Background
Liver cancer is one of the main causes of cancer-associated death with rising incidence and mortality [
1]. Hepatocellular carcinoma accounts for majority of liver cancer [
2]. Improvements have been gained in prevention and management of hepatocellular carcinoma [
3]. Nevertheless, some patients have poor prognosis. To improve the treatment and prognosis of hepatocellular carcinoma, the mechanism modulating the progression of hepatocellular carcinoma is sorely wanted.
Circular RNAs (circRNAs) are a group of noncoding RNAs generated via covalently linking the 5′ cap and 3′ end [
4]. Many circRNAs are ubiquitously expressed in eukaryotes [
5]. Moreover, circRNAs play essential roles in development and treatment of cancers [
6]. The emerging evidence demonstrates that circRNAs have pivotal roles in diagnosis and therapy of hepatocellular carcinoma [
7]. A previous study analyzes the expression of many circRNAs using two hepatocellular carcinoma-associated databases (GSE97332 and GSE94508), and finds circRNA hsa_circ_0000517 (circ_0000517) is the only one circRNA up-regulated in hepatocellular carcinoma in both databases [
8]. However, the exact function and mechanism of circ_0000517 in hepatocellular carcinoma development remain poorly understood.
CircRNAs could take part in the regulation of cancer development via functioning as competing endogenous RNAs (ceRNAs) for microRNAs (miRNAs) to affect the stability of targeted genes [
9]. miRNAs are a group of small noncoding RNAs which are implicated in hepatocellular carcinoma development [
10]. miR-326 is one of lowly expressed miRNAs and associated with patients’ outcomes in hepatocellular carcinoma [
11]. Moreover, miR-326 could inhibit hepatocellular tumorigenesis [
12]. However, whether miR-326 is required for circ_0000517-mediated mechanism is unclear. In addition, insulin-like growth factor system is reported to participate in liver disorders [
13]. Insulin-like growth factor type 1 receptor (IGF1R) is a member of insulin-like growth factor system, which is aberrantly expressed in hepatocellular carcinoma [
14]. Furthermore, accruing studies suggest IGF1R plays an oncogenic role in hepatocellular carcinoma [
15,
16]. Besides, the bioinformatics analysis predicts that miR-326 might bind with circ_0000517 and IGF1R. Therefore, we hypothesized circ_0000517 could serve as a ceRNA for miR-326 to target IGF1R to be involved in hepatocellular carcinoma development.
In this research, we investigated the effect of circ_0000517 on hepatocellular carcinoma development in vitro and in vivo. Furthermore, we analyzed the ceRNA network of circ_0000517/miR-326/IGF1R.
Materials and methods
Patients and tissues
45 patients with hepatocellular carcinoma were recruited from The First Affiliated Hospital of Zhengzhou University, and they all did not receive other therapy before tissues collection. The tumor and adjacent nontumor tissues were harvested and stored at − 80 °C. This research was permitted via the Ethics Committee of The First Affiliated Hospital of Zhengzhou University, and written informed consent was obtained from all subjects.
Cell culture
Normal liver cell line THLE-2 and hepatocellular carcinoma cell lines HCCLM3 and Huh7 were provided via BeNa Culture Collection (Beijing, China) and maintained in Dulbecco’s Modified Eagle Medium (Thermo Fisher, Waltham, MA, USA) plus 10% fetal bovine serum (Gibco, Gran Island, NY, USA) and 1% antibiotic (Thermo Fisher) in 5% CO2 at 37 °C.
RNA extraction and quantitative reverse transcription polymerase chain reaction (qRT-PCR)
Tissues or cells were lysed using Trizol reagent (Thermo Fisher) and were used for RNA extraction. For circRNA extraction, the obtained RNA was further incubated with RNase R (GeneSeed, Guangzhou, China) following instructions of manufacturer. The RNA was reversely transcribed to cDNA with specific reverse transcription kit (Thermo Fisher). The cDNA together with SYBR Green (Solarbio, Beijing, China) and specific primers (Sangon, Shanghai, China) was used for qRT-PCR. The primers included: circ_0000517 (sense, 5′-GGGAGGTGAGTTCCCAGAG-3′; antisense, 5′-CAGGGAGAGCCCTGTTAGG-3′), IGF1R (sense, 5′-AGTATGGAGGGGCCAAGCTA-3′; antisense, 5′-CTTTTGGCCTGGACATAGAAGA-3′), miR-326 (sense, 5′-CATCTGTCTGTTGGGCTGGA-3′; antisense, 5′-AGGAAGGGCCCAGAGGCG-3′), U6 (sense, 5′-CTCGCTTCGGCAGCACA-3′; antisense, AACGCTTCACGAATTTGCGT), and GAPDH (sense, 5′-CATGAGAAGTATGACAACAGCCT-3′; antisense, 5′-AGTCCTTCCACGATACCAAAGT-3′). GAPDH or U6 was used as reference. Relative RNA level was calculated through 2
−ΔΔCt method [
17].
Cell transfection
IGF1R overexpression vector was generated through inserting the sequence of IGF1R into pcDNA3.1 vector. The pcDNA3.1 vector (Thermo Fisher) served as negative control (pcDNA). siRNA for circ_0000517 (si-circ_0000517#1, 5′-GGCUCCGCGCGAGGUCUGAGA-3′; si-circ_0000517#2, 5′-UCCGCGCGAGGUCUGAGACUA-3′; si-circ_0000517#3, 5′-GGGCUCCGCGCGAGGUCUGAG-3′), negative control of siRNA (si-NC, 5′-AACAGUCGCGUUUGCGACUGG-3′), miR-326 mimic (5′-CCUCUGGGCCCUUCCUCCAG-3′), mimic negative control (miR-NC, 5′-CGAUCGCAUCAGCAUCGAUUGC-3′), miR-326 inhibitor (anti-miR-326, 5′-CUGGAGGAAGGGCCCAGAGG-3′), and inhibitor negative control (anti-NC, 5′-CUAACGCAUGCACAGUCGUACG-3′) were synthesized by Ribobio (Guangzhou, China). Transfection was conducted in HCCLM3 and Huh7 cells with above vectors or oligonucleotides through Lipofectamine 2000 (Thermo Fisher) for 24 h.
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and colony formation assay
MTT method was employed for analysis of cell viability. HCCLM3 and Huh7 cells (5 × 103 cells/well) were added into 96-well plates and incubated for 0, 24, 48 or 72 h. At each time point, 10 μL MTT (Solarbio) with final concentrations of 0.5 mg/mL was added. Next, cells were maintained for 4 h. Subsequently, the medium was changed to 100 μL dimethyl sulfoxide (Solarbio). Then the optical density (OD) value at 490 nm was examined through microplate reader (Bio-Gene Technology, Guangzhou, China).
For colony formation assay, 1 × 103 HCCLM3 and Huh7 cells were placed into 6-well plates and maintained for 10 days. Next, cells were fixed via 4% paraformaldehyde (Solarbio) and dyed with 0.5% crystal violet (Solarbio). The colonies were photographed and counted under microscope (Nikon, Tokyo, Japan).
Western blot
Protein was extracted via RIPA lysis buffer (Solarbio), and sample concentration was examined through BCA kit (Solarbio). Equal amounts of proteins were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transfer of nitrocellulose membranes (Solarbio). The membranes were blocked with 5% fat-free milk. Subsequently, the blocked membranes were interacted with primary and secondary antibodies. The antibodies included anti-Ki67 (AF0198, 1:1000 dilution, Affinity Biosciences, Changzhou, China), anti-proliferating cell nuclear antigen (PCNA) (ab152112, 1:3000 dilution, Abcam, Cambridge, MA, USA), anti-E-cadherin (ab15148, 1:300 dilution, Abcam), anti-Vimentin (ab137321, 1:2000 dilution, Abcam), anti-lactate dehydrogenase A (LDHA) (ab125683, 1:3000 dilution, Abcam), anti-hexokinase II (HK2) (ab227198, 1:3000 dilution, Abcam) and anti-IGF1R (ab131476, 1:100 dilution, Abcam). β-actin (ab8227, 1:5000 dilution, Abcam) was used as reference, and IgG conjugated via horseradish peroxidase (ab97051, 1:10,000 dilution, Abcam) served as secondary antibody. Next, the membranes were exposed to ECL kit (Solarbio). The protein signaling was assessed using Quantity One software (Bio-Rad, Hercules, CA, USA).
Transwell analysis
Cell migration and invasion were measured through transwell analysis using 24-well transwell chambers (Corning, Corning, NY, USA). The procedures of migration and invasion were similar, but the chambers were coated with Matrigel (BD Bioscience, San Jose, CA, USA) for invasion assay. HCCLM3 and Huh7 cells (1 × 104 cells/well) in non-serum medium were seeded into upper chambers, while 500 μL medium with 10% serum was injected into the lower chambers. After culture for 20 h, cells passed the membranes were dyed with 0.5% crystal violet. The number of migrated or invasive cells was analyzed under microscope with three random fields.
Glucose consumption, lactate production and adenosine triphosphate (ATP) production
HCCLM3 and Huh7 cells (4 × 104 cells/well) were placed into 24-well plates, and cultured for 72 h. Next, the culture supernatants were collected for detection of glucose consumption, lactate production and ATP production using Glucose Uptake Assay Kit (Abcam), Lactate Assay Kit (Abcam) or ATP Assay Kit (Abcam) according to the protocols of manufacturer. The relative level of glucose consumption, lactate production or ATP production was normalized to total protein concentration and control group.
Dual-luciferase reporter analysis
The target correlation between circ_0000517 and miR-326 or between miR-326 and IGF1R was predicted via circBank (
http://www.circbank.cn/), circinteractome (
https://circinteractome.nia.nih.gov/) or starBase (
http://starbase.sysu.edu.cn/). The wild-type luciferase reporter plasmids (circ_0000517-WT and IGF1R 3′UTR-WT) and their mutants (circ_0000517-MUT and IGF1R 3′UTR-MUT) were generated through inserting the wild-type or mutant-type sequence of circ_0000517 or IGF1R 3′UTR containing miR-326 complementary sites within psiCHECK-2 (Promega, Madison, WI, USA), respectively. The constructed luciferase reporter plasmids were co-transfected with miR-326 mimic or miR-NC into HCCLM3 and Huh7 cells. The luciferase activity was analyzed via dual-luciferase analysis system (Promega) after 24 h.
Xenograft model
12 BALB/c nude mice (male, 4-week-old) were provided via Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The lentiviral vector of shRNA for circ_0000517 (sh-circ_0000517) and its negative control (sh-NC) were produced via GenePharma (Shanghai, China), and then transduced into Huh7 cells. Huh7 cells (4 × 106 cells/mouse) with stable transfection of sh-circ_0000517 or sh-NC were subcutaneously injected into the left flank of nude mice, and the mice were classified as sh-circ_0000517 or sh-NC group (n = 6/group) after corresponding inoculation. The size of the formed tumors was measured every 7 days and the volume was analyzed with the formula: 0.5 × length × width2. 28 days after cell injection, mice were killed via cervical dislocation. All generated tumors were harvested for weight and further molecular analyses. The current experiments had procured the permission of the Animal Ethical Committee of The First Affiliated Hospital of Zhengzhou University.
Statistical analysis
The experiments were conducted 3 times. Statistical analysis was processed via GraphPad Prism 7 (GraphPad, La Jolla, CA, USA). Data were validated to meet normal distribution with equal variances. The data were shown as mean ± SD. The difference was compared through Student’s t-test or ANOVA with Tukey post hoc test. The linear correlation among circ_0000517, miR-326 and IGF1R was assessed via Pearson’s test. P < 0.05 indicated the significant difference.
Discussion
Hepatocellular carcinoma represents about 90% cases of liver cancer [
18]. Great advance has been gained in causes, pathways and therapy of hepatocellular carcinoma in recent years [
19]. CircRNAs are identified as potential targets for diagnosis, prognosis and treatment of hepatocellular carcinoma [
20]. In this research, we were the first to validate the anti-cancer role of circ_0000517 knockdown in hepatocellular carcinoma. Moreover, we confirmed that was associated with miR-326 and IGF1R.
The previous study analyzed the dysregulated circRNAs in hepatocellular carcinoma, and found upregulation of circ_0000517 indicated poor outcomes of hepatocellular carcinoma [
8]. Similarly, we also found high expression of circ_0000517 in hepatocellular carcinoma, indicating circ_0000517 might be involved in hepatocellular carcinoma development. Ki67 and PCNA are two key viability-related proteins in human cancers, including hepatocellular carcinoma [
21,
22]. By MTT, colony formation assay and detecting expression of Ki67 and PCNA, results showed that circ_0000517 silence suppressed cell viability. Furthermore, cell migration and invasion are important factors of hepatocellular carcinoma malignancy, and EMT is responsible for these two processes [
23,
24]. Here we found that circ_0000517 knockdown repressed migration and invasion by blocking EMT. Besides, glycolysis is the important hallmark of cancers, contributing to development of hepatocellular carcinoma. Through detecting glycolysis-related biomarkers (glucose consumption, lactate production and ATP production) and targeted enzymes (LDHA and HK2) [
25‐
27], we found that circ_0000517 downregulation restrained glycolysis of hepatocellular carcinoma. Collectively, circ_0000517 inhibition played an anti-cancer role in hepatocellular carcinoma in vitro, which was also in agreement with a previous study [
28].
The ceRNA crosstalk of circRNA/miRNA/mRNA is the key mechanism by which circRNA modulating cancer development [
9]. Zhang et al. reported that circ_0000517 could regulate miR-1296-5p/TXNDC5 axis to promote HCC development [
28]. In this work, we wanted to explore an additional regulatory network. miR-326 was a candidate target of circ_0000517, and this study identified miR-326 was sponged via circ_0000517 and was lowly expressed in hepatocellular carcinoma. Furthermore, our data showed the tumor-suppressive role of miR-326 in hepatocellular carcinoma, which was also in agreement with previous studies [
12,
29]. Additionally, downregulation of miR-326 reversed the regulatory function of circ_0000517 silence on hepatocellular carcinoma development, implying that circ_0000517 regulated hepatocellular carcinoma development via sponging miR-326.
The dysregulation of IGF1R was a crucial target for development and treatment of hepatocellular carcinoma [
14]. Here we confirmed IGF1R was targeted via miR-326. Moreover, we confirmed the oncogenic role of IGF1R in hepatocellular carcinoma via promoting cell proliferation, migration and invasion, which was also consistent with former works [
15,
30,
31]. In addition, IGF1R upregulation also facilitated glycolysis in hepatocellular carcinoma, which was similar to that in mammary gland tumor and gliomas [
32,
33]. Meanwhile, the rescue experiments displayed that IGF1R mitigated the effect of miR-326, suggesting miR-326 targeted IGF1R to take part in the regulation of hepatocellular carcinoma development. Besides, we found that circ_0000517 could modulate IGF1R level via competitively binding with miR-326, supporting the ceRNA network of circ_0000517/miR-326/IGF1R. Furthermore, the anti-cancer role of circ_0000517 knockdown was identified using xenograft model in vivo.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.