1 Introduction
More than 450,000 new cases are diagnosed with esophageal cancer every year, placing it ninth among all cancer types [
1,
2]. Pathologically, esophageal squamous cell carcinoma (ESCC) accounts for over 90% of these cancers [
3]. Although current treatment methods, such as drug therapy and targeted therapy, can significantly improve the therapeutic effect for ESCC patients, the prognosis remains poor, especially in the advanced stage [
4,
5]. Therefore, it is necessary to investigate the molecular pathogenesis of ESCC and identify molecular markers and therapeutic targets for the disease.
CircRNAs were first discovered in 1976 [
6]. In 1991, Nigro et al. identified their presence in human cells when studying the tumor suppressor gene DCC [
7]. The covalent closed-loop structure of circRNAs makes them more stable than the linear RNAs within cells [
8]. Importantly, circRNAs are expressed in specific cell types or pathological conditions [
9]. Some circRNAs serve as prognostic biomarkers for various cancers, including glioma, hepatocellular carcinoma, and ESCC [
10‐
12]. The regulatory role of circRNA in ESCC requires further exploration. In a previous report, Wang et al. reported the dysregulation of circCHSY1 (circRNA ID hsa_circ_0005019) in ESCC through qRT-PCR analysis [
13]. However, research on circCHSY1 is still relatively rare.
MicroRNAs (miRNAs) are non-coding small molecules that play a crucial role in tumorigenesis. Abnormal expression of certain miRNAs has been detected in ESCC tissues, contributing to the development and progression of the disease. For instance, miR-375 is highly expressed in ESCC, promoting tumor cell growth and metastasis [
14]. Moreover, miR-34a inhibited ESCC cell proliferation and migration [
15]. Another miRNA, miR-1229-3p, was found to promote the progression of some cancers such as gastric cancer [
16] and breast cancer [
17]. However, the role of miR-1229-3p in ESCC progression remains unclear.
Herein, we analyzed circCHSY1 and miR-1229-3p expression, and determined the role of circCHSY1 in ESCC cell malignancy. Additionally, the present work investigated whether the regulation of circCHSY1 in ESCC progression involved miR-1229-3p.
2 Materials and methods
2.1 Human samples
The study was carried out with the approval of the Ethics Committee of Gaozhou People’s Hospital and was performed in accordance with the ethical standards as laid down in the 1964 Declaration of Helsinki 56 pairs of fresh ESCC tissues and adjacent normal tissues were obtained from this hospital. Informed consent was obtained from all participants before sample collection. The collected tissue specimens were stored at − 80 °C.
2.2 Cell culture and transfection
Normal esophageal epithelial cells (HET-1A) were acquired from ATCC (Manassas, VA, USA). TE-1, Eca-109, KYSE150, and HUVEC cell lines were obtained from Procell (Wuhan, China), while KYSE70 cells were provided by TongPai Biotechnology (Shanghai, China). KYSE70 cells and KYSE150 cells were maintained in RPMI-1640 medium, and other cells were cultivated in a DMEM medium. During cell culture, medium was supplemented with 1% penicillin/streptomycin (Procell) and 10% fetal bovine serum (FBS). The culture conditions were 37 °C, 5% CO2, and 95% humidity.
SiRNAs for circCHSY1 (si-circCHSY1-1 and si-circCHSY1-2), shRNA against circCHSY1 (sh-circCHSY1), miR-1229-3p mimic and inhibitor, Tectonic-1 (TCTN1) overexpressed plasmid (pcDNA-TCTN1) and their negative controls were all provided by GenePharma (Shanghai, China). When the cell aggregation rate reached 80%, 50 nM of miRNA mimic, different substances (20 pmoL of siRNA, 0.8 µg of plasmids, and 100 nM of miRNA inhibitor) were used for cell transfection by Lipofectamine™ 3000 (Invitrogen, Carlsbad, CA, USA) depending on the experimental requirements.
2.3 qRT-PCR
In line with the guidebook of GoldenstarTM RT6 cDNA Synthesis Kit (Chinese Indigo), the isolated RNA by TRIzol
™ was used to synthesize complementary DNA. Premix Ex Taq
™ II (Chinese Indigo) was used for real-time PCR. RNA quantification was performed by the 2
−∆∆Ct method. Primer’s sequences used in this paper are listed in Table
1.
Table 1
Primer sequences for qRT-PCR
circCHSY1 | Forward | TCTTATGAGAACATGGTCCAAGAC |
Reverse | CCACACCCCGTAGTGGC |
CHSY1 | Forward | CAGGAACTTTCTCTTCGTGGGA |
Reverse | TCCAAGTAGTGGTCGTGCAT |
miR-1229-3p | Forward | GCCGAGCTCTCACCACTGCCCTC |
Reverse | AGTGCAGGGTCCGAGGTATT |
TCTN1 | Forward | ATGAGGTGAGCCTGAACTTGA |
Reverse | CTCTGTCTCAAGGAACCCAGT |
GAPDH | Forward | GGTCACCAGGGCTGCTTT |
Reverse | GGAAGATGGTGATGGGATT |
U6 | Forward | CTTCGGCAGCACATATACT |
Reverse | AAAATATGGAACGCTTCACG |
2.4 RNase R digestion
Three μg of RNA was incubated with RNase R (Epicentre Biotechnologies, Madison, WI, USA) for 20 min under normal conditions. Expression of circCHSY1 and its linear gene CHSY1 was measured by qRT-PCR.
2.5 CCK8 test
1 × 104 TE-1 or Eca-109 cells for each assay were respectively planted onto the 96-well plates and transfected with different substances (si-circCHSY1, si-NC, miRNA inhibitors, inhibitor control, miRNA mimics, mimic control, pcDNA-TCTN1 and pcDNA-NC) into the cells. Cell proliferative ability was then analyzed following the suggestion of CCK8 kit (Beyotime, Shanghai, China).
2.6 EdU assay
EdU Imaging Detection Kit (KeyGEN, Nanjing, China) was utilized to assess cell proliferation. ESCC cells (5 × 104/well) with different transfections were seeded in 96-well plates and subsequently went through incubation with an EdU working reagent. Subsequently, the cells were fixed with paraformaldehyde (4%) and infiltrated with Triton X-100 solution (0.5%). After the addition of Click-iT EdU reaction buffer (100 µL), images of EdU-positive cells were recorded under a fluorescence microscope.
2.7 Flow cytometry
Cells with different substances (si-circCHSY1, si-NC, miRNA inhibitors, inhibitor control, miRNA mimics, mimic control, pcDNA-TCTN1, and pcDNA-NC) were cultured at 37 °C for 48 h. 1 × 105 cells were harvested and suspended in 5 μL of Annexin V-FITC and 10 μL of PI (Beyotime) for 10 min. Apoptotic cells were detected by flow cytometry (Countstar, Shanghai, China).
2.8 Transwell assay
Matrigel (Millipore, Billerica, MA, USA) was utilized for cell invasion analysis. In simple terms, 1 × 105 of ESCC cells with different substances (si-circCHSY1, si-NC, miRNA inhibitors, inhibitor control, miRNA mimics, mimic control, pcDNA-TCTN1, and pcDNA-NC) were added to the upper chambers. After 24 h of culture, the invaded cells were finally photographed under a microscope.
HUVEC cells (3 × 104 cells/well) were treated with si-circCHSY1, si-NC, anti-miR-1229-3p, miR-NC, pcDNA-TCTN1, pcDNA-NC, anti-miR-NC or miR-1229-3p, alone or jointly. The cells were suspended into 96-well plates coated with 60 μL Matrigel (Millipore) and cultured with supernatant of ESCC cells for 5 h. Then, a microscope was used to determine the number of capillary-like branches.
2.10 Western blot
Proteins were extracted from cells and tissues using RIPA lysis solution (Beyotime). The proteins were separated by 5% SDS-PAGE and then transferred onto membranes. The membranes were blocked with non-fat milk for 1.5 h and incubated overnight with primary antibodies including anti-PCNA (ab92552, 1:1000, Abcam, Cambridge, MA, USA), anti-Bax (ab32503, 1:1000, Abcam), anti-Bcl-2 (ab182858, 1:1000, Abcam), anti-TCTN1 (15,004-1-AP, 1:500, proteintech, Chicago, Illinois, USA) and anti-GAPDH (ab9485, 1:1000, Abcam). The protein bands were visualized using ECL substrates (Millipore).
2.11 Dual-luciferase reporter gene assay
Wild (WT) or mutant (MUT) circCHSY1 (or TCTN1) containing the potential binding sites for miR-1229-3p were inserted into the psi-CHECK vector (Promega, Madison, WI, USA). TE-1 and Eca-109 cells were subsequently co-transfected with the constructed plasmids described above with miR-1229-3p or miR-NC. The cells were divided into groups including circCHSY1WT + miR-1229-3p group, circCHSY1WT + miR-NC group, circCHSY1MUT + miR-1229-3p group, circCHSY1MUT + miR-NC group, TCTN1 3’UTRWT + miR-1229-3p, TCTN1 3’UTRWT + miR-NC, TCTN1 3’UTRMUT + miR-1229-3p, and TCTN1 3’UTRMUT + miR-NC group. After 48 h, luciferase activity was analyzed using a dual-luciferase assay system.
2.12 RNA pull-down assay
Eca109 and TE-1 cells were collected and incubated in a RIPA lysis buffer. The lysate was incubated with biotin-labeled oligonucleotide probes and Streptavidin-coupled Dynabeads (Invitrogen). The magnetic beads were incubated at 4 °C for 3 h and the combined RNA in the complex was purified using TRIzol. MiR-1224-3p, miR-1253, and miR-1229-3p expression were assessed by qRT-PCR.
2.13 Nucleus-cytoplasm fractionation
PARIS™ kit (Invitrogen) was applied to determine the position of circCHSY1 in cells. The cytoplasmic and nuclear components of ESCC cells were isolated and collected for qRT-PCR analysis of circCHSY1 expression.
2.14 In vivo studies
Specific pathogen-free BALB/c nude female mice (n = 10) aged 4–5 weeks weighing 18–22 g were purchased from Hunan Slyke Jingda Experimental Animal Co., LTD (Changsha, China) and maintained in the absence of specific pathogens. The experiments were approved by the Administrative Panel on Laboratory Animal Care of Gaozhou People’s Hospital. All animal procedures were carried out following the National guidelines of the Animal Care and Use of laboratory animals, the ARRIVE guidelines and the Basel Declaration. The maximal tumor size permitted by the Ethics Committee of Gaozhou People’s Hospital is not exceed 2000 mm
3 in size and 20 mm in diameter. The generated xenograft tumors in this study were not exceeded this range. Two groups of mice were injected subcutaneously with TE-1 cells stably expressing sh-NC or sh-circCHSY1. The density of cell suspension was adjusted to 1 × 10
6 cells/mL, and each mouse was injected with the cell suspension (200 μL) to establish an in vivo model. Tumor volume was recorded weekly. After 4 weeks, the mice were anesthetized using pentobarbital sodium, and the tumor was dissected for tumor weight and gene expression analysis. Confounders were not controlled in this experiment. Immunohistochemistry (IHC) was conducted to analyze PCNA, Bax, Bcl-2, and Ki67 expression as instructed [
18]. Antibodies were obtained from Abcam (Shanghai) Trading Co., LTD.
2.15 Statistical analyses
Data in this study were analyzed by GraphPad Prism version 5.0 and presented as mean ± standard deviation. Distribution normality was evaluated using the Shapiro-Wilk normality test. The Student’s t-test was used to analyze the difference between 2 groups. Analysis of variance was performed to analyze data among three or more groups. P-value less than 0.05 meant a significant difference.
4 Discussion
CircRNAs can act as oncogenes or suppressor genes in various cancers by modulating signaling pathways [
19]. In ESCC, circ-SLC7A5 [
20], circ-LRP6 [
21] and circ-TTC17 [
22] have been reported to play tumor-promoting roles, but circFoxo3 [
23] and circSMAD7 [
24] act tumor-inhibiting roles. In a previous study, researchers revealed that circCHSY1 was significantly overexpressed in ESCC [
13]. Although some evidence points to the involvement of circCHSY1 in disease progression through circ_0005019 [
25], further research is required to gain a deeper understanding of the intricate networks regulated by circCHSY1. This might help us to develop clinical diagnostic reagents or seek more therapeutic targets. In this research, we discovered that circCHSY1 expression was increased in ESCC patients and cell lines. We observed that circCHSY1 silencing restrained cell migration, invasion, and angiogenesis, while also promoting apoptosis rate. Also, circCHSY1 silencing inhibited tumor growth in a xenograft mouse model using TE-1 cells.
MiR-1229-3p is involved in the progression of many cancer tumors such as colorectal cancer, glioma, and hepatocellular carcinoma [
26‐
28]. In this study, we discovered this miRNA in tumor tissues and cells was significantly reduced, consistent with previous findings [
29]. Moreover, miR-1229-3p showed a significant negative correlation with circCHSY1. CircRNA functions include miRNA sponge, alternative splicing, and regulation of gene transcription [
30,
31]. CircRNA indirectly affects gene expression through direct absorption of miRNA [
32]. Based on the above theories, we wondered whether circCHSY1 could sponge miR-1229-3p. Interestingly, in this project, miR-1229-3p inhibitor could reverse circCHSY1-mediated changes in ESCC cells’ function to a certain extent.
TCTN1 is a protein composed of 587 amino acids [
33]. It belongs to the tectonic family and is closely related to the Hedgehog signaling pathway [
34]. Early reports indicated that TCTN1 was associated with numerous tumors including gastric cancer [
35], human thyroid cancer [
36], as well as ESCC [
37]. In this topic, TCTN1 was abnormally elevated in ESCC tissues. TCTN1 was negatively modulated via miR-1229-3p and could participate in the changes in cell function caused by miR-1229-3p. Meanwhile, the absence of circCHSY1 reduced TCTN1 expression, whereas the inhibitor of miR-1229-3p reversed this phenomenon. These findings fully demonstrated that the novel signal axis circCHSY1/miR-1229-3p/TCTN1 was closely related to the regulation of ESCC.
However, there are some limitations to this research. Firstly, all clinical samples were collected from one hospital, and the sample size is relatively small. It is recommended to collect more samples from different hospitals in the future. In addition, the mechanism by which TCTN1 regulates ESCC progression has not been studied, and further experiments using other ESCC cell lines should be performed according to the methods described in this manuscript. The results show that the circCHSY1/miR-1229-3p/TCTN1 axis has a direct or indirect association with Bax, Bcl-2 and PCNA expression, and the relationship may have important influence on cell cycle regulation and apoptosis process. Further research is needed to test these hypotheses and explore their specific mechanisms of action.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.