of neuropathic pain has not been fully elucidated. Several rat models with partial injury to peripheral nerves have been used to investigate the possible mechanisms. CCI is a commonly used model to mimic the pathophysiological progress of chronic neuropathic pain. In this study, the role of miRNA-146a-5p in the pathophysiological mechanism of neuropathic pain was investigated. Our research successfully established a CCI rat model and found that the mechanical PWT and thermal PWL in the CCI group were significantly lower than those in the sham group. The CCI rats showed allodynia and hyperalgesia, which are precise clinical characteristics of neuropathic pain. Our results demonstrated a significant increase in the miRNA-146a-5p level in DRG and SDH of rats suffering from neuropathic pain and a considerable increase in the expression of IRAK1 and TRAF6. Our findings are consistent with other studies that used other pain models, in which miRNA-146a-5p, TRAF6, or IRAK1 are strongly upregulated in the SDH of pain models [
26,
30,
31].
Several reports showed some miRNAs participate in the development of neuropathic pain and affect neuropathic pain by regulating protein level in the pain progress [
19,
32‐
34]. The proposed possible mechanism indicates that peripheral stimuli from inflammation or nerve injury can induce the secretion of inflammatory mediators and thus change the miRNA expression in DRG or SDH. miRNA-146a-5p, a member of the miRNA family, is involved in immune responses, cell proliferation, and inflammation [
18,
35]. miRNA-146a-5p is related to pain-related pathophysiology of osteoarthritis. The variable expression of miRNA-146a-5p in the spinal cord and DRG contributes to osteoarthritic pain in the knee joint [
25,
31].
As a critical innate immune receptor, TLRs is activated in neuropathic pain, and its deficiency protects against neuropathic pain. The activation of the TLRs signaling on cells in the peripheral or central nervous system, particularly the glia cell and DRG neuron, contributes to neuropathic pain [
5‐
8,
15,
36,
37]. Activated TLR4 initiates transmembrane signaling cascades that trigger intracellular mediators [
13‐
16]. In this pathway, the activation of IRAK1 and TRAF6 leads to the nuclear translocation of the transcription factor NF-κB, resulting in the production of proinflammatory cytokines, such as IL-6 and TNF-α. Meanwhile, the activation of NF-κB can induce miRNA-146a-5p [
17]. miRNA-146a-5p that is NF-κB-dependent microRNA plays a key role in the regulation of TIR signaling through its target molecules, namely, TRAF6 and IRAK1, which are two important protein kinase in the TIR signaling pathway [
17,
22,
24]. We demonstrated that over-expression of miRNA-146a-5p protects rats against neuropathic pain after CCI operation by negatively regulating the expression level of IRAK1 and TRAF6.
To further determine the role of miRNA-146a-5p in the CCI-induced neuropathic pain, we found CCI rats which were intrathecally injected with miRNA-146a-5p antagonist; miRNA-146a-5p antagomir suffer from aggravated neuropathic pain. Intrathecal injection with miRNA-146a-5p antagomir elevated the level of IRAK1 and TRAF6 of CCI rats. Our finding is consistent with recent studies, in which miRNA-146a-5p negatively regulates the TIR signaling pathway by targeting IRAK1 and TRAF6. Several studies suggested that miRNA-146a-5p may negatively regulate the LPS-induced TLR signaling through downregulation of IRAK1 and TRAF6 by binding to the 3′UTR of their mRNAs [
17,
38]. Previous studies also confirmed that miRNA-146a-5p-deficient mice exhibit a considerable increase in IRAK1 and TRAF6 protein level and are hypersensitive to LPS [
23,
39]. However, whether miR-146a-null mice are sensitive to neuropathic pain must be further confirmed. In our research, we demonstrated that miRNA-146a-5p antagomir increased the phosphorylation level of NF-κB (p65). That indicated downregulation of miRNA-146a-5p may result in the over-responsiveness of TIR signaling pathway. By contrast, the over-expression of miRNA-146a-5p contributed to the lower level of phosphorylation for NF-κB (p65). In this study, we did not study the expression of miRNA-146a-5p and its targets in the brain after neuropathic pain. The expression of miRNA-146a-5p on the brain can possibly regulate neuropathic pain, yet this hypothesis must be further confirmed.
Conclusions
In this study, we demonstrated that neuropathic pain was associated with miRNA-146a-5p. The therapeutic approaches using miRNA-146a-5p agomir could relieve neuropathic pain in rat models of CCI. The mechanism may involve the regulation of the TIR signaling pathway by directly suppressing its target, IRAK1 and TRAF6. The administration of miRNA-146a-5p or its inducers can be used as a promising therapy to relieve neuropathic pain.
Acknowledgements
We thank Dr. Wenyin Qiu, Xiaojin Qian, and Yongmei Chen in the Department of Anatomy, Histology and Embryology, Institute of Basic Medical Sciences Chinese Academy of Medical Sciences, for their technical assistance in immunohistochemistry.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.