Background
Methods
Patients
COX-2 expression in tumor tissue | ||
---|---|---|
High (10) | Low (10) | |
COX-2 T | 12.5 ± 1.5 | 2.6 ± 0.4 |
(mol/mol GAPDH) NM | 5.06 ± 3.0 | 12.3 ± 4.0 |
Dukes1
| 3 A, 6 B, 1 D | 3 B, 5 C, 2 D |
Age at surgery | 71 ± 2.5 | 73 ± 3.4 |
Gender | 6 M, 4 F | 4 M, 6 F |
Postoperative survival (months) | 23 ± 5.8 | 29 ± 8.0 |
Right/left colon | 4/6 | 4/6 |
RNA and DNA extraction
Gene expression analysis
DNA methylation analysis with bisulfite sequencing
Tag | Primer Sequence (5'-3') | Bp | |
---|---|---|---|
1 | FP1692 |
CCACTCACTCACCCACCCGAAGAAGAAAAGATATTTGG | 448 |
1 | RP2104 |
GGGTGGGAGGTGGGAGGGATAAACTTTACTATCTAAAA | |
2 | B1(1595) |
CCACTCACTCACCCACCCTTGGAGAGGAAGTTAAGTGTTT | 223 |
2 | b1(1782) |
GGGTGGGAGGTGGGAGGGATCCCCACTCTCCTATCTAAT |
Statistics
Results
COX-2 expression
Gene | ↑/↓ | FC | Function | Gene Symbol (GeneID) |
---|---|---|---|---|
Matrix metallopeptidase 7 |
↑
| 110 | Breakdown of extracellular matrix, metastasis | MMP7 (4316) |
Keratin 23 |
↑
| 77 | Structural integrity of epithelial cells | KRT23 (25984) |
Myosin |
↑
| 63 | Muscle, heavy polypeptide 2 | MYH2 (4620) |
Claudin 1 |
↑
| 38 | Integral membrane protein, component of tight junction strands | CLDN1 (9076) |
Actin α1, skeletal |
↑
| 36 | Cell motility, structure and integrity | ACTA1 (58) |
Forkhead box Q1 |
↑
| 34 | Transcription factor (i.e. TGF-beta2) | FOXQ1 (94234) |
Proprotein convertase subtilisin/kexin type 1 |
↑
| 22 | Regulating insulin biosynthesis, obesity, activate precursor protein, associated with carcinoid tumors | PCSK1 (5122) |
Sarcolipin |
↑
| 25 | Regulates several sarcoplasmic reticulum Ca(2+)-ATPases | SLN (6588) |
Matrix metallopeptidase 1 |
↑
| 14 | Breakdown of extracellular matrix, metastasis | MMP1 (4312) |
Myosin, cardiac, beta |
↑
| 25 | Heavy chain, also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers | MYH7 (4625) |
Hydroxy-δ-5-steroid dehydrogenase |
↓
| 79 | Biosynthesis of steroid hormones, polymorphisms related to prostate cancer | HSD3B2 (3284) |
Hydroxy-δ-5-steroid dehydrogenase |
↓
| 30 | Biosynthesis of steroid hormones, diagnostic trophoblastic marker | HSD3B1 (3283) |
similar to 3 β-hydroxysteroid dehydrogenase |
↓
| 28 | Pseudogene | LOC391081 (391081) |
- |
↓
| 24 | unknown | CR627415 |
Butyrylcholinesterase |
↓
| 21 | Homozygoutics sustain prolonged apnea after administration of the muscle relaxant suxamethonium | BCHE (590) |
Neuronal pentraxin |
↓
| 19 | Excitatory synapse remodelling, mediate neuronal death induced by reduction in neuronal activity in mature neurons | NPTX1 (4884) |
Dipeptidyl-peptidase 6 |
↓
| 18 | Binds and alters specific voltage-gated potassium channels expression and biophysical properties | DPP6 (1804) |
ATP-binding cassette, sub-family G |
↓
| 17 | Breast cancer resistance protein, xenobiotic transporter may play a major role in multi-drug resistance | ABCG2 (9429) |
Insulin like-5 |
↓
| 17 | Relaxin/Insulin family, ligand for GPCR142 | INSL5 (10022) |
Regenerating islet-derived 1 β |
↓
| 16 | Highly similar to REG1A protein (islet cell regeneration and diabetogenesis) | REG1B (5968) |
Gene | ↑/↓ | FC | Function | Gene Symbol (GeneID) |
---|---|---|---|---|
Unknown |
↑
| 156 | unknown | W60781 |
Myosin |
↑
| 107 | Muscle, heavy polypeptide 2 | MYH2 (4620) |
Desmin |
↑
| 49 | Muscle filament | DES (1674) |
Creatine kinase |
↑
| 46 | Muscle, energy homeostasis, serum marker for myocardial infarction | CKM (1158) |
Troponin T type 3 |
↑
| 41 | Skeletal | TNNT3 (7140) |
Actin α, cardiac |
↑
| 37 | Muscle, contractile, cell motility | ACTC1 (70) |
Actin α1, skeletal |
↑
| 35 | Cell motility, structure and integrity | ACTA1 (58) |
Synaptopodin 2 |
↑
| 28 | Cell-shape regulation, homolog with Myopodin (a tumor suppressor; inhibits growth and metastasis) | SYNPO2 (171024) |
Nebulin |
↑
| 25 | Cytoskeletal matrix | NEB (4703) |
Calponin |
↑
| 23 | Differentiation marker, reduced in tumor vessels associated with tumor progression | CNN1 (1264) |
Growth diff. factor 10 |
↓
| 28 | Regulation of cell growth and differentiation | GDF10 (2662) |
Unc-13 homolog A |
↓
| 19 | diacylglycerol and phorbol ester receptors, essential role in synaptic vesicle priming | UNC13A (23025) |
LOC553137 |
↓
| 16 | miscRNA, unknown function | LOC553137 (553137) |
Melanoma antigen family B, 2 |
↓
| 14 | Tumor-associated antigen, expressed only in testis and tumors, regulated by demethylation | MAGEB2 (4113) |
Chondrosarcoma associated gene 1 |
↓
| 13 | Tumor antigen, expressed in testis and in chondrosarcomas | CSAG1 (158511) |
Folate receptor 1 |
↓
| 13 | Involvement in cancer prognosis | FOLR1 (2348) |
Renin |
↓
| 13 | Blood pressure and electrolyte balance | REN (5972) |
Small proline-rich protein 3 |
↓
| 12 | Epithelial homeostatis, aberrant expression contribute to tumorigenesis of esophageal squamous cell carcinoma | SPRR3 (6707) |
Heat shock 27kDa protein 3 |
↓
| 12 | Muscle | HSPB3 (8988) |
Chromogranin B |
↓
| 11 | Precursor for biological active peptides, involved early in breast cancer | CHGB (1114) |
Gene | ↑/↓ | FC | Function | Gene Symbol (GeneID) |
---|---|---|---|---|
Pancreatic derived factor (PANDER) |
↑
| 79 | Cytokine, induces apoptosis of alpha and beta cells, implicated in diabetes | FAM3B (54097) |
Regenerating islet-derived 1 α |
↑
| 40 | Secreted by the exocrine pancreas, associated with islet cell regeneration and diabetogenesis | REG1A (5967) |
Ribosomal protein S4, Y-linked 2 |
↑
| 40 | Translation | RPS4Y2 (140032) |
Serpin peptidase inhibitor, ovalbumin |
↑
| 35 | Cytoprotective, cell survival factor, monocyte regulation, potential cancer marker (elevated in plasma) | SERPINB2 (5055) |
Nitric oxide synthase 2, inducible |
↑
| 19 | reactive free radical, biologic mediator in several processes, incl. neurotransmission, antimicrobial and antitumoral activities | NOS2A (4843) |
Pentraxin-related gene |
↑
| 16 | Immune response, inflammation, rapidly induced by IL-1β | PTX3 (5806) |
Regenerating islet-derived 1 β |
↑
| 16 | highly similar to REG1A protein | REG1B (5968) |
Hydroxy-delta-5-steroid dehydrogenase |
↑
| 10 | Biosynthesis of steroid hormones, polymorphisms related to prostate cancer | HSD3B2 (3284) |
Hydroxy-delta-5-steroid dehydrogenase |
↑
| 10 | Biosynthesis of steroid hormones, diagnostic trophoblastic marker | HSD3B1 (3283) |
ADAM metallopeptidase |
↑
| 10 | cleavage of proteoglycans, control of organ shape during development, and inhibition of angiogenesis | ADAMTS9 (56999) |
Unknown |
↓
| 15 | unknown | ENST00000343 |
6-phosphofructo-2-kinase |
↓
| 13 | Produce fructose 2,6-P(2), involved in Warburg effect | PFKFB3 (5209) |
hemoglobin, γ A |
↓
| 8 | Normally expressed in the fetal liver, spleen and bone marrow | HBG1 (3047) |
matrix metallopeptidase 7 |
↓
| 8 | Breakdown of extracellular matrix, metastasis | MMP7 (4316) |
Fc receptor-like 4 |
↓
| 7 | Immune regulation | FCRL4 (83417) |
Chemokine receptor 5 |
↓
| 6 | B cell migration and localization | BLR1 (643) |
Fibroblast growth factor 5 |
↓
| 6 | Mitogenic and cell survival activities, involved in a variety of biological processes, incl. cell growth, morphogenesis, tissue repair, tumor growth and invasion, oncogene | FGF5 (2250) |
Family with sequence similarity 129, member C |
↓
| 6 | B-cell novel protein, BCNP1 completely unknown protein with 3 predicted transmembrane domains | FAM129C (199786) |
selectin L |
↓
| 6 | Leukocyte-endothelial cell interactions | SELL (6402) |
Zinc finger protein |
↓
| 5 | DNA binding | ZNF683 (257101) |
Transcription factors
Gene | Product | FC 1.5 | FC 2.0 | FC 3.0 | Referencea
|
---|---|---|---|---|---|
TFAP2C | AP-2γ |
↓
|
-
| - | [12] |
TFAP2E | AP-2ε |
-
|
-
| - | [12] |
ATF1 | ATF1 |
-
|
-
| - | [13] |
ATF2 | ATF2/CREB2 |
-
|
-
| - | [13] |
ATF3 | ATF3/AP1 |
↑
|
-
| - | [13] |
BATF | B-ATF |
-
|
-
| - | [13] |
CREBBP | CBP/p300 co-activator |
-
|
-
| - | [12] |
CDX2 | CDX2 |
↓
|
-
| - | [29] |
CEBPA | C/EBP-α |
-
|
-
| - | [13] |
CEBPB | C/EBP-β |
-
|
-
| - | [13] |
CEBPD | C/EBP-δ |
↑
|
↑
| - | [13] |
CREB5 | CRE-BPA |
-
|
-
| - | [13] |
CREB1 | CREB |
-
|
-
| - | [13] |
ELK1 | Elk-1 |
↓
|
-
| - | [13] |
FOS | c-Fos/AP1 |
↑
|
-
| - | [12] |
FOSB | Fos-B/AP1 |
↑
|
↑
|
↑
| [12] |
FOSL1 | Fra-1/AP1 |
-
|
-
| - | [12] |
FOSL2 | Fra-2/AP1 |
-
|
-
| - | [12] |
DNAJC12 | JDP1 |
-
|
-
| - | [12] |
JDP2 | JDP2 |
↑
|
-
| - | [12] |
JUN | Jun/AP1 |
-
|
-
| - | [12] |
JUNB | JunB/AP1 |
-
|
-
| - | [12] |
JUND | JunD/AP1 |
↑
|
-
| - | [12] |
MAF | c-Maf/AP1 |
↑
|
↑
| - | [12] |
NFATC1 | NFATc1/NFAT2 |
-
|
-
| - | [12] |
NFATC4 | NFAT3 |
-
|
-
| - | [12] |
NFATC3 | NFAT4 |
-
|
-
| - | [12] |
NFAT5 | NFAT5 |
-
|
-
| - | [12] |
NFKB1 | NF-κB, p105/p50 |
-
|
-
| - | |
NFKB2 | NF-κB, p100 |
-
|
-
| - | |
RELA | NF-κB, RelA (p65) |
-
|
-
| - | |
RELB | NF-κB, RelB |
-
|
-
| - | |
REL | NF-κB, c-Rel |
-
|
-
| - | |
NFKBIA | NF-κB, IκBα |
↑
|
↑
| - | |
NFKBIB | NF-κB, IκBβ |
-
|
-
| - | |
NFKBIE | NF-κB, IκBε |
-
|
-
| - | |
CHUK | NF-κB, IKK-α |
-
|
-
| - | |
IKBKB | NF-κB, IKK-β |
-
|
-
| - | |
IKBKG | NF-κB, IKK-γ |
-
|
-
| - | |
TP53 | p53 |
↓
|
↓
| - | [30] |
ETV4 | PEA3 |
↓
|
-
| - | [13] |
PPARA | PPARα |
-
|
-
| - | [12] |
PPARD | PPARβ/δ |
-
|
-
| - | [12] |
PPARG | PPARγ |
-
|
-
| - | [12] |
SP1 | SP-1 |
-
|
-
| - | [12] |
TBP | TATA-binding protein |
-
|
-
| - | [12] |
TCF4 | TCF4 |
↑
|
↑
| - | [13] |
External factors
Gene | Product | FC 1.5 | FC 2.0 | FC 3.0 | Referencea
|
---|---|---|---|---|---|
DNMT1 | DNA MTase 1 |
-
| - | - | [26] |
DNMT3A | DNA MTase 3A |
↑
|
↑
| - | [26] |
DNMT3B | DNA MTase 3B |
-
| - | - | [26] |
MDM2 | hdm2 |
-
| - | - | [30] |
HPGD | HPGD |
-
| - | - | [1] |
HNRPD | HuR |
-
| - | - | [31] |
IL1B | IL1b |
↑
|
↑
| - | |
IL6 | IL6 |
↑
|
↑
|
↑
| [34] |
IL6R | IL6 receptor |
↑
| - | - | [34] |
NOS2A | iNOS |
-
| - | - | [13] |
MAPK14 | p38 MAPK |
-
| - | - | [35] |
PTGES | mPGES-1 |
-
| - | - | [1] |
PRKCB1 | Protein kinas Cβ1 |
↑
|
↑
|
↑
| [12] |
RALA | Ras family (oncogene) |
-
| - | - | [12] |
RASA4 | Ras p21 protein activator |
-
| - | - | [12] |
RASSF1 | Ras ass. (tumor supr.) |
-
| - | - | [12] |
RIN2 | Ras and Rab interact. 2 |
-
| - | - | [12] |
TINP1 | TGF-β |
-
| - | - | [13] |
TNF | TNF-α |
↑
| - | - | [13] |
Gene | Product | FC 1.5 | FC 2.0 | FC 3.0 |
---|---|---|---|---|
PTGS2 | COX-2 |
↑
|
↑
|
↑
|
Transcription | ||||
ATF3 | ATF3/AP1 |
↑
| - | - |
CEBPD | C/EBP-δ |
↑
|
↑
| - |
CREB1 | CREB |
↑
|
-
| - |
FOSB | Fos-B/AP1 |
↑
|
↑
| - |
DNAJC12 | JDP1 |
↑
|
-
| - |
NFATC1 | NFATc1/NFAT2 |
↓
| - | - |
PPARG | PPARγ |
↓
| - | - |
BATF | B-ATF |
↓
| - | - |
External cell factors | ||||
IL1B | IL1b |
↑
|
↑
|
↑
|
IL6 | IL6 |
↑
|
↑
|
↑
|
NOS2A | iNOS |
↑
|
↑
|
↑
|
Pathway analysis
CARD 11 | TRA@ | IL6 | IL1B | AKT1 | ||||||
---|---|---|---|---|---|---|---|---|---|---|
High COX-2 (9) | Low COX-2 (9) | High COX-2 (9) | Low COX-2 (9) | High COX-2 (9) | Low COX-2 (9) | High COX-2 (9) | Low COX-2 (9) | High COX-2 (9) | Low COX-2 (9) | |
Mean | 0.40 ± 0.08 | 0.42 ± 0.24 | 2.87 ± 0.63 | 0.55 ± 0.14 | 1.97 ± 0.79 | 0.09 ± 0.03 | 1.61 ± 0.49 | 0.27 ± 0.06 | 1.09 ± 0.13 | 0.62 ± 0.07 |
Median | 0.39 | 0.07 | 3.12 | 0.44 | 0.87 | 0.05 | 1.01 | 0.21 | 0.96 | 0.59 |
Variance | 0.06 | 0.50 | 3.57 | 0.18 | 5.65 | 0.008 | 2.16 | 0.04 | 0.14 | 0.04 |
P-value* | ns | 0.002 | 0.03 | 0.02 | 0.005 |