Background
Pancreas ductal adenocarcinoma (PDAC) is the most aggressive malignancy with the most dismal prognosis among all human cancers. The overall 5-year survival rate of PDAC patients is only 6%, and the median survival time for PDAC patients with locally advanced or metastatic disease, which accounts for over 80% of all human PDAC cases, is about 6–10 months [
1]. A major cause of this poor prognosis is lack of effective therapies as PDAC is highly resistant to chemotherapy, radiotherapy and immunotherapy [
2‐
4]. Gemcitabine has been, for years, the standard therapy for PDAC patients. However, gemcitabine only increases the survival rate of PDAC patients with advanced disease by a median duration of 5 weeks suggesting that human PDAC cells are either intrinsically resistant or acquire resistance to gemcitabine [
1,
5].
The host immune system plays an important role in pancreatic cancer growth control and progression [
4,
6‐
8]. Cancer immunotherapy has made clinically significant advances in the treatment of human cancers in the last few years. In addition to the first FDA-approved immune checkpoint cytotoxic T lymphocyte antigen-4 (CTLA-4) inhibitor, immune checkpoint programmed death-1 (PD-1) and programmed death-1 ligand-1 (PD-L1) blocking antibodies have been also recently approved for treatment of many types of human cancers. Since 2014, anti-PD-1 and anti-PD-L1 antibodies have been shown to induce objective responses in about 20–30% of cancer patients and many of these responses are durable [
9,
10]. However, PDAC stands out as one of the few cancers that do not respond to checkpoint immunotherapy [
10‐
15].
The anticipated consequence of all therapies, including chemotherapy, radiotherapy and immunotherapy, is induction of tumor apoptosis. The highly resistance nature of PDACs to various therapies suggests that the tumor cell intrinsic factor, likely the deregulated apoptosis pathway, rather than the therapeutic agents themselves, is one of the major mechanisms for the non-responsiveness of PDAC to these therapies. Therefore, identification of the deregulated apoptosis mediators and development of a targeted therapy that acts through a different mechanism of action than the currently existing therapeutic agents will have the potential to suppress PDAC growth or overcome PDAC resistance to current therapies.
It is well-known that genetic alterations [
16‐
21] in concert with inflammatory factors in the tumor microenvironment [
4,
7,
8] drive pancreatic cancer development. Recent studies, however, have shown that epigenetic changes also promote PDAC through aberrant gene expression patterns [
6,
22‐
25]. The methylation of N-terminal lysine residues in histones H3 and H4 plays a fundamental role in the regulation of gene expression through chromatin structure modulation. Histone methyltransferases (HMTase) catalyze the methylation of histones to modify chromatin structure, thereby influencing gene expression patterns during cellular differentiation and embryonic development [
26]. Recent studies have shown a critical role of aberrant HMTase expression in human cancers, including PDAC [
22‐
26]. Importantly, unlike genetic defects, which are permanent and non-reversible mutations in the DNA primary sequence of the cancer genome, epigenetic alterations, including histone methylation, is a reversible process that has made HMTases attractive as molecular targets for novel cancer therapies [
26‐
30]. Furthermore, most of current chemotherapeutic agents target the genetic program of cancer cells. Targeting HMTases may be an effective alternative therapeutic approach for PDACs that are refractory to therapies that target the tumor cell genetic program [
31‐
33].
In previous studies, we have developed the novel HMTase inhibitor verticillin A, which selectively inhibits six HMTases and suppresses 5-FU-resistant colon cancer growth [
34,
35]. Here, we showed that verticillin A inhibits HMTases to alter H3K9 and H3K4 methylation. Thereby, it regulates the expression of a number of apoptosis regulatory genes, including Mcl-1, FLIP, Bcl-x, Bak, Bax and Bim, effectively sensitizing human PDAC cells to gemcitabine. Our data suggest that targeting HMTase is an effective approach to alter the apoptosis-resistant phenotype of human PDAC and overcome their resistance to chemotherapy.
Methods
Human cancer cells
Human pancreatic cell lines MiaPaCa2 (Cat# CRL-1420), PANC1 (Cat# CRL-1469), CFPAC1 (Cat#CRL-1918) and SW1990 (CRL-2172) were obtained from American Type Culture Collection (ATCC, Manassas, VA). ATCC has characterized these cells by morphology, immunology, DNA fingerprint, and cytogenetics. De-identified human normal pancreas and pancreatic carcinoma tissues were obtained from Georgia Cancer Center tumor bank. The treatment history of these patients is not available. Normal pancreatic tissues were collected from the adjacent normal tissues of the tumor tissues. All studies with human specimens were carried out according to protocol (933148–1) approved by Augusta University Institutional Review Board.
Cell viability assays
Cell viability assays were performed using the MTT cell proliferation assay kit (ATCC, Manassas, VA) according to the manufacturer’s instructions.
Western blotting analysis
Western blotting analysis was performed as previously described [
36]. Cells were collected and lysed in cytosol buffer [10 mM Hepes, pH 7.4, 250 mM Sucrose, 70 mM KCl, 1.5 mM MgCl
2, 1 mM EDTA, 1 mM EGTA, protease and phosphatase inhibitor cocktails (Calbiochem, Billerica, MA), and 0.01% digitonin] for 10 min. The supernatant was collected as cytosol fraction. The pellet was then resuspended in mitochondria extraction buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 10mMMgCl
2, 2 mM EGTA, 2 mM EDTA, 1% NP40, and 10% glycerol), incubated on ice for 10 min and centrifuged at 13,000 RPM for 10 min. The supernatant was collected as organelle-enriched mitochondrial fraction. Tumor tissues and normal pancreatic tissues were homogenized in total lysis buffer (20 mM Hepes, pH 7.4, 20 mM NaCl, 1% glycerol, and 1% Triton x-100) with a tissue homogenizer. Cytosolic and mitochondrial fractions and total tissue lysate were resolved in 4–20% SDS polyacrylamide gel and analyzed by Western blotting. Sources of antibodies are: Bax, Mcl-1, FLIP, Bcl-x and cytochrome C: BD Biosciences (San Diego, CA); Bak, Bid, Bim, cleaved Caspase 8, cleaved Caspase 3, cleaved Caspase 9, and cleaved PARP: Cell Signaling Tech (Danvers, MA); H3K9me3 (Abcam, MA); β-actin: Sigma-Aldrich (St Luis, MO). Detailed antibody information is listed in Table
1.
H3K9Me3 | Abcam | ab8898 | WB,ChIP |
H3 | Cell signaling technology | 4499 | WB |
FLIPL | Cell signaling technology | 3210 | WB |
Mcl-1 | Santa Cruz | sc-819 | WB |
Bcl-2 | BD Biosciences | 610539 | WB |
Bcl-x | BD Biosciences | 610747 | WB |
Bax | Abcam | ab32503 | WB |
Bid | Cell signaling technology | 2002 | WB |
Bak | Upstate | 6536 | WB |
Bim | Cell signaling technology | 2933P | WB |
CoxIV | Cell signaling technology | 4844 | WB |
Cleaved caspase 8 | R&D system | AF705 | WB |
Cleaved caspase 9 | Cell signaling technology | 9501S | WB |
Cleaved caspase 3 | Cell signaling technology | 9661S | WB |
Cleaved PARP | Cell signaling technology | 9541S | WB |
Cytochrome C | BD Pharmingen | 556433 | WB |
β-actin | Sigma | A5441 | WB |
H3K4me3 | Cell signaling technology | 9751S | ChIP |
Analysis of H3K9 methylation
Verticilin A was isolated, purified and characterized as previously described [
37]. Cells were treated with verticillin A for 2 days and incubated in NETN buffer (20 mM Tris-HCl, pH 8, 150 mM NaCl, 5 mM EDTA, 0.5% NP40, 1.5 mM PMSF, 1.7μg/ml aprotinin, 1mN NaV, 0.5 mM NaF) containing protease inhibitor cocktails (Millipore) for 30 min, centrifuged at 13,000 RPM for 5 min, resuspended the detergent-insoluble pellet in 0.1 M HCl, incubated on ice for 30 min and centrifuge at 13,000 RPM for 10 min. Add 1 M Tris pH 9.0 into the supernatant then do Western Blotting analysis. The blot was probed with antibodies specific for H3K9me3 (Abcam) and anti-H3 (Cell Signaling) which was used as the normalization control.
Chromatin immunoprecipitation (ChIP) assay
ChIP assays were carried out as previously described [
6]. Briefly, cells were crosslinked and fixed and the sheared chromatin fragments were immunoprecipitated using anti-H3K9me3 (Abcam) and anti-H3K4me3 antibody (Cell Signaling). The gene-specific promoter DNA was detected by qPCR using promoter DNA-specific primers as listed in Table
2.
Table 2
PCR primer sequences
BCL-x-F | GCACAGCAGCAGTTTGGATGC |
BCL-x-B | GAGGATGTGGTGGAGCAGAGAAG |
MCL-1-F | TCCCTTTTCCTTGGACTGGTATC |
MCL1–1-B | GATGACCTTATGGCTCTGAGATGG |
FLIP-F | CGAGGCAAGATAAGCAAGGA |
FLIP-B | CACATGGAACAATTTCCAAGAA |
MIM-F | TCTGAGTGTGACCGAGAAGGTAGAC |
BIM-B | CCGATACGCCGCAACTCTTG |
BAK-F | TACCGCCATCAGCAGGAACAGGAG |
BAK-B | AAGCCCAGAAGAGCCACCACAC |
BAX-F | CCCCCGAGAGGTCTTTTTCC |
BAX-B | ATCCAGCCCAACAGCCGCTC |
BIM-ChIP-F | GAGGAGGGACGGGGTATTTTG |
BIM-ChIP-B | TGCTGGGCTCGCAGATAACC |
BAX-ChIP-F | CCTGCCCGAAACTTCTAAAAATGG |
BAX-ChIP-B | CCAATGAGCATCTCCCGATAAG |
BAK1-ChIP-F | CCCCAATGCGACTACAGAACTG |
BAK1-ChIP-B | AGGCAGGAGAATCCCTTGAACC |
MCL1-ChIP-F | AACTTCCCCGTCCTCTTCCTTC |
MCL-ChIP-B | TTCTCGTGGCTACCTCTGTGCTTC |
FLIP-ChIP-F | CCGACGAGTCTCAACTAAAAGGG |
FLIP-ChIP-B | AAAGAAACCGAAAGCCTGGAAG |
BCL-x-ChIP-F | CTCTCCCGACCTGTGATACAAAAG |
BCL-x-ChIP-B | CACCTACATTCAAATCCGCCTTAG |
Gene expression analysis
Normal human pancreas tissues and human pancreatic tumor tissues were homogenized using a tissue homogenizer in Trizol (Life Technologies) to isolate total RNA. cDNA was synthesized from total RNA and used for analysis of gene expression using gene-specific primers (Table
2) in the StepOne Plus Real-Time PCR System (Applied Biosystems). β-actin was used as an internal control.
Discussion
Gemcitabine is a nucleotide analog that is rapidly metabolized to the active triphosphate form of gemcitabine (2′, 2′-difluoro-2′-deoxycytidine triphosphate, or dFdCTP) once inside the cells. dFdCTP is then incorporated into DNA to stop DNA synthesis by a process known as masked chain termination [
41,
42]. Although many cellular responses to dFdCTP incorporation are known, the downstream pathways leading to tumor cell death are largely unknown [
43]. However, it has been well-documented that gemcitabine activates caspase-dependent apoptosis signaling pathways in tumor cells [
5,
43]. Gemcitabine has been the standard adjuvant therapy for PDAC for the last two decades, but tumor cells are either intrinsically resistant to gemcitabine or develop acquired resistance to gemcitabine within weeks of chemotherapy initiation [
1,
5,
21]. To overcome PDAC resistance to gemcitabine, nabpaclitaxel, and the folic acid, fluorouracil, irinotecan, and oxaliplatin (FOLFIRINOX) have been combined with gemcitabine and this combined protocol has shown some improvement in efficacy and survival time compared to gemcitabine alone. Unfortunately, the disease still rapidly advances [
1,
5,
25]. Furthermore, although targeted therapies, either alone or in combination with gemcitabine, generate responsiveness in some PDAC patients, the majority of PDAC patients do not respond to targeted therapies or rapidly acquire resistance during therapy [
44]. In this study, we observed that the HMTase inhibitor verticillin A dramatically suppresses human PDAC growth. More interestingly, a sublethal dose of verticillin A effectively overcame human PDAC cell resistance to gemcitabine. Verticillin A is a selective HMTase inhibitor that inhibits SUV39H1, SUV39H2, G9a, GLP, NSD2 and MLL1 [
35]. These observations suggest that human PDAC cells use deregulation of HMTase to acquire a chemoresistant phenotype.
Verticillin A inhibits PDAC growth at least in part through activating the intrinsic apoptosis pathway as it alters the levels of a panel of apoptosis regulatory genes, mainly the pro-apoptotic Bak, Bax and Bim and the anti-apoptotic Bcl-x, Mcl-1 and FLIP, in human PDAC cells. All these six apoptosis regulatory genes are known to be involved in PDAC growth and progression [
45‐
49]. Analysis of PDAC tissues from human patients revealed that Bak, Bax and Bim are significantly down-regulated, whereas Bcl-x, FLIP and Mcl-1 are notably up-regulated as compared to normal human pancreas tissues. Therefore, it seems that human PDAC cells deregulate multiple apoptosis regulators to confer an apoptosis-resistant phenotype, which may explain the potency of verticillin A in inhibition of PDAC cell growth and in sensitization of tumor cells to gemcitabine-induced growth suppression since it targets all these deregulated genes in the tumor cells. Various inhibitors that selectively target individual apoptosis regulators have been developed and tested in suppression of PDAC growth and progression and show efficacy [
45‐
49]. In light of the observations that multiple apoptosis mediators are deregulated in human PDAC and that the HMTase inhibitor verticillin A simultaneously targets these deregulated apoptosis regulators, it seems that an epigenetic HMTase inhibitors may have an advantage over these selective agents targeting a single apoptosis regulator.
SUV39H1 and SUV39H2 catalyze H3K9me3 [
50]. G9a and GLP form a complex to catalyze H3K9Me1 and H3K9Me2 [
51]. NSD2 mediates H3K36Me2 [
52], and MLL1 catalyzes H3K4me3 [
53]. H3K9me3 is often associated with a transcriptionally repressive chromatin and H3K4me3 is often linked to a transcriptionally active chromatin. Consistent with their functions in gene transcription regulation, we observed that verticillin A inhibited H3K9me3 at the
BAK1,
BAX and
BCL2L11 promoter chromatin, and H3K4me3 at the
BCL2L1,
CFLAR and
MCL-1 promoter chromatin in human PDAC cells. Furthermore, inhibition of H3K9me3 resulted in elevated Bak, Bax and Bim expression level and inhibition of H3K4me3 led to decreased Bcl-x, FLIP and Mcl-1 expression levels in the tumor cells. These observations suggest that PDAC cells use H3K4me3 to increase Bcl-x, FLIP and Mcl-1 expression while using H3K9me3 to silence Bak, Bax and Bim expression, which results in an overall stable apoptosis-resistant phenotype that confers PDAC cell resistance to gemcitabine.
Acknowledgements
We thank Dr. Roni Bollag at Georgia Cancer Center tumor bank for providing human pancreatic tumor specimens.