Down regulating PHGDH affects the lactate production of sertoli cells in varicocele

During laparoscopic varicocelectomy, after exposing the testicular vein, Venous blood is extracted with a syringe with a slender needle before high ligation, and the scrotum is squeezed as the blood is extracted. Finally, blood gas analysis was performed on the varicocele side venous blood and peripheral venous blood of patients at the same time to detect lactate concentration. This study was approved by the ethics committee of the Third Affiliated Hospital of Southern Medical University under code number 68222115.

Twenty adult male specific-pathogen free Sprague-Dawley rats (body weight, 250–300 g) were randomly assigned to a sham group (n = 10) and a varicocele group (n = 10). Rats were housed in a climate-controlled environment with free access to food and water under a 12-h day/night cycle. Experimental rat varicocele model was constructed according to our new clip technique [13]. The establishment and assessment of the rat model is described in the previous articles published by our team. This study was approved by the ethics committee of the Third Affiliated Hospital of Southern Medical University and the animal work was approved by the Animal Care and Ethics Committee of Southern Medical University.

Total RNA was extracted from the left testis of each animal using TRIzol reagent (Invitrogen, Carlsbad, USA) in accordance with the manufacturer’s instructions. In brief, tissues were homogenized and incubated in TRIzol for 10 min, and then RNA was separated using chloroform (0.2 mL/1 mL TRIzol). After centrifugation at 12,000 g for 15 min at 4 °C, the aqueous phase of the sample was transferred to a fresh tube for RNA precipitation using isopropyl alcohol (0.5 mL/1 mL TRIzol). After repeating the incubation and centrifugation steps, the remaining pellet was washed with 75% ethanol and centrifuged at 7500 g for 5 min at 4 °C. Finally, the air-dried pellet was re-dissolved in RNase-free water. The quantity and quality of the extracted RNA were measured with E-Spect (Malcon, Japan). In total, 200 ng of total RNA was reverse-transcribed with a PrimerScriptTM RT Kit (TaKaRa) for mRNA while quantitative real-time PCR for mRNA was performed in a 96-well plate using a SYBR Premix Ex Taq Real Time PCR Kit (TaKaRa). Amplification reactions were carried out in a final volume of 20 μL and were performed on an Mx3005P Stratagene under the following thermal cycling conditions: (denaturation at 95 °C for 30 s [1×], followed by 40 cycles of denaturation [95 °C, 30 s], annealing [60 °C, 10 s] and extension [72 °C, 15 s]). Rat Gapdh was used as an endogenous reference. The primers used for detecting Phgdh and Gapdh expression are shown in Table 1. The comparative cycle threshold method was performed for relative quantification. The sequences of the primers were as follows: PHGDH forward, 5′- GATGAAAGATGGCAAATGGGA -3′; PHGDH reverse, 5′- GCGGGGTATGGACAGTGATG -3′. GAPDH forward, 5′-TGGAGTCTAGGCGTCTT -3′; GAPDH reverse5′- TGTCATATTTCTCGTGGTTCA − 3′.

Sertoli cells (a mouse testis Sertoli cell line) were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in DMEM with 10% FBS at 37 °C in an incubator with an atmosphere of 5% CO2. For the experiments, sertoli cells were adherently cultured in 100-mm tissue culture dishes and reached 60 ~ 70% density before use.

PHGDH siRNA was used to silence the PHGDH gene. A scrambled sequence siRNA (siNCtrl) was used as a negative control. The siRNA transfection was optimized using Lipofectamine2000-RNAimax (Invitrogen, Carlsbad, CA, USA), according to the manufacturer s instructions. Briefly, siRNA and lipofectamine were diluted separately in Opti-MEM (Gibco) and incubated at room temperature for 5 min. Then, the two solutions were gently mixed and incubated for 15 min. Finally, the mixture was added to plated cells, and after 48 h, the cells were analyzed using the following assays.

PHGDH siRNA and a negative control siRNA were transfected as mentioned above.For cell apoptosis analysis, cells were prepared with the PE Annexin V Apoptosis Detection Kit I (BD Biosciences, New Jersey, USA) according to the manufacturer’s recommendations. For cell cycle analysis, cells were fixed and permeabilized by 75% ethanol, and were stained by PI/RNase Staining Buffer (BD Biosciences, New Jersey, USA) after incubation at − 20 °C overnight. The cell apoptosis ratio and cell cycle profile were detected by FAC Station (FV500,Beckman Coulter, Brea, USA), and the raw data were analyzed using FlowJo 10.0.7 software (FlowJo, Oregon, USA).

Total cells washed twice with cold PBS and lysed with RIPA (lysis buffer radioimmunoprecipitation assay) (Beyotime Institute of Biotechnology, China) and PMSF (protease inhibitors phenylmethanesulfonyl fluoride) (Beyotime Institute of Biotechnology, China). The protein concentration was determined by utilizing bicinchoninic acid (BCA) protein assay kit (P0010S, Beyotime Biotech, China). Equal amounts of protein (~ 10 μg) were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to 0.45 μm polyvinylidine difluoride filter (PVDF) membranes. The membranes were blocked with 5% BSA for 1 h and then the membranes were incubated at 4 °C overnight with primary antibodies. Next, the membranes were washed three times with TBST for at least 15 min, and probed with HRP linked secondary antibodies for 1 h at room temperature. Protein bands were visualized employing the enhanced chemiluminescence detection kit (Thermo scientific, USA). The gray value of each protein band was analyzed by Image Lab software.

The primary antibodies were: PHGDH,PKM-2,PSPH and β-actin. All these antibodies were purchased from Abcam.

PHGDH siRNA and a negative control siRNA were transfected as mentioned above.After 48 h, the media were collected for measurement of glucose and lactate concentrations as determined by glucose (GO) assay kit (Sigma) and lactate assay kit (Biovision). Glucose consumption and lactate production were normalized by cell numbers.

PHGDH siRNA and a negative control siRNA were transfected as mentioned above. After 48 h, the media were collected for measurement of LDH activities as determined by colorimetric assay kits in accordance with the manufacturer protocols.

Using the Search Tool for the Retrieval of Interacting Genes (STRING) database (http://​www.​string-db.​org/​), a PPI network related to PHGDH, PSPH, PSAT1 and PKM2 was established. The interactions procured included known interactions and predicted interactions.

The blood gas analysis results showed that compared with the peripheral venous blood, the lactate concentration in the varicocele side of the patients decreased significantly (Fig. 1).

PHGDH was of interest because of its involvement in lactic acid metabolism, and we chose to test our hypothesis in a rat model. Eight weeks after initial surgery, the mean diameter of the LSV in the varicocele group was significantly larger than that of the sham group (1.58 ± 0.05 mm versus 0.24 ± 0.01 mm, respectively, P < 0.0001, Supplementary Fig. 1). Histological assessment of the left testes showed that the proportion (%) of degenerating seminiferous tubules was significantly higher in the varicocele group than in the sham group (57.83 ± 3.63% versus 13.73 ± 0.65%, respectively, P < 0.0001, Fig. 2a, b), which indicated clear impairment of spermatogenesis. The mRNA and protein expression levels of PHGDH were examined with qRT-PCR and Western blotting, respectively, in the left testes from the two groups of rats. Notably, PHGDH mRNA and protein expression was obviously reduced in the left testes from the varicocele group relative to the sham group (Fig. 2c, d).

In order to investigate the role of PHGDH in sertoli cells, the expression of PHGDH was knocked down by PHGDH siRNA. sertoli cells were transfected with a scrambled sequence siRNA (siNCtrl) and three PHGDH siRNA. the protein level of PHGDH were inhibited significantly by PHGDH siR1 (Fig. 3a, b). Because the production of lactate to fulfill the energy needs of spermatogenesis is a crucial function of sertoli cells, and PHGDH may cause changes in cell lactate production by affecting glycolysis, we wondered whether PHGDH Knockdown regulate sertoli cells glycolysis. After transiently transfection sertoli cells with NC siR or PHGDH siR1 for 48 h, PHGDH knockdown significantly decreased the glucose consumption (Fig. 3c) and the LDH activities (Fig. 3d) of sertoli cells. We further examined the lactate production of sertoli cells,which showed that PHGDH knockdown inhibited the lactate production of sertoli cells (Fig. 3e). These results indicate that PHGDH knockdown inhibited the glycolysis of sertoli cells and resulted in the reduction of lactate production.

To investigate the mechanism how PHGDH regulates sertoli cell glycolysis and lactate production, we constructed a PPI network using the STRING database, It was verified that PSPH, PSAT1 and PKM2 were indeed related to PHGDH (Fig. 4a). We performed western blot to access the effects of PHGDH on the expression of PSPH and PKM2. Our results showed that knockdown of PHGDH remarkably decreased the expression of PSPH and PKM2 (Fig. 4b).

After transiently transfection sertoli cells with NC siR or PHGDH siR1 for 48 h, cell cycle and cell apoptosis assays indicated that PHGDH knockdown decreased the proportion of cells in S-phase (Fig. 5a) and increased the percentage of apoptotic cells (Fig. 5b) in sertoli cells compared with control groups. These results indicate that PHGDH might play a key role in sertoli cells growth.