Background
Avian influenza virus subtype H9N2 (H9N2 AIV) is usually found in chicken, but also isolated from the mammals, even humans [
1,
2]. Importantly, most high pathogenic AIV (e.g. H7N9) acquired their internal’ gene segments from H9N2 strains [
3]. And the virus can be isolated from host tissues including trachea, lung, brain, spleen, pancreas, cloacal cavity and intestinal tract. However, no characteristic clinical symptoms and lesions were observed in animals individually infected with H9N2 AIV. Generally, hosts begin to develop inflammation and enteric problems at 3–5 days post infection, often resulting in morbidity or mortality due to infection with secondary bacteria, for example
Escherichia coli [
4]. In mammals, AIV H9N2 always causes mild respiratory illness, but fatal outcomes are sometimes observed [
3,
5,
6]. After H9N2 AIV infection, the inflammation was serious, even with severe peritonitis, perihepatitis and pericarditis in chicken. The problem of bacterial secondary infection has also plagued many scholars and clinical practitioners, and also brought great difficulties to the prevention and control of the bird flu. This is a puzzle that animal infection with influenza virus would appear serious bacterial secondary infection and how do these bacteria break through the body’s mucosal barrier into vital organs? All of those questions deserve further research.
The intestinal tract is the body’s largest immune organ. Once the mucosal barrier and microbial flora are destroyed, the intestinal diseases will occur. The avian influenza virus can be replicated in intestinal epithelial cells after infection and will trigger the massive expression of inflammatory factors and appear intestinal inflammatory injury [
7,
8]. In clinically, antibiotics were always used to treat. Antibiotics can kill bacteria, but can also cause damage to intestinal beneficial flora, aggravating intestinal injury because of its broad spectrum. A large number of studies have showed that Chinese herbal medicine in the regulation of the intestinal tract have a good effect, such as Ageratum-liquid (AL), which can regulate gastrointestinal motility function, repair damaged mucosa and reduce intestinal permeability [
9,
10]. As a representative natural medicine, AL is considered safe and with few adverse drug reactions. Clinical studies found that AL has significant effect on the treatment of gastrointestinal influenza [
11,
12]. In the view of these problems, this project, on the basis of previous studies, we used BALB/c mice as an animal model to infect H9N2 AIV with low pathogenicity to investigate the mechanism of H9N2 AIV promoting bacterial translocation in the intestine of mice infected with H9N2 AIV, the close relationship between intestinal bacterial translocation and secondary bacterial infection, and the feasibility of compound traditional Chinese medicine in preventing intestinal flora translocation to prevent secondary infection.
Materials and methods
Viral and bacterial strains
The H9N2 AIV strain A/mink/China/01/2014 (H9N2) was isolated from minks and obtained from Professor Qingfang Liu, Chinese Acad Agr Sci, Shanghai Vet Res Inst, Shanghai, Peoples R China. The viral titer was 10
6.1 EID
50/0.1 mL. Neongreen specific marker
Escherichia coli (Neongreen-tagged bacteria) was obtained from Professor Youming Zhang, the State Key Laboratory of Microbial Technology, Shandong University, and the marker was visualized by a secreted Neongreen fluorescent reporter. Ageratum-Liquid (alcohol free) was used as a commercialized manufacture of Chinese herb medicine purchased from Taiji Group Chongqing Fuling Pharmaceutical Co., Ltd. (LOT number: 17021045, Approval Code: Z50020409, Chongqing, China) and used for treatment of the infection according the manufacturer’s instructions. Ageratum-Liquid is a Chinese patent medicine composed of 10 kinds of Chinese medical medicines, including Atractylodis Rhizoma, Citri Reticulatae Pericarpium, Magnoliae Ofcinalis Cortex, and Pinelliae Rhizoma, Angelicae Dahuricae Radix, Poria, and Arecae Pericarpium, Licorice extract, Patchouli oil and volatile oil in Perillae Folium, and the herbal prescription and reference compounds were relatively constant as previous description [
10].
Animals and experimental protocol
The six weeks of BALB/c mice with similar weight were housed in negative pressure isolator and supplied commercial food and water Ad libitum in an air-conditioned environment (22–24 °C) with a regular 12-h light/dark cycle. After 1 week of acclimatization, eighty mice were randomly divided into eight groups (Table
1). The animal well-being was monitored during whole experiment, and cloacal swabs of the mice were collected for virus isolation and detection after 3 days post H9N2 AIV infection. Five mice from Control, Infection, Ageratum-liquid and Infection-Ageratum-liqui groups were euthanized by CO
2 asphyxiation recommended by previous description [
13] at 5 and 12 dpi (day post infection) respectively. Then the distal ileal contents were collected in a sterile environment and frozen immediately in liquid nitrogen for 16S rRNA sequencing and four mice were randomly selected for posterior bacterial isolation in liver and lung. The other distal ileal (1 cm) was placed in the slice fixative to prepare pathological sections. In addition, three mice from Neongreen, Infected-Neongreen, Ageratum-liquid-Neongreen and Infection-Ageratum-liquid-Neongreen groups were euthanized as previous description at 12, 24, 36 and 48 h post the intragastrical administration and aseptic collection of liver, lung, mesentery and intestinal cavity contents in placed in sterile centrifuge tubes for posterior Neongreen-tagged isolation. All procedures involving the handling of animals were carried out in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The animal study protocol was approved by the South China Agricultural University Committee of Animal Experiments (approval ID: SYXK-2014-0136).
Table 1
Group of Experiments
1 (Control) | PBS nose drops, 300 μL/per mouse |
2 (Infection) | H9N2 AIV nose drops, 300 μL/per mouse |
3 (Neongreen) | PBS nose drops, 300 μL/per mouse; intragastrical administration oflabeled bacteriaat 3 dpi, 300 μL/per mouse |
4 (Infected-Neongreen) | H9N2 AIV nose drops, 300 μL/per mouse; intragastrical administration oflabeled bacteriaat 3 dpi, 300 μL/per mouse |
5 (Ageratum-liquid) | PBS nose drops, 300 μL/per mouse; filled with ALat 2, 3, 4 dpi, 1 mL/100 g, perday |
6 (Infection-Ageratum-liquid) | H9N2 AIV nose drops, 300 μL/per mouse; filled with ALat 2, 3, 4 dpi, 1 mL/100 g, perday |
7 (Ageratum-liquid-Neongreen) | PBS nose drops, 300 μL/per mouse; filled with ALat 2, 3, 4 dpi, 1 mL/100 g, perday; intragastrical administration oflabeled bacteria at 3 dpi, 300 μL/per mouse |
8 (Infection-Ageratum-liquid-Neongreen) | H9N2 AIV nose drops, 300 μL/per mouse; filled with ALat 2, 3, 4 dpi, 1 mL/100 g, perday; intragastrical administration oflabeled bacteria at 3 dpi, 300 μL/per mouse |
Virus isolation and identification
The total RNA was extracted by swab eluate and detected by RT-PCR. The PCR system was 20 μL volume, including10 μL of 2 × One-Step Buffer, 0.5 μL of primers pares (F: CAAGATGGAAGTAGTATCACT, R: TTGCCAATTATATACAAATGT), 2 μL of RNA, 1 μL of RNA, One-Step Enzyme Mix and 6 μL of ddH2O. Reaction procedure was followed: reverse transcription 30 min at 50 °C; Denaturation 5 min at 94 °C, 30 cycles, 10 s at 94 °C, 55 °C annealing, 15 s; 72 °C extend 90 s, it extends 10 min after 72 °C, preserve at 4 C. The amplified products were detected by 1% agarose gel electrophoresis, and the results were recorded by the VL gel imaging system (France). In addition, 20 mg ileal contents and lung were homogenized in 100 μL of phosphate buffered solution from each of Infection, Ageratum-liquid and Infection-Ageratum-liquid groups at 5 dpi and 12 dpi, and TCID50 on MDCK cells was used to determine virus titers.
Bacterial isolation
Tissue samples including collected liver and lung of four mice were homogenized in 500 μL of sterile saline from each of Trial 1 and Trial 3 groups. 100 μL of grinding fluid was coated on the LB plate and cultured 48 h at 37 °C. The growth status of bacteria was observed.
Neongreen-tagged bacteria isolation
200 mg tissue samples including collected liver, lung, mesentery and intestinal cavity contents of three mice were homogenized in 500 μL of sterile saline from each of 3, 4, 7 and 8 groups. 100 μL of grinding fluid was coated on the LA plate (containing ampicillin was 100 μg/ml) and cultured 48 h at 37 °C. The growth status of Neongreen-tagged bacteria was observed.
Histological examination of intestinal segments and villus conditions
Intestinal sections were performed in a commercial company (Wuhan). The collected distal ileum was sectioned for evaluation of the ileal epithelium lesions as previous description [
7]. Intestinal tissue slice was observed through the microscope (20 × 10). Ten complete structures of the villi and crypt depth were measured using Image-Pro Plus 6.0 (Media Cybernetics, Inc.), and V/C ratio were calculated.
DNA extraction and 16S rRNA gene sequencing
Intestinal bacterial genomic DNA was extracted with a TIANamp Stool DNA Kit (TIANGEN, Beijing, China). Total DNA Trizol Reagent was used to extract DNA from all samples of the intestinal contents, according the manufacturer’s instructions. The DNA purity and concentration were determined using a NanoDrop spectrophotometer (Thermo, USA). A 16S rRNA were sequenced for the V4 region of 16S rRNA in BGI Science and Technology Service Co., Ltd. according to the previous description [
7,
14].
Data analyses
All the data were calculated by Excel 2016 and one-way ANOVA was performed by using SPSS 22.0 software. Multiple significant comparisons were analyzed by DUNCAN, p < 0.05 was considered as significant difference, the test data in average and standard deviation form.
Discussion
H9N2 AIV, a low-virulent virus, is widely found in some avian species, and mammals, causing significant losses due to diarrhea and secondary infections [
1,
2,
15]. There are many studies reporting the effects of H9N2 AIV on the respiratory tract [
16,
17], but few reports focus on the effect of H9N2 AVI on the gastrointestinal tract. Stable intestinal morphology and physiological function are the basis of the intestinal health. It has been reported that short villus height and deep crypt depth means the poor intestinal function. The higher to the V/C value, the healthier to the intestine [
18,
19]. In this study, the villus of ileum became shorter, the crypt became deeper, and V/C was down-regulated significantly after 5 and 12 dpi, indicating that mice infected with H9N2 AIV damaged the structure of villus and affected the function of nutritional absorption. The change of villi epithelial cells could be directly observed through pathological sections, showing, in accordance with previous observations [
7,
20], H9N2 AIV infection could destroy the intestinal barrier structure, weaken digestion and absorption capacity, and further may affect the body’s immune capacity, resulting in that conditional pathogens might reach to pathogenic conditions.
It has been reported that H9N2 AIV infection could change the structure of intestinal flora with beneficial bacteria reduction and damage the structure of intestinal barrier in mice or chicken [
7,
20,
21]. At 5 dpi, broiler chickens were greatly reduced in beneficial bacteria such as
Lactobacillus, and the number of opportunistic pathogens increased, especially the conditional pathogens
Escherichia abundance exceeded 40%. Similarly, H9N2 AIV infected mice also showed some changes in bacterial population, resulting in increased abundance of
Proteobacteria and
Actinomycetes. Especially, beneficial
Lactobacillus was significantly down-regulated, and
Streptococcus,
Staphylococcus and Coryneba
cterium-1 were significantly up-regulated at 12 dpi. As we know, the etiological relationship between gastrointestinal diseases and intestinal microflora was relatively constant [
22,
23]. We proposed that the structure disruption of mouse intestinal flora caused by H9N2 AIV probably took shape a bacterial environment to trend to critical pathological conditions. Meanwhile, we isolated plenty of
Staphylococcus and a few
E. coli from liver and lung in infected mice. Those findings provide clues that these microbes might be from translocation of intestine. The isolation of Neongreen-labeled bacteria confirmed this hypothesis. The labeled bacteria transferred from the intestine through the intestinal epithelial tissue to the mesenteric tissue sites in 36 h and lungs in 24 h post intragastrical administration of Neongreen-labeled bacteria. These results indicated that H9N2 AIV promotes some bacterium translocation into body, then invaded other tissues through body fluid circulation and so on, leading to bacterial infection. Which bacteria can synergize with H9N2 AIV co-infection and how does this synergy work? These require further study. In addition, the labeled bacteria were also isolated from lungs of the infected mouse group 24 h post intragastrical administration, indicating specific intestinal bacteria may also be able to infect damaged lungs by the digestive tract.
Patchouli is an edible plant, which broadly grows in China and is the main ingredient of AL. As one of the 50 fundamental herbs, Patchouli is used in popular medicine to viral, fungal, and bacterial infections [
24‐
26]. Magnolia officinalis (Chinese name: Houpo) was an important constituent of AL and rich in Honokiol or magnolol, isomers of neolignans [
27,
28], which was reported that honokiol have function of anti-oxidative, anti-inflammatory, anti-tumor and anti-microbial properties [
29‐
34]. A previous review showed that the mechanisms of kampo medicines including some components of AL were involved in regulating the intestinal motility by NO or 5-HT3 receptor pathways and anti-inflammatory [
35]. As a thousand-year-old formula, AL combines each component biological and pharmacological property and is an efficiency and low toxicity natural medicines. It is reported that the AL can increase the number of Lactobacillus, Bifidobacterial in mammal gut, reduce intestinal permeability in acetic acid-induced PI-IBS, regulate CD4+ and CD8+ cells in Peyer’s patch and suppress TNF-alpha levels in enteric homogenates to improve the diarrhea caused by Salmonella typhimurium in mice [
9,
10,
36,
37,
38]. Our experiment found AL can effectively minimize the H9N2 AIV infection-induced intestinal mucosal injuries and alleviate bacterial flora disorder, suggesting that AL no only might somehow improve the immunity and anti-H9N2 AIV capabilities of host, but also repair intestinal barrier to prevent secondary infections. Thus, as a low resistance and toxicity natural medicine, traditional Chinese medicine has many pharmacological activities and could be applied to treat many diseases as potential antibiotic substitutes. Those need to further research.
Meanwhile, little to no bacteria was isolated from liver and lung of mice after H9N2 AIV infection in Ageratum-liquid group and Infection-Ageratum-liquid group. Moreover, no Neongreen-labeled bacteria were isolated from liver, lung, and mesentery tissues of the mice from both of the treatment groups, but the Neongreen-labeled bacteria were isolated from the intestines of all mice subjected to either administration of Neongreen-labeled bacteria or H9N2 AIV infection followed by administration of Neongreen-labeled bacteria, indicating that gut bacterial translocation to the baby might play important roles during H9N2 AIV infection process and AL treatment effectively prevented the bacteria translocation that otherwise would be induced post H9N2 AIV infection in mice.
Acknowledgements
We thank Qingfang Liu at Chinese Acad Agr Sci, Shanghai Vet Res Inst, Shanghai, Peoples R China for kindly providing the A/mink/China/01/2014 strain and Youming Zhang for kindly providing the Neongreen-tagged bacteria at the State Key Laboratory of Microbial Technology, Shandong University for this study.