Background
Lung cancer remains by far the most common cause of cancer mortality and non-small cell lung cancer (NSCLC) accounts for >80% of cases of lung cancer, which ranks among the most deadly cancers worldwide[
1]. Although three therapeutic modalities (surgical resection, chemotherapy, and radiotherapy) have been established, long-term survival for lung cancer patients is still generally poor[
1,
2]. Therefore, further characterization of NSCLC pathogenesis to identify useful biomarkers and explore novel therapeutic targets becomes an essential task.
Epidermal growth factor receptor (EGFR) is a transmembrane protein with intrinsic tyrosine kinase activity that regulates cell growth in response to binding of its ligands. EGFR is overexpressed or mutated in most NSCLC cases, and deregulated expression of EGFR together with ligand binding and concomitant receptor activation promotes tumor cell growth, proliferation, and survival[
3,
4]. Several studies have demonstrated that EGFR overexpression correlates with reduced disease-free and overall survival[
5,
6]. Therefore, many strategies including using specific tyrosine kinase inhibitors (TKI) and monoclonal antibodies to target EGFR have been developed for treatment of NSCLC[
7,
8].
CUL4A, a member of the cullin family of proteins that composes the multifunctional ubiquitin ligase E3 complex, plays critical roles in DNA replication, cell cycle regulation and genomic instability[
9‐
15]. CUL4A amplification or overexpression has been reported in some human cancers, including breast cancer, squamous cell carcinoma, adrenocortical carcinoma, childhood medulloblastoma, prostate cancer and hepatocellular carcinoma and is associated with poor prognosis in node-negative breast cancer[
16‐
23]. Recently, it has benn shown that CUL4A is overexpressed and amplified in 64% primary malignant pleural mesothelioma, and downregulation of CUL4A with shRNA causes cell cycle arrest and growth inhibition through upregulation of p21 and p27 proteins[
20]. The use of a Cul4A transgenic mouse model demonstrates the potential oncogenic role of Cul4A in lung tumor development. After 40 weeks of Cul4A overexpression, lung tumors were visible and were characterized as grade I or II adenocarcinomas[
24]. Kim
et al. reported that DLC1 was ubiquitinated and degraded by cullin 4A-RING ubiquitin ligase (CRL4A) complex interaction with DDB1 and the FBXW5 substrate receptor in NSCLC cell lines[
25]. The recently report also shown that EGFR protects proliferating cell nuclear antigen from cullin 4A protein-mediated proteolysis[
26]. However, the functions and mechanism of CUL4A in NSCLC development and progression remain largely unknown.
In the present work, we sought to investigate the role and mechanism of CUL4A in NSCLC. We first examined both mRNA and protein expression patterns and evaluated prognostic significance of CUL4A in NSCLC. High levels of CUL4A predicted poor prognosis in overall survivals. Moreover, ectopic expression of CUL4A promoted cell proliferation and inhibited apoptosis. Knockdown of endogenous CUL4A by shRNA significantly decreased cell proliferation and tumorigenesis. Those oncogenic functions of CUL4A are at least partially mediated by regulation of EGFR and its related pathways. Additionally, we showed that CUL4A overexpression conferred NSCLC cells resistance to chemotherapy and sensitivity to EGFR target therapy. Our findings implicate CUL4A as a promising molecular target for therapy and a prognostic marker for highly recurrent NSCLC.
Discussion
To our knowledge, this is the first study to show that CUL4A has clinical significance and plays a functional role in human NSCLC. CUL4A was highly expressed in NSCLC and its expression was correlated with poor prognosis. Ectopic CUL4A expression in NSCLC cells induced proliferation and inhibited apoptosis in vitro. In contrast, silencing CUL4A reversed these events and resulted in inhibition of tumorigenic potential of NSCLC cells. We also verified a mechanistic link between CUL4A and EGFR through CUL4A mediated recruitment of H3K4me3 to EGFR promoter, which subsequently led to activation of EGFR expression and EGFR mediated signaling pathways. All of these functions of CUL4A conferred chemotherapy resistance and EGFR target therapy sensitivity to NSCLC cells.
Abnormal gene expression plays key roles in tumorigenesis which followed by series of target gene alterations and subsequent biological changes and this cascade of events is essential to tumorigenesis[
30]. In addition to reported upregulation in breast carcinomas[
16,
23], high level of CUL4A expression was also found in squamous cell carcinoma of the esophagus[
31], Adrenocortical carcinoma[
32], childhood medulloblastoma[
33], hepatocellular carcinomas[
17], malignant pleural mesothelioma[
20] and prostate cancer[
22]. In this study, we showed that CUL4A expression is frequently increased in human NSCLC tissues when compared with normal lung tissues and this elevation was significantly associated with NSCLC progression and prognosis. CUL4A is proposed as oncogenic based on its ability to ubiquitinate and degrade tumor suppressors, such as p21, p27, DDB2 and p53[
11‐
13,
34]. In this report we proposed a novel function of CUL4A in NSCLC. A serial evidence in our manuscript suggested that CUL4A activated EGFR transcription and its downstream signaling. EGFR signaling network plays a central role in the growth and maintenance of epithelial tissues, and alterations of this network can lead to malignant transformation[
35,
36]. Overexpression of EGFR was found in 50-70% of human lung cancer[
37], and deregulated expression of EGFR together with ligand binding and concomitant receptor activation promotes tumor cell growth, proliferation, and survival[
38,
39]. Our current study found that the transactivating activity of EGFR could be stimulated by CUL4A upregulation and suppressed by CUL4A inhibition. In addition, CUL4A expression was found to be positively correlated with overexpression of EGFR in NSCLC patient tumors. However, the current report just tested the effects of CUL4A on EGFR expression and did not stratify the situation of EGFR gene amplification/ mutation. Such tests with the stratification of EGFR gene status will greatly expand the relevance of CUL4A to a broader population of EGFR overexpressing NSCLC tumors and will be explored in our future work.
Increased resistance to apoptosis is a hallmark alteration in most types of cancers[
1]. Abrogation of proapoptotic pathways has been demonstrated to be one of the events key to tumor development and progression, and impairments in apoptotic programming are tightly linked to the commonly seen failure of anticancer chemotherapy and radiotherapy[
40‐
42]. Thus, clarification of the mechanisms modulating the apoptosis/survival process in a particular cancer type will bring new insights in developing more effective therapeutic strategies. Notably, in the current study, we found that CUL4A plays an important role in antiapoptosis of NSCLC cells that is relatively insensitive to chemotherapy. Ectopic expression of CUL4A in NSCLC cells dramatically enhances their resistance to apoptosis induced by doxorubicin or docetaxel, two commonly used chemotherapeutics, whereas suppressing CUL4A expression with shRNA markedly abrogated the ability of NSCLC cells to resist cytotoxic reagent-induced cell death. Our results suggest that CUL4A contributs to sustaining the unwanted survival of NSCLC cells under the treatment of chemotherapeutics and targeting CUL4A may overcome chemotherapy resistance in NSCLC with high levels of CUL4A. In summary, our study demonstrates that NSCLC cells with CUL4A overexpression are relatively resistant to chemotherapy but sensitive to EGFR target therapy. Therefore, our experiments provide a good rational to believe that CUL4A is not only a potential therapeutic target, but also a therapeutic biomarker for sensitive to TKI and resistance to chemotherapy.
Methods
Patients and specimens
This study was conducted with the approval of the Shandong University Institutional Ethical Review Board. Primary tumor specimens were obtained from 78 patients that underwent complete resection in Qilu Hospital of Shandong University between 2006 and 2008. Follow-up information was obtained from review of the patients’ medical record. None of the patients had received radiotherapy or chemotherapy before surgical resection. All 78 specimens were reevaluated with respect to histological subtype, differentiation, and tumor stage. The TNM staging system of the International Union Against Cancer was used to classify specimens as stages I (n =17), II (n =20), III (n =25), and IV (n =16). A total of 22 fresh tumor tissues and 22 fresh normal lung tissues were stored at -70°C immediately after resection for extraction of RNA.
Cell lines
BEAS2B, HSAEpiC, A549, H1299, H460, A427, H1650, 95D, and HLAMP cell lines were from American Type Culture Collection (Manassas, VA). The cells were cultured in RPMI 1640 (Invitrogen, Carlsbad, CA) containing 10% fetal calf serum (Invitrogen), 100 IU/ml penicillin (Sigma, St. Louis, MO), and 100 μg/ml streptomycin (Sigma). Cells were grown on sterilized culture dishes and were passaged every 2 days with 0.25% trypsin (Invitrogen).
Establishment of CUL4A stable expressing and knockdown cell lines
pBabe-puro retroviral constructs containing human
CUL4A cDNA and pSuper.retro.puro with shRNA against human
CUL4A cDNA were prepared as described previously[
20]. The constructs were transfected into the HEK 293 Phoenix ampho packaging cells to produce retroviral supernatants. 48 h after transfection, the supernatant was filtered through a 0.25 μm syringe filter. Retroviral infection was performed by adding filtered supernatant to mammary cell lines in the presence of 8 μg/ml of polybrene (Sigma, St. Louis, MO, USA). 6 h after infection, medium was changed with fresh medium and infected cells were allowed to recover for 48 h. Infected cells were selected by adding 2 μg/ml puromycin (Sigma, St. Louis, MO, USA) to the culture medium for 48 h and then maintained in complete medium with 1 μg/ml puromycin. Empty retroviral-infected stable cell lines were also produced by the above protocols. The expression of CUL4A was confirmed by RT-PCR and Western blot analysis.
Immunohistochemistry
Immunostaining was performed using the avidin-biotin-peroxidase complex method (UltrasensitiveTM, MaiXin, Fuzhou, China). The sections were deparaffinized in xylene, rehydrated with graded alcohol, and then boiled in 0.01 M citrate buffer (pH 6.0) for 2 min with an autoclave. Hydrogen peroxide (0.3%) was applied to block endogenous peroxide activity, and the sections were incubated with normal goat serum to reduce nonspecific binding. Tissue sections were incubated with CUL4A rabbit polyclonal antibody (1:250 dilution), EGFR mouse monoclonal antibody (1:150 dilution). Mouse immunoglobulin (at the same concentration of the antigen specific antibody) was used as a negative control. Staining for both antibodies was performed at room temperature for 2 h. Biotinylated goat antimouse serum IgG was used as a secondary antibody. After washing, the sections were incubated with streptavidin-biotin conjugated with horseradish peroxidase, and the peroxidase reaction was developed with 3, 30-diaminobenzidine tetrahydrochloride.
Two independent, blinded investigators examined all tumor slides randomly. Five views were examined per slide, and 100 cells were observed per view at 400× magnification. Scores for CUL4A and EGFR membrane and cytoplasmic staining were calculated based on staining intensity (0, below the level of detection; 1, weak; 2, moderate; and 3, strong) and the percentage of cells staining at each intensity level (0-100%). The final score was calculated by multiplying the intensity score by the percentage, producing a scoring range of 0 to 300. The immunohistochemistry score cut-off point was established as 73 using X-tile software program (version 3.6.3, Yale University School of Medicine, CT USA).
RNA Extraction and semi-quantitative RT-PCR
Total cellular RNA was extracted from cells using the RNeasy Plus Mini Kit from (Qiagen). The quality and yield of the RNA samples were determined by ultraviolet spectrophotometer. Total RNAs (1 μg) were reverse transcribed to cDNA (20 μl) using PrimeScriptTM RT Kit (TaKaRa) according to the manufacturer’s instructions. PCR reaction was conducted with 2 μL cDNA sample, 0.4 μL forward primer (10 μmol/L), 0.4 μL reverse primer (10 μmol/L), 11.2 μL RNase-free water, and 6 μL 2× EsayTaq PCR SuperMix (TransGen BIotech, Beijing, China). PCR reaction was performed using the following cycle parameters: 95°C for 5 minutes, (94°C for 30 seconds, 56°C for 30 seconds, 72°C for 45 seconds) for 30 cycles, 72°C for 7 minutes. RT-PCR products were separated on 2% agarose gels. After stained with ethidium bromide, gel images were photographed with ChemiImagerTM 4400. RT-PCR was performed at least 3 times for each sample. The sequences of the primer pairs are:
CUL4A forward, 5′ ATACTTCAGGACCCACGTTTGAT 3′,
CUL4A reverse, 5′ TCTCCAAGTACTAAAGCAGGAAAATCT 3′,
EGFR forward, 5′ GCCACGTCTCCACACATCAG 3′,
EGFR reverse, 5′ TGGTGCATTTTCGGTTGTTG 3′,
GAPDH forward, 5′ ATAGCACAGCCTGGATAGCAACGTAC- 3′,
GAPDH reverse, 5′ CACCTTCTACAATGAGCT GCGTGTG 3′.
GAPDH was used as the reference gene.
Western blot analysis
Total protein from cells was extracted in lysis buffer (Pierce) and quantified using the Bradford method. Then, 50 μg of protein were separated by SDS-PAGE (10%). After transferring to polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA), the membranes were incubated overnight at 4°C with antibodies against CUL4A (1:1000; CST), EGFR (1:1000; Abcam), β-actin (1:2000, Santa Cruz Biotechnology). After incubation with peroxidase-coupled antimouse IgG (Santa Cruz Biotechnology) at 37°C for 2 h, bound proteins were visualized using ECL (Pierce) and detected using BioImaging Systems (UVP Inc., Upland, CA). The relative protein levels were calculated based on beta-actin protein as a loading control.
Soft agar assay
The test cells (3 × 105) were suspended in 5ml of culture medium containing 0.4% agar (USB Corportion) and seeded onto a base layer of 5ml of 0.7% agar bed in 10-cm tissure-culture dishes. Colonies >50 μm in diameter were counted after 3 weeks.
Confocal immunofluorescence microscopy
Cell lines were plated on culture slides (Costar, Manassas, VA, USA). After 24 hrs, the cells were rinsed with phosphatebuffered saline (PBS) and fixed with 4% paraformaldehyde in PBS, and cell membrane was permeabilized using 0.5% Triton X-100. These cells were then blocked for 30 min in 10% BSA (Sigma, Aldrich St. Louis, MO, USA) in PBS and then incubated with primary monoclonal antibodies in 10% BSA overnight at 4°C. After three washes in PBS, the slides were incubated for 1 hour in the dark with FITC-conjugated secondary goat anti-mouse, or goat anti-rabbit antibodies (Invitrogen, Grand Island, NY, USA). After three further washes, the slides were stained with 4-,6-diamidino-2-phenylindole (DAPI; Sigma, Aldrich St. Louis, MO, USA) for 5 min to visualize the nuclei, and examined using an Carl Zeiss confocal imaging system (LSM 780) ( Carl Zeiss, Jena, Germany).
MTT assay
Cells were plated in 96-well plates in medium containing 10% FBS at about 3,000 cells per well 24 h after transfection. Then, 20 μl of 5 mg/ml MTT (Thiazolyl Blue) solution was added to each well and incubated for 4 h at 37°C, the media was removed from each well, and the resultant MTT formazan was solubilized in 150 μl of DMSO. The results were quantitated spectrophotometrically using a test wavelength of 570 nm.
Apoptosis assay
Cells were harvested and washed twice with cold PBS by gentle shaking. Resuspend cells were added to Binding buffer and adjusted cell density to 2–5 × 105/mL. In the dark, 5 μL Annexin V-FITC (50 mM TRIS, 100 mM NaCl, 1% BSA, 0.02% Sodium Azide, pH 7.4) was added to cell suspension Mix of 195 μL and incubated for 10 min at room temperature before adding 190 μL Binding buffer (1×) and 10μL PI. Ten thousand events per sample were acquired using a FACS-scan flow cytometer (Becton-Dickinson, San Jose, CA, USA) and the percentage of cell apoptosis were analyzed using Cell Quest analysis software (Becton-Dickinson).
Chromatin immunoprecipitation assays
Cells were fixed in 1% formaldehyde for 10 minutes at 37°C. Cross-linking was quenched by adding 125 mmol/L glycine. Cells were then washed with cold PBS, harvested and resuspended in SDS lysis buffer containing a protease inhibitor cocktail. Chromatin was sheared by sonication (average length 0.25-1 Kb) and incubated with 60 ml protein A/G agarose/salmon sperm DNA (50% slurry; Millipore) with gentle agitation for 30 minutes. The supernatant was then immunoprecipitated with anti-SOX4 antibody 1:500 or its matched nonimmune crude serum 1:500 (IgG; Diagenode) at 4°C overnight. Protein A/G agarose (60 mL of 50% slurry) was then added and incubated for 1 hour. Pellets were washed and protein-DNA cross-links were reversed by overnight incubation at 65°C with proteinase K. DNA was purified following a conventional phenol–chloroform protocol and eluted in 50 mL water. At least 3 independent Chromatin immunoprecipitation (ChIP) experiments were carried out.
Xenografted tumor model in vivo
Female BALB/c nude mice (4–5 weeks of age, 18–20 g) were purchased from the Center of Experimental Animal of Guangzhou University of Chinese Medicine and were housed in barrier facilities on a 12-hour light/dark cycle. All experimental procedures were approved by the Institutional Animal Care and Use Committee of Shandong University. The BALB/c nude mice were randomly divided into 2 groups (n =6/group). One group of mice were inoculated subcutaneously with A549/vector cells (1 × 106, suspended in 100 μL sterile PBS) per mouse in the right oxter as control group. The other group was inoculated with A549/CUL4A shRNA cells (1 × 106, suspended in 100 μL sterile PBS). Tumor volume was calculated using the equation (L × W2)/2.
Statistical analysis
SPSS version 11.5 for Windows was used for all analyses. The χ2 test was used to examine possible correlations between CUL4A expression and clinicopathologic factors. The association between CUL4A and EGFR immunointensity on the same specimens was analyzed using Spearman rank correlation test. The t test was used to compare data from the densitometry analysis of foci numbers. The Kaplan–Meier method was used to estimate the probability of patient survival, and differences in the survival of subgroups of patients were compared using Mantel’s log-rank test. A multivariate analysis was performed using the Cox regression model to study the effects of different variables on survival. P value of <0.05 was considered to indicate statistical significance.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
GWW designed the experiments. WYS, ZPJ, WQ, WMX, and YHT performed the experiments. LZM, MJH and WYL performed the statistical analysis. WYS and GWW wrote the manuscript. All authors approved the final draft of this manuscript.