1 Background
Oral squamous cell carcinoma (OSCC) is the most frequent type of head and neck squamous cell carcinoma (HNSCC). Despite the fact that multiple treatments are available for OSCC patients, the 5-year survival rate is less than 50% [
1,
2]. The main causes of the poor prognosis are local invasion, recurrence, and lymph node metastasis of OSCC [
3]. A thorough understanding of the underlying mechanisms of OSCC invasion and metastasis would facilitate the identification of new targets and therapies for OSCC patients.
The tumor microenvironment (TME) is a highly heterogeneous ecosystem that typically contains a collection of tumor cell populations, immune cells, tissue-specific resident cells and recruited stromal cells [
4]. The development and progression of cancers are closely related to the tumor immune microenvironment (TIM). Tumor-associated macrophages (TAMs), the largest population of immune cells in the TIM, display two major phenotypes, M1 and M2 [
5]. TAMs are predominantly the M2 macrophages, which promote cancer progression. In contrast, M1 macrophages exert an antitumor effect [
6‐
8]. Recently, the link between TAMs and OSCC progression has also been uncovered [
9]. Macrophages may represent potential therapeutic targets for OSCC.
At present, crosstalk between cancer cells and macrophages plays an important role in tumor progression. A previous study showed that hepatocellular progression was facilitated by crosstalk between macrophage-derived PGE and tumor UHRF1 [
10]. HNSCC cells polarized monocytes into M2-like macrophages resulting in the promotion of HNSCC cell migration via the secretion of epithelial growth factor (EGF) [
11]. In the OSCC microenvironment, OSCC cells secrete cytokines or chemokines to regulate the activities of macrophages [
12,
13]. Infiltrated macrophages also interact with cancer cells to promote tumor progression in a paracrine manner [
14,
15]. For example, TAMs promote OSCC cell invasion and metastasis via the secretion of CCL13 [
16]. Moreover, macrophage-derived epithelial growth factor (EGF) induces OSCC migration and invasion via epithelial growth factor receptor (EGFR), and EGF has been linked with poor patient prognosis [
17]. However, the underlying mechanism by which the crosstalk between macrophages and OSCC cells accelerates metastasis of OSCC remains unclear.
Tumor-derived CXCL1 plays an important role in migration and invasion by influencing the polarization of macrophages [
18,
19]. Many previous studies have indicated that CXCL1 is highly expressed in the vast majority of OSCC cell lines and closely associated with OSCC invasion and metastasis [
20‐
23], but the roles of tumor cell-secreted CXCL1 in the aggressiveness of OSCC have not been fully elucidated. Colorectal cancer cell-derived CXCL1 promotes the secretion of epithelial growth factor (EGF) in an autocrine manner by binding to CXCR2 in colorectal cancer cells [
24]. CXCR2 has also been found in infiltrated macrophages in OSCC, prostate cancer, and hepatocellular carcinoma [
25‐
27]. Whether OSCC cell-derived CXCL1 regulates the secretion of EGF via CXCR2 on the membrane of macrophages and further promotes OSCC progression needs to be determined.
It is crucial to find new therapeutic strategies and improve the clinical outcome of OSCC patients by completely understanding the molecular mechanism driving the interaction between tumor cells and macrophages. Our research demonstrated that OSCC cell-derived CXCL1 can stimulate the secretion of EGF via CXCR2 on the macrophage surface, and EGF significantly activates NF-κB signaling and promotes the migration and invasion of OSCC cells. Targeting CXCL1/CXCR2 or EGF/EGFR signaling might be a promising therapeutic approach to suppress OSCC progression and metastasis.
2 Materials and methods
2.1 Cell culture
The human oral tongue squamous carcinoma cell line Cal27, human epidermal keratinocyte cell line Hacat, and mouse acute monocytic leukemia cell line RAW264.7 were purchased from the China Center for Type Culture Collection. All of the cell lines were cultured in Dulbecco's modified Eagle's medium (VivaCell; Shanghai; China) with 10% fetal bovine serum (VivaCell; Shanghai; China), 100 U/ml penicillin, and 100 μg/ml streptomycin in a humidified 5% CO2 atmosphere at 37 °C.
2.2 Reagents
Recombinant human CXCL1 and recombinant mouse EGF were purchased from R&D Systems Inc. (cat. no. 275-GR) and Abcam (cat. no. ab206643), respectively. AG1478 and SB225002 were purchased from Selleck Biotechnology Co., Ltd. (cat. no. S2728; cat. no. S7651). The antibodies used included rabbit anti-β-actin (cat. no. ab115777; Abcam), rabbit anti-E-cadherin (cat. no. ab40772 Abcam), rabbit anti-N-cadherin (cat. no. ab76011 Abcam), rabbit anti-CXCL1 (cat. no. ab206411 Abcam), rabbit anti-total EGFR (Zen Bio Science Co., Ltd), rabbit anti-phospho-EGFR (cat. no. R24173; Zen Bio Science Co., Ltd), rabbit anti-total P65 (cat. no. R25149; Zen Bio Science Co., Ltd), and rabbit anti-phospho-P65 (cat. no. 310013; Zen Bio Science Co., Ltd). DyLight 488 (A23220) and 800 (A23920) were purchased from Abbkine Scientific Co., Ltd. Anti-mouse PE CD86 (12-0862-81) and anti-mouse APC CD206 (17–2061-80) were purchased from Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA. The anti-CXCL1 (YT2074) antibody for immunohistochemical staining was obtained from Immunoway, USA. The secondary antibody kit (GK600705) for IHC was purchased from Gene Tech, Shanghai, China.
2.3 Tumor- and TAM-conditioned medium preparation
Cancer cell lines were cultured in complete medium, and the medium was replaced by serum-free medium when the cell density reached approximately 90%. After 48 h, the conditioned medium (CM) was harvested, centrifuged at 2000×g for 10 min, filtered through 0.22 mm filters, and stored at 80 °C. Regarding TAM-conditioned medium, Raw264.7 cells were stimulated with tumor-conditioned medium for 48 h, and then serum-free medium replaced the conditioned medium. After 24 h, the conditioned medium (CM) was harvested, centrifuged at 2000×g for 10 min, filtered through 0.22 mm filters, and stored at 80 °C. Tumor- or TAM-conditioned medium was defined as TCM or TAM-CM.
2.4 Immunohistochemistry (IHC)
Five healthy tissues and ten OSCC tissues were obtained from the Department of Oral Pathology of China Medical University. Human participants were not included in the study. Both healthy tissues and OSCC tissues were obtained using the paraffin-embedded method. Immunostaining was performed using the avidin–biotin-peroxidase method. Sections were stained using primary anti-CXCL1 (1:100) antibody. Then, a secondary antibody kit was used. Finally, sections were stained with Mayer’s hematoxylin, and sections were observed using a light microscope (Nikon Eclipse Ts2R, Japan).
2.5 Chemotactic migration and Matrigel invasion assays
For assessment of tumor cell migration, tumor cells (1 × 105) in 200 μl of serum-deprived medium were cultured in the upper chamber, and conditioned medium from macrophages stimulated with TCM or TCM and CXCL1 (100 ng/ml); TAM supernatant containing EGF (100 ng/ml) or EGF (100 ng/ml) and AG1478 (5 μM) with 10% FBS was added to the lower chamber. Moreover, cell invasion was assessed using a Transwell chamber (pore size 8 mm, Jet Biofil; Guangzhou; China) with Matrigel coating (BD Biosciences). For chemotactic migration and invasion, the non-migrated cells were removed from the surface of the upper chamber after 24 h, while after 48 h, the noninvasive cells were also scraped. The representative migrated or invaded cells were treated with 4% paraformaldehyde (product no. P0099; Beyotime Institute of Biotechnology) for 20 min and then with 0.5% crystal violet (product no. C0121; Beyotime Institute of Biotechnology) for 15 min. Cells were counted using a light microscope (Nikon Eclipse Ts2R, Japan) and analyzed by ImageJ software (National Institutes of Health, Bethesda, MD, USA).
2.6 Scratch wound healing assay
Cell migration ability was assessed in vitro by wound healing. Cal27 cells (1 × 10^6/well) were seeded in 6-well plates treated with conditioned medium from macrophages stimulated with TCM or TCM and CXCL1 (100 ng/ml) or TAM-CM including EGF (100 ng/ml) or EGF and AG1478 (5 μM). After the tumor cells were grown to confluency, a scratch was created with a 200 µl pipette tip. Then, PBS was used to wash the plates several times. The plates were incubated for 24 h, and the tumor cells that migrated to heal the artificial wound were photographed with a light microscope (Nikon Eclipse Ts2R, Japan) and assessed with ImageJ software. The healing rate was calculated as (%) = (initial average scratch area − average scratch area at 24 h)/initial average scratch area × 100%.
2.7 Real-time PCR (RT‒PCR)
RT‒PCR was used to measure the gene expression levels of CD206, CD86, Arg-1, EGF, CXCL1, cell transfection- and EMT-related markers in Raw264.7 cells and Cal27 cells. Total RNA was isolated by TRIzol Reagent (Takara Bio, Inc., Otsu, Japan), and extracted RNA was reversed transcribed by PrimeScript RT (Takara Bio, Inc., RR036A, Otsu, Japan). RT‒qPCR was performed using the SYBR Premix® Ex TaqTM Kit (Takara Bio, Inc, RR820A, Otsu, Japan) with the 7500 Fast System (Thermo Fisher Scientific). RT‒qPCR thermocycling conditions were as follows: 40 cycles of 95 °C for 30 s, 95 °C for 5 s, 60 °C for 34 s, 95 °C for 15 s, 60 °C for 60 s and 95 °C for 15 s. The internal control of the experiment was β-actin. Primers for β‑actin, CXCL1, EGF, E-cadherin, N-cadherin, Vimentin, CD206, CD86, and Arg-1 were obtained from Shanghai Sheng gong Biological Technology Co., Ltd. All primer sequences are shown in Table
1.
Table 1
Primers used for RT‒PCR
E-Cadherin | CCTGGGACTCCACCTACAGAA | AGGAGTTGGGAAATGTGAGC |
N-Cadherin | AACAGCAACGACGGGTTAGT | CAGACACGGTTGCAGTTGAC |
Vimentin | AGGCGAGGAGAGCAGGATTT | AGTGGGTATCAACCAGAGGGA |
CXCL1 | AAGAACATCCAAAGTGTGAACG | CACTGTTCAGCATCTTTTCGAT |
EGF | CATCATGGTGGTGGCTGTCTGC | CTCACACTTCCGCTTGGCTCAC |
CD86 | ACGGAGTCAATGAAGATTTCCT | GATTCGGCTTCTTGTGACATAC |
CD206 | CTCTGTTCAGCTATTGGACGC | CGGAATTTCTGGGATTCAGCTC |
Arg-1 | CATTGGCTTGCGAGACGTAGAC | GCTGAAGGTCTCTTCCATCAC |
β-actin | GTGCTATGTTGCTCTAGACTTCG | ATGCCACAGGATTCCATACC |
2.8 Western blot analysis
Cal27 cells were washed with PBS and then lysed using RIPA buffer (product no. P0013B; Beyotime Institute of Biotechnology) including 1 mM PMSF (Product no. ST507; Beyotime Institute of Biotechnology) to extract total proteins. Next, the protein concentration was determined by a BCA protein assay kit (product no. P0012s; Beyotime Institute of Biotechnology). Total proteins were separated using 10% or 12% SDS‒PAGE, and electrophoresis was run at 150 V. The separated proteins were transferred to a PVDF membrane at 220 mA. The PVDF membrane was incubated with 5% nonfat dry milk at room temperature for 1 h to block the immunoblots and probed at 4 °C overnight with specific primary antibodies, including rabbit anti-β-actin (1:2000), rabbit anti-CXCL1 (1:1000), rabbit anti-E-cadherin (1:1000), rabbit anti-N-cadherin (1:1000), rabbit anti-total EGFR (1:1000), rabbit anti-phospho-EGFR (1:1000), rabbit anti-total P65 (1:1000), and rabbit anti-phospho-P65 (1:500). Then, the membranes were incubated with the secondary anti-rabbit antibody DyLight 800 goat anti-rabbit IgG (1:2000) at room temperature for 1 h. The gray values of the bands were analyzed by Odyssey CLX (LI-COR, Lincoln, NE, USA) and ImageJ software (National Institutes of Health, Bethesda, MD, USA).
2.9 Enzyme-linked immunosorbent assay (ELISA)
Measurement of EGF and CXCL1 levels in the supernatant of the TAMs and Cal27 cells was conducted using mouse EGF ELISA kits (BOSTER Biological Technology Co. Ltd., Wuhan, China; EK0326) and human CXCL1 ELISA kits (R&D Systems Inc., Minneapolis, MN, USA; cat. no. #DY275), respectively. For the standard solution or sample, 100 μl/well was added to the 96-well containing specific antibody incubated at room temperature for 2 h. After washing three times with 300 μl diluted washing buffer, each well was incubated with the diluted HRP conjugate at room temperature for 1 h. Then, the diluted washing buffer was used to wash each well three times. Each well was incubated with 100 µl chromogenic substrate in the dark for 30 min. Finally, 90 μl stop solution was added to every well, and the absorbance of each well was measured by a microplate reader at 450 nm. By constructing a standard curve, the results of the sample solution were obtained.
2.10 Immunofluorescence
The Cal27 cells were treated with 0.5% Triton solution for 10 min. PBS was used to wash the Cal27 cells three times. Then, the Cal27 cells were incubated with primary antibodies against one of the EMT markers (E-cadherin) at 4 °C overnight. The cells were washed three times with PBS again. The cells were incubated with the corresponding secondary anti-rabbit antibodies with DyLight 488 (1:200) at room temperature for 1 h. Finally, the cells were counterstained with DAPI at room temperature for 10 min. Moreover, tissue sections were incubated using primary anti-CXCL1 (1:100) antibody. Then, a secondary antibody kit was used. The staining was observed and photographed with a fluorescence microscope (Nikon Eclipse Ts2R, Japan).
2.11 Cell proliferation assay
The rate of cell proliferation was determined using a Cell Counting Kit-8 assay (product no. C0038; Beyotime Institute of Biotechnology) according to the manufacturer’s instructions. Cal27 cells were plated in 96-well plates at a ratio of 3 × 10^3/well. Then, the cells were incubated in TAM-CM with EGF (100 ng/ml) or EGF (100 ng/ml) and AG1478 (5 μM) for 24 and 48 h. Ten microliters of CCK-8 solution was added to every well, and the cells were cultured at 37 °C for 1 h. The absorbance of each well was measured at 450 nm (Tecan Mechelen, Belgium).
Cal27 cells were cultured in 6-well plates at a ratio of 1 × 10^3/well and stimulated with TAM-CM containing EGF (100 ng/ml) or EGF (100 ng/ml) and AG1478 (5 μM) for 2 weeks. The incubation medium was replaced every two days. Subsequently, the cells were treated with 4% paraformaldehyde and then with 0.5% crystal violet for 30 min, and colonies were counted with a light microscope.
2.13 Transfection of Cal27 cells
Cal27 cells (1 × 10^5/well) were seeded in 6-well plates and transfected with double-stranded small interfering RNA (siRNA) (Shanghai Gene Pharma Co., Ltd., Shanghai, China). Sense and antisense strands for siRNAs were as follows: si-CXCL1-1 (5′-ACUCAAGAAUGGGCGGAAATT-3′) (5′-UUUCCGCCCAUUCUUGAGUTT-3′); si-CXCL1-2 (5′-CCAAGAACAUCAAAGUGUTT-3′) (5′-ACACUUUGGAUGUUCUUGGTT-3′); and si-CXCL1-3 (5′-GAUGCUGAACAGUGACAAATT-3′) (5′-UUUGUCACUGUUCAGCAUCTT-3′). Cal27 cells transfected for 24 h were used for subsequent experiments.
2.14 Flow cytometry
After RAW264.7 cells were cultured with TCM or TCM and CXCL1 for 48 h, they were stained with anti-mouse PE CD86 (Thermo Fisher Scientific, Waltham, MA, USA) and anti-mouse APC CD206 (Thermo Fisher Scientific, Waltham, MA, USA) on ice for 20 min according to the dilution ratio recommended by the manufacturers. Data analysis was performed using FlowJo software.
2.15 Statistical analysis
Prism 8.0 for Windows (GraphPad Software, Inc., La Jolla, CA, USA) was used for data analysis. Measurement data are presented as the mean ± standard deviation (SD), and statistical significance between groups was determined by Student’s t test or analysis of variance (ANOVA). Western blotting, wound healing assay and Transwell assay results were assessed by ImageJ software. Differences were considered statistically significant at *P < 0.05, **P < 0.01, and ***P < 0.001.
4 Discussion
The OSCC microenvironment is a chronic inflammatory environment. Numerous previous studies have revealed that the poor prognosis of OSCC patients is related to macrophage infiltration [
38]. In the OSCC microenvironment, cytokines and chemokines have a crucial effect on tumor cells, and they also mediate the crosstalk between tumor cells and infiltrated macrophages. Here, we made efforts to investigate the interaction between tumor cells and macrophages, as well as the underlying mechanism by which macrophages contribute to the invasion and metastasis of OSCC cells. This study may facilitate the development of novel therapeutic approaches for OSCC.
Previous studies indicated that the gene and protein expression levels of CXCL1 in OSCC cells were much higher than those in normal epithelium cells [
20]. In our current investigation, we found heightened expression of CXCL1 in OSCC tissues and OSCC cells. Moreover, CXCL1 promoted OSCC cell migration and invasion via macrophages. Tumor-derived CXCL1 has been reported to promote malignant behavior by polarizing macrophages [
18,
38]. Subsequently, the phenotype of macrophages was evaluated and the results were consistent with the above research showing that macrophages stimulated by CXCL1 underwent polarization into the M2 phenotype and secreted high levels of EGF.
Persistent chronic inflammation in cancer tissue gives rise to inhibition of antitumor immunity via a variety of mechanisms. For example, macrophages infiltrating the tumor microenvironment are polarized into activated (M1) and alternatively activated (M2) phenotypes, and anti-inflammatory and immunosuppressive M2 TAMs can induce tumor invasion and metastasis [
39,
40]. Whether CXCL1-induced EGF in M2 macrophages regulates OSCC cell proliferation, migration and invasion, as well as EMT in Cal27 cells was further examined in our research. We observed that cell proliferation, migration and invasion were enhanced by recombinant EGF. Meanwhile, the epithelial marker E-cadherin was downregulated, while the mesenchymal marker N-cadherin was upregulated in Cal27 cells. These results indicated that M2 macrophage-derived EGF play an important role in the invasive behavior of OSCC.
Macrophages secreting EGF could induce the invasion and metastasis of tumor cells via the EGF/EGFR signaling pathway [
41]. The downstream signaling of EGF/EGFR that mediates the invasion and migration of OSCC cells is unclear. Metastasis of OSCC was controlled by multiple molecular mechanisms, such as p65 phosphorylation and activation of other intracellular signaling pathways [
42,
43]. In our research, we noticed that the levels of p-EGFR and p65 were significantly activated after stimulation with recombinant EGF. Moreover, the phosphorylation level of p65 was prominently reversed by an inhibitor of EGFR (AG1478). The NF-κB/p-65 pathway has been reported to be a mediator of OSCC metastasis [
34‐
36]. These results indicated that EGF may induce the migration and invasion of OSCC cells through the EGFR/NF-κB signaling pathway.
The crosstalk between tumor cells and macrophages during malignant tumor progression has been increasingly reported [
39,
44,
45]. Our data demonstrated that CXCL1 could induce OSCC migration and invasion via inducing the secretion of EGF in macrophages. In addition, the expression of CXCL1 in Cal27 cells was upregulated after stimulation with recombinant EGF, and blockade of the EGF/EGFR axis reduced the secretion of CXCL1, which indicated that a CXCL1/EGF positive feedback loop was formed between OSCC cells and macrophages.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.