Skip to main content
Erschienen in: Cancer Cell International 1/2020

Open Access 01.12.2020 | Primary research

RETRACTED ARTICLE: Circular RNA circ_0000517 regulates hepatocellular carcinoma development via miR-326/IGF1R axis

verfasst von: Shuwei He, Jianzeng Yang, Shitao Jiang, Yuan Li, Xingmin Han

Erschienen in: Cancer Cell International | Ausgabe 1/2020

Abstract

Background

Circular RNAs (circRNAs) play vital roles in hepatocellular carcinoma development. However, the role and mechanism of circRNA hsa_circ_0000517 (circ_0000517) in hepatocellular carcinoma development were largely unknown.

Methods

45 paired tumor and adjacent nontumor samples were collected from hepatocellular carcinoma patients. The levels of circ_0000517, miR-326 and insulin-like growth factor type 1 receptor (IGF1R) were detected via quantitative reverse transcription polymerase chain reaction or western blot. Cell viability, colony ability, migration, invasion and glycolysis were assessed via 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), colony formation, western blot, transwell assay, glucose consumption, lactate production or adenosine triphosphate (ATP) production. The target correlation between miR-326 and circ_0000517 or IGF1R was analyzed via dual-luciferase reporter analysis. The function of circ_0000517 in vivo was assessed via xenograft model.

Results

circ_0000517 expression was elevated in hepatocellular carcinoma tissues and cell lines. circ_0000517 knockdown suppressed cell viability, colony formation, migration, invasion and glycolysis. miR-326 was sponged via circ_0000517 and miR-326 knockdown reversed the effect of circ_0000517 silence on hepatocellular carcinoma development. miR-326 overexpression inhibited hepatocellular carcinoma development through targeting IGF1R. circ_0000517 knockdown decreased IGF1R expression by modulating miR-326. circ_0000517 downregulation reduced xenograft tumor growth.

Conclusion

circ_0000517 knockdown repressed hepatocellular carcinoma development in vitro and in vivo by modulating miR-326 and IGF1R.
Hinweise
This article has been retracted. Please see the retraction notice for more detail: https://​doi.​org/​10.​1186/​s12935-024-03341-1
A retraction note to this article is available online at https://​doi.​org/​10.​1186/​s12935-024-03341-1.

Supplementary information

Supplementary information accompanies this paper at https://​doi.​org/​10.​1186/​s12935-020-01496-1.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
IGF1R
Growth factor type 1 receptor
ATP
Adenosine triphosphate

Background

Liver cancer is one of the main causes of cancer-associated death with rising incidence and mortality [1]. Hepatocellular carcinoma accounts for majority of liver cancer [2]. Improvements have been gained in prevention and management of hepatocellular carcinoma [3]. Nevertheless, some patients have poor prognosis. To improve the treatment and prognosis of hepatocellular carcinoma, the mechanism modulating the progression of hepatocellular carcinoma is sorely wanted.
Circular RNAs (circRNAs) are a group of noncoding RNAs generated via covalently linking the 5′ cap and 3′ end [4]. Many circRNAs are ubiquitously expressed in eukaryotes [5]. Moreover, circRNAs play essential roles in development and treatment of cancers [6]. The emerging evidence demonstrates that circRNAs have pivotal roles in diagnosis and therapy of hepatocellular carcinoma [7]. A previous study analyzes the expression of many circRNAs using two hepatocellular carcinoma-associated databases (GSE97332 and GSE94508), and finds circRNA hsa_circ_0000517 (circ_0000517) is the only one circRNA up-regulated in hepatocellular carcinoma in both databases [8]. However, the exact function and mechanism of circ_0000517 in hepatocellular carcinoma development remain poorly understood.
CircRNAs could take part in the regulation of cancer development via functioning as competing endogenous RNAs (ceRNAs) for microRNAs (miRNAs) to affect the stability of targeted genes [9]. miRNAs are a group of small noncoding RNAs which are implicated in hepatocellular carcinoma development [10]. miR-326 is one of lowly expressed miRNAs and associated with patients’ outcomes in hepatocellular carcinoma [11]. Moreover, miR-326 could inhibit hepatocellular tumorigenesis [12]. However, whether miR-326 is required for circ_0000517-mediated mechanism is unclear. In addition, insulin-like growth factor system is reported to participate in liver disorders [13]. Insulin-like growth factor type 1 receptor (IGF1R) is a member of insulin-like growth factor system, which is aberrantly expressed in hepatocellular carcinoma [14]. Furthermore, accruing studies suggest IGF1R plays an oncogenic role in hepatocellular carcinoma [15, 16]. Besides, the bioinformatics analysis predicts that miR-326 might bind with circ_0000517 and IGF1R. Therefore, we hypothesized circ_0000517 could serve as a ceRNA for miR-326 to target IGF1R to be involved in hepatocellular carcinoma development.
In this research, we investigated the effect of circ_0000517 on hepatocellular carcinoma development in vitro and in vivo. Furthermore, we analyzed the ceRNA network of circ_0000517/miR-326/IGF1R.

Materials and methods

Patients and tissues

45 patients with hepatocellular carcinoma were recruited from The First Affiliated Hospital of Zhengzhou University, and they all did not receive other therapy before tissues collection. The tumor and adjacent nontumor tissues were harvested and stored at − 80 °C. This research was permitted via the Ethics Committee of The First Affiliated Hospital of Zhengzhou University, and written informed consent was obtained from all subjects.

Cell culture

Normal liver cell line THLE-2 and hepatocellular carcinoma cell lines HCCLM3 and Huh7 were provided via BeNa Culture Collection (Beijing, China) and maintained in Dulbecco’s Modified Eagle Medium (Thermo Fisher, Waltham, MA, USA) plus 10% fetal bovine serum (Gibco, Gran Island, NY, USA) and 1% antibiotic (Thermo Fisher) in 5% CO2 at 37 °C.

RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Tissues or cells were lysed using Trizol reagent (Thermo Fisher) and were used for RNA extraction. For circRNA extraction, the obtained RNA was further incubated with RNase R (GeneSeed, Guangzhou, China) following instructions of manufacturer. The RNA was reversely transcribed to cDNA with specific reverse transcription kit (Thermo Fisher). The cDNA together with SYBR Green (Solarbio, Beijing, China) and specific primers (Sangon, Shanghai, China) was used for qRT-PCR. The primers included: circ_0000517 (sense, 5′-GGGAGGTGAGTTCCCAGAG-3′; antisense, 5′-CAGGGAGAGCCCTGTTAGG-3′), IGF1R (sense, 5′-AGTATGGAGGGGCCAAGCTA-3′; antisense, 5′-CTTTTGGCCTGGACATAGAAGA-3′), miR-326 (sense, 5′-CATCTGTCTGTTGGGCTGGA-3′; antisense, 5′-AGGAAGGGCCCAGAGGCG-3′), U6 (sense, 5′-CTCGCTTCGGCAGCACA-3′; antisense, AACGCTTCACGAATTTGCGT), and GAPDH (sense, 5′-CATGAGAAGTATGACAACAGCCT-3′; antisense, 5′-AGTCCTTCCACGATACCAAAGT-3′). GAPDH or U6 was used as reference. Relative RNA level was calculated through 2−ΔΔCt method [17].

Cell transfection

IGF1R overexpression vector was generated through inserting the sequence of IGF1R into pcDNA3.1 vector. The pcDNA3.1 vector (Thermo Fisher) served as negative control (pcDNA). siRNA for circ_0000517 (si-circ_0000517#1, 5′-GGCUCCGCGCGAGGUCUGAGA-3′; si-circ_0000517#2, 5′-UCCGCGCGAGGUCUGAGACUA-3′; si-circ_0000517#3, 5′-GGGCUCCGCGCGAGGUCUGAG-3′), negative control of siRNA (si-NC, 5′-AACAGUCGCGUUUGCGACUGG-3′), miR-326 mimic (5′-CCUCUGGGCCCUUCCUCCAG-3′), mimic negative control (miR-NC, 5′-CGAUCGCAUCAGCAUCGAUUGC-3′), miR-326 inhibitor (anti-miR-326, 5′-CUGGAGGAAGGGCCCAGAGG-3′), and inhibitor negative control (anti-NC, 5′-CUAACGCAUGCACAGUCGUACG-3′) were synthesized by Ribobio (Guangzhou, China). Transfection was conducted in HCCLM3 and Huh7 cells with above vectors or oligonucleotides through Lipofectamine 2000 (Thermo Fisher) for 24 h.

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and colony formation assay

MTT method was employed for analysis of cell viability. HCCLM3 and Huh7 cells (5 × 103 cells/well) were added into 96-well plates and incubated for 0, 24, 48 or 72 h. At each time point, 10 μL MTT (Solarbio) with final concentrations of 0.5 mg/mL was added. Next, cells were maintained for 4 h. Subsequently, the medium was changed to 100 μL dimethyl sulfoxide (Solarbio). Then the optical density (OD) value at 490 nm was examined through microplate reader (Bio-Gene Technology, Guangzhou, China).
For colony formation assay, 1 × 103 HCCLM3 and Huh7 cells were placed into 6-well plates and maintained for 10 days. Next, cells were fixed via 4% paraformaldehyde (Solarbio) and dyed with 0.5% crystal violet (Solarbio). The colonies were photographed and counted under microscope (Nikon, Tokyo, Japan).

Western blot

Protein was extracted via RIPA lysis buffer (Solarbio), and sample concentration was examined through BCA kit (Solarbio). Equal amounts of proteins were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transfer of nitrocellulose membranes (Solarbio). The membranes were blocked with 5% fat-free milk. Subsequently, the blocked membranes were interacted with primary and secondary antibodies. The antibodies included anti-Ki67 (AF0198, 1:1000 dilution, Affinity Biosciences, Changzhou, China), anti-proliferating cell nuclear antigen (PCNA) (ab152112, 1:3000 dilution, Abcam, Cambridge, MA, USA), anti-E-cadherin (ab15148, 1:300 dilution, Abcam), anti-Vimentin (ab137321, 1:2000 dilution, Abcam), anti-lactate dehydrogenase A (LDHA) (ab125683, 1:3000 dilution, Abcam), anti-hexokinase II (HK2) (ab227198, 1:3000 dilution, Abcam) and anti-IGF1R (ab131476, 1:100 dilution, Abcam). β-actin (ab8227, 1:5000 dilution, Abcam) was used as reference, and IgG conjugated via horseradish peroxidase (ab97051, 1:10,000 dilution, Abcam) served as secondary antibody. Next, the membranes were exposed to ECL kit (Solarbio). The protein signaling was assessed using Quantity One software (Bio-Rad, Hercules, CA, USA).

Transwell analysis

Cell migration and invasion were measured through transwell analysis using 24-well transwell chambers (Corning, Corning, NY, USA). The procedures of migration and invasion were similar, but the chambers were coated with Matrigel (BD Bioscience, San Jose, CA, USA) for invasion assay. HCCLM3 and Huh7 cells (1 × 104 cells/well) in non-serum medium were seeded into upper chambers, while 500 μL medium with 10% serum was injected into the lower chambers. After culture for 20 h, cells passed the membranes were dyed with 0.5% crystal violet. The number of migrated or invasive cells was analyzed under microscope with three random fields.

Glucose consumption, lactate production and adenosine triphosphate (ATP) production

HCCLM3 and Huh7 cells (4 × 104 cells/well) were placed into 24-well plates, and cultured for 72 h. Next, the culture supernatants were collected for detection of glucose consumption, lactate production and ATP production using Glucose Uptake Assay Kit (Abcam), Lactate Assay Kit (Abcam) or ATP Assay Kit (Abcam) according to the protocols of manufacturer. The relative level of glucose consumption, lactate production or ATP production was normalized to total protein concentration and control group.

Dual-luciferase reporter analysis

The target correlation between circ_0000517 and miR-326 or between miR-326 and IGF1R was predicted via circBank (http://​www.​circbank.​cn/​), circinteractome (https://​circinteractome.​nia.​nih.​gov/​) or starBase (http://​starbase.​sysu.​edu.​cn/​). The wild-type luciferase reporter plasmids (circ_0000517-WT and IGF1R 3′UTR-WT) and their mutants (circ_0000517-MUT and IGF1R 3′UTR-MUT) were generated through inserting the wild-type or mutant-type sequence of circ_0000517 or IGF1R 3′UTR containing miR-326 complementary sites within psiCHECK-2 (Promega, Madison, WI, USA), respectively. The constructed luciferase reporter plasmids were co-transfected with miR-326 mimic or miR-NC into HCCLM3 and Huh7 cells. The luciferase activity was analyzed via dual-luciferase analysis system (Promega) after 24 h.

Xenograft model

12 BALB/c nude mice (male, 4-week-old) were provided via Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The lentiviral vector of shRNA for circ_0000517 (sh-circ_0000517) and its negative control (sh-NC) were produced via GenePharma (Shanghai, China), and then transduced into Huh7 cells. Huh7 cells (4 × 106 cells/mouse) with stable transfection of sh-circ_0000517 or sh-NC were subcutaneously injected into the left flank of nude mice, and the mice were classified as sh-circ_0000517 or sh-NC group (n = 6/group) after corresponding inoculation. The size of the formed tumors was measured every 7 days and the volume was analyzed with the formula: 0.5 × length × width2. 28 days after cell injection, mice were killed via cervical dislocation. All generated tumors were harvested for weight and further molecular analyses. The current experiments had procured the permission of the Animal Ethical Committee of The First Affiliated Hospital of Zhengzhou University.

Statistical analysis

The experiments were conducted 3 times. Statistical analysis was processed via GraphPad Prism 7 (GraphPad, La Jolla, CA, USA). Data were validated to meet normal distribution with equal variances. The data were shown as mean ± SD. The difference was compared through Student’s t-test or ANOVA with Tukey post hoc test. The linear correlation among circ_0000517, miR-326 and IGF1R was assessed via Pearson’s test. P < 0.05 indicated the significant difference.

Results

circ_0000517 expression is increased in hepatocellular carcinoma

To explore circ_0000517 level in hepatocellular carcinoma, 45 pair of tumor and adjacent nontumor tissues were collected. The result of qRT-PCR displayed that circ_0000517 level was higher in tumor than adjacent nontumor tissues (P < 0.05) (Fig. 1a). Furthermore, circ_0000517 level was detected in hepatocellular carcinoma cell lines. Compared with that in THLE-2 cells, circ_0000517 expression was markedly enhanced in HCCLM3 and Huh7 cells (Fig. 1b). These data indicated that dysregulated circ_0000517 was associated with hepatocellular carcinoma progression.

circ_0000517 knockdown inhibits cell viability, colony formation, migration, invasion and glycolysis in hepatocellular carcinoma cells

To explore the role of circ_0000517 in hepatocellular carcinoma, circ_0000517 expression was knocked down in HCCLM3 and Huh7 cells. The 3 siRNAs targeting circ_0000517 (si-circ_0000517#1, #2 and #3) induced more than 50% reduction in circ_0000517 level, and si-circ_0000517#3 with highest efficacy was used for further experiments (Fig. 2a). MTT assay showed that circ_0000517 knockdown remarkably decreased the viability of HCCLM3 and Huh7 cells at 24, 48 or 72 h (Fig. 2b, c). Moreover, circ_0000517 downregulation obviously suppressed colony formation ability in the two cell lines (Fig. 2d). Meanwhile, the viability-associated with markers Ki67 and PCNA were measured. Silence of circ_0000517 significantly reduced the expression of these two proteins (Fig. 2e, Additional file 1: Figure S1A). In addition, interference of circ_0000517 suppressed migration and invasion of HCCLM3 and Huh7 cells (Fig. 2f, g). Furthermore, knockdown of circ_0000517 repressed epithelial-mesenchymal transition (EMT), revealed via increase of E-cadherin and decrease of Vimentin, which also indicated the inhibition of migration and invasion (Fig. 2h, Additional file 1: Figure S1B). Besides, inhibition of circ_0000517 evidently suppressed glycolysis, revealed via suppression of glucose consumption, lactate production, ATP production and protein levels of LDHA and HK2 (Fig. 2i–l, Additional file 1: Figure S1C). These results suggested that circ_0000517 knockdown could repress hepatocellular carcinoma progression in vitro.

circ_0000517 is a sponge for miR-326

miR-326 and miR-1296-5p were predicted as targets of circ_0000517 via circInteractome, circBank and StarBase (Fig. 3a). Moreover, miR-326 abundance was upregulated by circ_0000517 knockdown in HCCLM3 and Huh7 cells, and the expression change of miR-326 was more significant than miR-1296-5p (Fig. 3b, c). Hence, miR-326 was selected for further experiments. The binding sites of circ_0000517 and miR-326 were shown in Fig. 3d. Furthermore, dual-luciferase reporter analysis was conducted to validate this interaction. miR-326 overexpression reduced over 60% of luciferase activity in circ_0000517-WT group, but it could not alter the luciferase activity in circ_0000517-MUT group (Fig. 3e, f). Additionally, miR-326 abundance was evidently declined in hepatocellular carcinoma tumor tissues and cell lines in comparison to adjacent nontumor tissues or THLE-2 cells (Fig. 3g, h). Besides, miR-326 level in hepatocellular carcinoma tissues was negatively associated with circ_0000517 level (r = − 0.525, P = 0.0002) (Fig. 3i). These results indicated that miR-326 was a target of circ_0000517 in hepatocellular carcinoma.

miR-326 knockdown reverses effect of circ_0000517 silence on cell viability, colony formation, migration, invasion and glycolysis in hepatocellular carcinoma cells

To probe if miR-326 was required for circ_0000517-mediated hepatocellular carcinoma development, HCCLM3 and Huh7 cells were transfected with si-NC, si-circ_0000517#3, si-circ_0000517#3 + anti-miR-326 or anti-NC. The efficacy of anti-miR-326 was identified in Fig. 4a. In addition, downregulation of miR-326 attenuated the suppressive effect of circ_0000517 silence on cell viability, colony formation, migration, invasion and glycolysis in HCCLM3 and Huh7 cells (Fig. 4b–l, Additional file 2: Figure S2A–C). Taken together, circ_0000517 knockdown inhibited hepatocellular carcinoma progression via increasing miR-326.

IGF1R is targeted via miR-326

starBase predicted 10 targets of miR-326 including IGF1R, and the effect of miR-326 on their levels was assessed in HCCLM3 cells. IGF1R was the only down-regulated target (Fig. 5a), which was selected for further experiments. The complementary sequence of miR-326 and IGF1R was displayed in Fig. 5b. To confirm the correlation between miR-326 and IGF1R, we constructed IGF1R 3′UTR-WT and IGF1R 3′UTR-MUT, and found that miR-326 overexpression induced more than 50% loss of luciferase activity in IGF1R 3′UTR-WT group, but it did not affect the activity in IGF1R 3′UTR-MUT group (Fig. 5c, d). Moreover, IGF1R expression was decreased via miR-326 overexpression (Fig. 5e, f). In addition, IGF1R mRNA and protein abundances were markedly elevated in hepatocellular carcinoma tissues and cell lines compared with adjacent nontumor tissues or THLE-2 cells (Fig. 5g–j). Besides, IGF1R expression in hepatocellular carcinoma tissues was negatively associated with miR-326 level (r = − 0.496, P = 0.0012) and positively correlated with circ_0000517 (r = 0.735, P < 0.0001) (Fig. 5k). These data suggested that IGF1R was targeted via miR-326 in hepatocellular carcinoma cells.

miR-326 overexpression represses cell viability, colony formation, migration, invasion and glycolysis via targeting IGF1R in hepatocellular carcinoma cells

To analyze the function of miR-326 in hepatocellular carcinoma development and whether it required IGF1R, HCCLM3 and Huh7 cells were transfected with miR-NC, miR-326 mimic, miR-326 mimic + pcDNA or IGF1R overexpression vector. The transfection of IGF1R overexpression vector effectively upregulated IGF1R abundance (Fig. 6a, b). In addition, miR-326 overexpression obviously suppressed cell viability, colony formation, migration, invasion and glycolysis in HCCLM3 and Huh7 cells (Fig. 6c–m, Additional file 3: Figure S3 A–C). Nevertheless, upregulation of IGF1R alleviated the effect of miR-326 on these events (Fig. 6c–m, Additional file 3: Figure S3A–C). These results indicated that miR-326 overexpression suppressed hepatocellular carcinoma progression via decreasing IGF1R.

circ_0000517 knockdown reduces IGF1R expression by miR-326

To analyze the effect of circ_0000517 on IGF1R, HCCLM3 and Huh7 cells were transfected with si-NC, si-circ_0000517#3, si-circ_0000517#3 + anti-miR-326 or anti-NC. As displayed in Fig. 7a, b, IGF1R mRNA and protein abundances were evidently declined via silence of circ_0000517, which was restored via miR-326 inhibition. These data suggested that circ_0000517 could regulate IGF1R via sponging miR-326.

circ_0000517 knockdown reduces xenograft tumor growth

To explore the function of circ_0000517 in hepatocellular carcinoma in vivo, Huh7 cells with stable transfection of sh-circ_0000517 or sh-NC were subcutaneously injected into nude mice to induce xenograft model. After 28 days, the tumor volume and weight were obviously declined in sh-circ_0000517 group in comparison to sh-NC group (Fig. 8a, b). Additionally, circ_0000517 and IGF1R levels were markedly decreased and miR-326 expression was enhanced in sh-circ_0000517 group compared with sh-NC group (Fig. 8c–e). These results indicated the tumor-suppressive role of circ_0000517 silence in hepatocellular carcinoma in vivo.

Discussion

Hepatocellular carcinoma represents about 90% cases of liver cancer [18]. Great advance has been gained in causes, pathways and therapy of hepatocellular carcinoma in recent years [19]. CircRNAs are identified as potential targets for diagnosis, prognosis and treatment of hepatocellular carcinoma [20]. In this research, we were the first to validate the anti-cancer role of circ_0000517 knockdown in hepatocellular carcinoma. Moreover, we confirmed that was associated with miR-326 and IGF1R.
The previous study analyzed the dysregulated circRNAs in hepatocellular carcinoma, and found upregulation of circ_0000517 indicated poor outcomes of hepatocellular carcinoma [8]. Similarly, we also found high expression of circ_0000517 in hepatocellular carcinoma, indicating circ_0000517 might be involved in hepatocellular carcinoma development. Ki67 and PCNA are two key viability-related proteins in human cancers, including hepatocellular carcinoma [21, 22]. By MTT, colony formation assay and detecting expression of Ki67 and PCNA, results showed that circ_0000517 silence suppressed cell viability. Furthermore, cell migration and invasion are important factors of hepatocellular carcinoma malignancy, and EMT is responsible for these two processes [23, 24]. Here we found that circ_0000517 knockdown repressed migration and invasion by blocking EMT. Besides, glycolysis is the important hallmark of cancers, contributing to development of hepatocellular carcinoma. Through detecting glycolysis-related biomarkers (glucose consumption, lactate production and ATP production) and targeted enzymes (LDHA and HK2) [2527], we found that circ_0000517 downregulation restrained glycolysis of hepatocellular carcinoma. Collectively, circ_0000517 inhibition played an anti-cancer role in hepatocellular carcinoma in vitro, which was also in agreement with a previous study [28].
The ceRNA crosstalk of circRNA/miRNA/mRNA is the key mechanism by which circRNA modulating cancer development [9]. Zhang et al. reported that circ_0000517 could regulate miR-1296-5p/TXNDC5 axis to promote HCC development [28]. In this work, we wanted to explore an additional regulatory network. miR-326 was a candidate target of circ_0000517, and this study identified miR-326 was sponged via circ_0000517 and was lowly expressed in hepatocellular carcinoma. Furthermore, our data showed the tumor-suppressive role of miR-326 in hepatocellular carcinoma, which was also in agreement with previous studies [12, 29]. Additionally, downregulation of miR-326 reversed the regulatory function of circ_0000517 silence on hepatocellular carcinoma development, implying that circ_0000517 regulated hepatocellular carcinoma development via sponging miR-326.
The dysregulation of IGF1R was a crucial target for development and treatment of hepatocellular carcinoma [14]. Here we confirmed IGF1R was targeted via miR-326. Moreover, we confirmed the oncogenic role of IGF1R in hepatocellular carcinoma via promoting cell proliferation, migration and invasion, which was also consistent with former works [15, 30, 31]. In addition, IGF1R upregulation also facilitated glycolysis in hepatocellular carcinoma, which was similar to that in mammary gland tumor and gliomas [32, 33]. Meanwhile, the rescue experiments displayed that IGF1R mitigated the effect of miR-326, suggesting miR-326 targeted IGF1R to take part in the regulation of hepatocellular carcinoma development. Besides, we found that circ_0000517 could modulate IGF1R level via competitively binding with miR-326, supporting the ceRNA network of circ_0000517/miR-326/IGF1R. Furthermore, the anti-cancer role of circ_0000517 knockdown was identified using xenograft model in vivo.

Conclusion

In conclusion, interference of circ_0000517 repressed hepatocellular carcinoma development, possibly via miR-326/IGF1R axis, indicating a new mechanism for circ_0000517 in hepatocellular carcinoma development. This study suggested circ_0000517 as a novel target for treatment of hepatocellular carcinoma.

Supplementary information

Supplementary information accompanies this paper at https://​doi.​org/​10.​1186/​s12935-020-01496-1.

Acknowledgements

None.
This research was permitted via the Ethics Committee of the First Affiliated Hospital of Zhengzhou University, and written informed consent was obtained from all subjects.
Not applicable.

Competing interests

The authors declare that they have no competing interest.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
3.
Zurück zum Zitat Yang JD, Hainaut P, Gores GJ, Amadou A, Plymoth A, Roberts LR. A global view of hepatocellular carcinoma: trends, risk, prevention and management. Nat Rev Gastroenterol Hepatol. 2019;16(10):589–604.CrossRefPubMedPubMedCentral Yang JD, Hainaut P, Gores GJ, Amadou A, Plymoth A, Roberts LR. A global view of hepatocellular carcinoma: trends, risk, prevention and management. Nat Rev Gastroenterol Hepatol. 2019;16(10):589–604.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Kristensen LS, Andersen MS, Stagsted LVW, Ebbesen KK, Hansen TB, Kjems J. The biogenesis, biology and characterization of circular RNAs. Nat Rev Genet. 2019;20(11):675–91.CrossRefPubMed Kristensen LS, Andersen MS, Stagsted LVW, Ebbesen KK, Hansen TB, Kjems J. The biogenesis, biology and characterization of circular RNAs. Nat Rev Genet. 2019;20(11):675–91.CrossRefPubMed
5.
7.
8.
Zurück zum Zitat Wang X, Wang X, Li W, Zhang Q, Chen J, Chen T. Up-Regulation of hsa_circ_0000517 predicts adverse prognosis of Hepatocellular Carcinoma. Front Oncol. 2019;9:1105.CrossRefPubMedPubMedCentral Wang X, Wang X, Li W, Zhang Q, Chen J, Chen T. Up-Regulation of hsa_circ_0000517 predicts adverse prognosis of Hepatocellular Carcinoma. Front Oncol. 2019;9:1105.CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Zhong Y, Du Y, Yang X, Mo Y, Fan C, Xiong F, Ren D, Ye X, Li C, Wang Y, et al. Circular RNAs function as ceRNAs to regulate and control human cancer progression. Mol Cancer. 2018;17(1):79.CrossRefPubMedPubMedCentral Zhong Y, Du Y, Yang X, Mo Y, Fan C, Xiong F, Ren D, Ye X, Li C, Wang Y, et al. Circular RNAs function as ceRNAs to regulate and control human cancer progression. Mol Cancer. 2018;17(1):79.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Lu M, Kong X, Wang H, Huang G, Ye C, He Z. A novel microRNAs expression signature for hepatocellular carcinoma diagnosis and prognosis. Oncotarget. 2017;8(5):8775–84.CrossRefPubMedPubMedCentral Lu M, Kong X, Wang H, Huang G, Ye C, He Z. A novel microRNAs expression signature for hepatocellular carcinoma diagnosis and prognosis. Oncotarget. 2017;8(5):8775–84.CrossRefPubMedPubMedCentral
12.
Zurück zum Zitat Zhao Q, Wu C, Wang J, Li X, Fan Y, Gao S, Wang K. LncRNA SNHG3 promotes Hepatocellular Tumorigenesis by Targeting miR-326. Tohoku J Exp Med. 2019;249(1):43–56.CrossRefPubMed Zhao Q, Wu C, Wang J, Li X, Fan Y, Gao S, Wang K. LncRNA SNHG3 promotes Hepatocellular Tumorigenesis by Targeting miR-326. Tohoku J Exp Med. 2019;249(1):43–56.CrossRefPubMed
14.
Zurück zum Zitat Wang L, Yao M, Zheng W, Fang M, Wu M, Sun J, Dong Z, Yao D. Insulin-like growth factor I receptor: a novel target for Hepatocellular Carcinoma gene therapy. Mini Rev Med Chem. 2019;19(4):272–80.CrossRefPubMed Wang L, Yao M, Zheng W, Fang M, Wu M, Sun J, Dong Z, Yao D. Insulin-like growth factor I receptor: a novel target for Hepatocellular Carcinoma gene therapy. Mini Rev Med Chem. 2019;19(4):272–80.CrossRefPubMed
15.
Zurück zum Zitat Liu Q, Shi H, Yang J, Jiang N. Long non-coding RNA NEAT1 promoted Hepatocellular Carcinoma cell proliferation and reduced apoptosis through the regulation of Let-7b-IGF-1R Axis. Onco Targets Ther. 2019;12:10401–13.CrossRefPubMedPubMedCentral Liu Q, Shi H, Yang J, Jiang N. Long non-coding RNA NEAT1 promoted Hepatocellular Carcinoma cell proliferation and reduced apoptosis through the regulation of Let-7b-IGF-1R Axis. Onco Targets Ther. 2019;12:10401–13.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Han X, Wang X, Zhao B, Chen G, Sheng Y, Wang W, Teng M. MicroRNA-187 inhibits tumor growth and metastasis via targeting of IGF-1R in hepatocellular carcinoma. Mol Med Rep. 2017;16(2):2241–6.CrossRefPubMed Han X, Wang X, Zhao B, Chen G, Sheng Y, Wang W, Teng M. MicroRNA-187 inhibits tumor growth and metastasis via targeting of IGF-1R in hepatocellular carcinoma. Mol Med Rep. 2017;16(2):2241–6.CrossRefPubMed
17.
Zurück zum Zitat Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8.CrossRefPubMed Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8.CrossRefPubMed
18.
Zurück zum Zitat Llovet JM, Zucman-Rossi J, Pikarsky E, Sangro B, Schwartz M, Sherman M, Gores G. Hepatocellular carcinoma. Nat Rev Dis Primers. 2016;2:16018.CrossRefPubMed Llovet JM, Zucman-Rossi J, Pikarsky E, Sangro B, Schwartz M, Sherman M, Gores G. Hepatocellular carcinoma. Nat Rev Dis Primers. 2016;2:16018.CrossRefPubMed
20.
Zurück zum Zitat Qiu L, Xu H, Ji M, Shang D, Lu Z, Wu Y, Tu Z, Liu H. Circular RNAs in hepatocellular carcinoma: biomarkers, functions and mechanisms. Life Sci. 2019;231:116660.CrossRefPubMed Qiu L, Xu H, Ji M, Shang D, Lu Z, Wu Y, Tu Z, Liu H. Circular RNAs in hepatocellular carcinoma: biomarkers, functions and mechanisms. Life Sci. 2019;231:116660.CrossRefPubMed
21.
Zurück zum Zitat Jurikova M, Danihel L, Polak S, Varga I. Ki67, PCNA, and MCM proteins: markers of proliferation in the diagnosis of breast cancer. Acta Histochem. 2016;118(5):544–52.CrossRefPubMed Jurikova M, Danihel L, Polak S, Varga I. Ki67, PCNA, and MCM proteins: markers of proliferation in the diagnosis of breast cancer. Acta Histochem. 2016;118(5):544–52.CrossRefPubMed
22.
Zurück zum Zitat Wang X, Wang M, Li XY, Li J, Zhao DP. KIFC1 promotes the proliferation of hepatocellular carcinoma in vitro and in vivo. Oncol Lett. 2019;18(6):5739–46.PubMedPubMedCentral Wang X, Wang M, Li XY, Li J, Zhao DP. KIFC1 promotes the proliferation of hepatocellular carcinoma in vitro and in vivo. Oncol Lett. 2019;18(6):5739–46.PubMedPubMedCentral
23.
Zurück zum Zitat Liu C, Peng X, Li Y, Liu S, Hou R, Zhang Y, Zuo S, Liu Z, Luo R, Li L, et al. Positive feedback loop of FAM83A/PI3K/AKT/c-Jun induces migration, invasion and metastasis in hepatocellular carcinoma. Biomed Pharmacother. 2020;123:109780.CrossRefPubMed Liu C, Peng X, Li Y, Liu S, Hou R, Zhang Y, Zuo S, Liu Z, Luo R, Li L, et al. Positive feedback loop of FAM83A/PI3K/AKT/c-Jun induces migration, invasion and metastasis in hepatocellular carcinoma. Biomed Pharmacother. 2020;123:109780.CrossRefPubMed
24.
Zurück zum Zitat Giannelli G, Koudelkova P, Dituri F, Mikulits W. Role of epithelial to mesenchymal transition in hepatocellular carcinoma. J Hepatol. 2016;65(4):798–808.CrossRefPubMed Giannelli G, Koudelkova P, Dituri F, Mikulits W. Role of epithelial to mesenchymal transition in hepatocellular carcinoma. J Hepatol. 2016;65(4):798–808.CrossRefPubMed
25.
Zurück zum Zitat Fang G, Zhang P, Liu J, Zhang X, Zhu X, Li R, Wang H. Inhibition of GSK-3beta activity suppresses HCC malignant phenotype by inhibiting glycolysis via activating AMPK/mTOR signaling. Cancer Lett. 2019;463:11–26.CrossRefPubMed Fang G, Zhang P, Liu J, Zhang X, Zhu X, Li R, Wang H. Inhibition of GSK-3beta activity suppresses HCC malignant phenotype by inhibiting glycolysis via activating AMPK/mTOR signaling. Cancer Lett. 2019;463:11–26.CrossRefPubMed
26.
Zurück zum Zitat Zhang Y, Zhang C, Zhao Q, Wei W, Dong Z, Shao L, Li J, Wu W, Zhang H, Huang H, et al. The miR-873/NDFIP1 axis promotes hepatocellular carcinoma growth and metastasis through the AKT/mTOR-mediated Warburg effect. Am J Cancer Res. 2019;9(5):927–44.PubMedPubMedCentral Zhang Y, Zhang C, Zhao Q, Wei W, Dong Z, Shao L, Li J, Wu W, Zhang H, Huang H, et al. The miR-873/NDFIP1 axis promotes hepatocellular carcinoma growth and metastasis through the AKT/mTOR-mediated Warburg effect. Am J Cancer Res. 2019;9(5):927–44.PubMedPubMedCentral
27.
Zurück zum Zitat Sheng H, Tang W. Glycolysis inhibitors for anticancer therapy: a review of recent patents. Recent Pat Anticancer Drug Discov. 2016;11(3):297–308.CrossRefPubMed Sheng H, Tang W. Glycolysis inhibitors for anticancer therapy: a review of recent patents. Recent Pat Anticancer Drug Discov. 2016;11(3):297–308.CrossRefPubMed
28.
Zurück zum Zitat Zang H, Li Y, Zhang X, Huang G. Circ_0000517 contributes to Hepatocellular Carcinoma progression by upregulating TXNDC5 via sponging miR-1296-5p. Cancer Manag Res. 2020;12:3457–68.CrossRefPubMedPubMedCentral Zang H, Li Y, Zhang X, Huang G. Circ_0000517 contributes to Hepatocellular Carcinoma progression by upregulating TXNDC5 via sponging miR-1296-5p. Cancer Manag Res. 2020;12:3457–68.CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat Hu S, Ran Y, Chen W, Zhang Y, Xu Y. MicroRNA-326 inhibits cell proliferation and invasion, activating apoptosis in hepatocellular carcinoma by directly targeting LIM and SH3 protein 1. Oncol Rep. 2017;38(3):1569–78.CrossRefPubMed Hu S, Ran Y, Chen W, Zhang Y, Xu Y. MicroRNA-326 inhibits cell proliferation and invasion, activating apoptosis in hepatocellular carcinoma by directly targeting LIM and SH3 protein 1. Oncol Rep. 2017;38(3):1569–78.CrossRefPubMed
30.
Zurück zum Zitat Wang X, Liu S, Cao L, Zhang T, Yue D, Wang L, Ping Y, He Q, Zhang C, Wang M, et al. miR-29a-3p suppresses cell proliferation and migration by downregulating IGF1R in hepatocellular carcinoma. Oncotarget. 2017;8(49):86592–603.CrossRefPubMedPubMedCentral Wang X, Liu S, Cao L, Zhang T, Yue D, Wang L, Ping Y, He Q, Zhang C, Wang M, et al. miR-29a-3p suppresses cell proliferation and migration by downregulating IGF1R in hepatocellular carcinoma. Oncotarget. 2017;8(49):86592–603.CrossRefPubMedPubMedCentral
31.
Zurück zum Zitat Ye Y, Zhuang J, Wang G, He S, Zhang S, Wang G, Ni J, Wang J, Xia W. MicroRNA-495 suppresses cell proliferation and invasion of hepatocellular carcinoma by directly targeting insulin-like growth factor receptor-1. Exp Ther Med. 2018;15(1):1150–8.PubMed Ye Y, Zhuang J, Wang G, He S, Zhang S, Wang G, Ni J, Wang J, Xia W. MicroRNA-495 suppresses cell proliferation and invasion of hepatocellular carcinoma by directly targeting insulin-like growth factor receptor-1. Exp Ther Med. 2018;15(1):1150–8.PubMed
32.
Zurück zum Zitat Ter Braak B, Siezen CL, Lee JS, Rao P, Voorhoeve C, Ruppin E, van der Laan JW, van de Water B. Insulin-like growth factor 1 receptor activation promotes mammary gland tumor development by increasing glycolysis and promoting biomass production. Breast Cancer Res. 2017;19(1):14.CrossRefPubMedPubMedCentral Ter Braak B, Siezen CL, Lee JS, Rao P, Voorhoeve C, Ruppin E, van der Laan JW, van de Water B. Insulin-like growth factor 1 receptor activation promotes mammary gland tumor development by increasing glycolysis and promoting biomass production. Breast Cancer Res. 2017;19(1):14.CrossRefPubMedPubMedCentral
33.
Zurück zum Zitat Wang B, Sun F, Dong N, Sun Z, Diao Y, Zheng C, Sun J, Yang Y, Jiang D. MicroRNA-7 directly targets insulin-like growth factor 1 receptor to inhibit cellular growth and glucose metabolism in gliomas. Diagn Pathol. 2014;9:211.CrossRefPubMedPubMedCentral Wang B, Sun F, Dong N, Sun Z, Diao Y, Zheng C, Sun J, Yang Y, Jiang D. MicroRNA-7 directly targets insulin-like growth factor 1 receptor to inhibit cellular growth and glucose metabolism in gliomas. Diagn Pathol. 2014;9:211.CrossRefPubMedPubMedCentral
Metadaten
Titel
RETRACTED ARTICLE: Circular RNA circ_0000517 regulates hepatocellular carcinoma development via miR-326/IGF1R axis
verfasst von
Shuwei He
Jianzeng Yang
Shitao Jiang
Yuan Li
Xingmin Han
Publikationsdatum
01.12.2020
Verlag
BioMed Central
Erschienen in
Cancer Cell International / Ausgabe 1/2020
Elektronische ISSN: 1475-2867
DOI
https://doi.org/10.1186/s12935-020-01496-1

Weitere Artikel der Ausgabe 1/2020

Cancer Cell International 1/2020 Zur Ausgabe

Erhebliches Risiko für Kehlkopfkrebs bei mäßiger Dysplasie

29.05.2024 Larynxkarzinom Nachrichten

Fast ein Viertel der Personen mit mäßig dysplastischen Stimmlippenläsionen entwickelt einen Kehlkopftumor. Solche Personen benötigen daher eine besonders enge ärztliche Überwachung.

15% bedauern gewählte Blasenkrebs-Therapie

29.05.2024 Urothelkarzinom Nachrichten

Ob Patienten und Patientinnen mit neu diagnostiziertem Blasenkrebs ein Jahr später Bedauern über die Therapieentscheidung empfinden, wird einer Studie aus England zufolge von der Radikalität und dem Erfolg des Eingriffs beeinflusst.

Erhöhtes Risiko fürs Herz unter Checkpointhemmer-Therapie

28.05.2024 Nebenwirkungen der Krebstherapie Nachrichten

Kardiotoxische Nebenwirkungen einer Therapie mit Immuncheckpointhemmern mögen selten sein – wenn sie aber auftreten, wird es für Patienten oft lebensgefährlich. Voruntersuchung und Monitoring sind daher obligat.

Costims – das nächste heiße Ding in der Krebstherapie?

28.05.2024 Onkologische Immuntherapie Nachrichten

„Kalte“ Tumoren werden heiß – CD28-kostimulatorische Antikörper sollen dies ermöglichen. Am besten könnten diese in Kombination mit BiTEs und Checkpointhemmern wirken. Erste klinische Studien laufen bereits.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.