Background
Angiogenesis is an essential process in follicular development and luteogenesis [
1,
2]. Once the proliferation of new blood vessels is complete, a rapid capillary regression takes place in the non-fertile cycle which suggests a delicate coordination between angiogenesis inducers and inhibitors [
3]. The intervention of ovarian vascularization has an adverse effect on the growth of the dominant follicle, the ovulation and the functioning of the corpus luteum and its ability to secrete progesterone [
1,
4].
The regulation of cyclic angiogenesis in the ovary is commanded by a variety of growth factors; vascular endothelial growth factor (VEGF) playing a major role by stimulating vessel hyperpermeability, endothelial cell proliferation and migration [
5]. Several splicing isoforms are generated from VEGF gene, and the proteins reach endothelial cells either by difussion of the shorter isoforms (VEGF 121, VEGF 165) or following proteolitic cleavage of longer ones (VEGF 189, VEGF 206) [
3]. The mRNAs for the isoforms of 121 and 165 aminoacids are dominant in normal human ovaries [
5]. In rodents, VEGF isoforms are one aminoacid shorter than in human, and have a similar distribution and function [
6,
7]. Another molecule that modulates angiogenesis is the transforming growth factor beta 1 (TGFβ1), being essential for matrix remodeling, vessel stabilization and pericyte differentiation. TGFβ1 deficient mice have impaired vessel wall integrity [
8,
9]. In the human ovary, follicular cells express TGFβ1, which has proliferative and differentiation effects on granulosa cells [
10,
11]. It also increases the size of follicles from adult mice [
12]. In the hamster ovary, the mRNAs for TGFβ receptors are cyclically regulated by gonadotropins and ovarian steroids, increasing their levels as the follicle develops during the estral cycle [
13].
Another important growth factor involved in ovarian physiology is the nerve growth factor (NGF). Mammalian ovary expresses the neurotrophin and both the high- and the low-affinity receptor for NGF (trkA and p75, respectively) [
14‐
16]. In neonatal rat ovaries, the expression of follicular stimulating hormone (FSH) receptors is induced by NGF [
17]. Immunoneutralization of NGF during early postnatal life of the rat results in undersized antral follicles, delayed puberty and disrupted estrous cyclicity [
18]. TrkA and NGF are transiently expressed in preovulatory follicles in the first preovulatory surge of gonadotropins at puberty in the rat. The use of a neutralizing antibody to NGF or pharmacological blockade of trkA tyrosine kinase activity targeted to one ovary resulted in the ipsilateral inhibition of ovulation [
19].
Although NGF promotes angiogenesis and/or induces the expression of angiogenic molecules in several tissues, such as skin, muscle, cornea, arteries [
20‐
23] and the immunoneutralization of this neurotrophin delays the reparative neovascularization of lesions in the mice [
21], the effects of NGF on ovarian angiogenesis remain unexplored. This study investigates the role of NGF in regulating the expression of the angiogenic factors VEGF and TGFβ1, and the area of blood vessels in the rat ovary. Gonadotropins can upregulate different angiogenesis-related parameters in the ovary [
24‐
26]; hence, to avoid this influence, we selected early stages of rat ovarian life as a model, when the tissue has not become gonadotropin-dependent [
27].
Methods
Animals
Sprague Dawley rats obtained from the Faculty of Chemical and Pharmaceutical Sciences, Universidad de Chile were housed under controlled conditions of temperature (21°C) and light (12 h of light, 12 h of darkness; lights on from 0800–2000 h). Food and drinking water were provided ad libitum. All the protocols for animal care and use included in this study were approved by the institutional review board of the Faculty of Chemical and Pharmaceutical Sciences, Universidad de Chile.
Organ culture
Ovaries from 2 day old rats were dissected under aseptic conditions, placed on sterile lens paper, and cultured on plastic supports at the interface of air/culture medium [
28], under an atmosphere of 5% CO2. For histochemical studies, one ovary per well was utilized, and for mRNA studies, three glands per well were cultured. Considering this, for an n = 5, 20 pups were utilized for each incubation point. Ovaries were cultured in 24-well plates (Becton Dickinson, USA); each well contained 1 ml DMEM: F-12 (50% vol/vol, Sigma Chemicals, St Louis, MO, USA) medium supplemented with sodium bicarbonate (600 mg/l, Sigma Chemicals, St Louis, MO, USA), penicillin (50 mg/l, Laboratorio Chile, Santiago, Chile), gentamycin (80 mg/l, Andrómaco, Santiago, Chile), streptomycin (50 mg/l, Laboratorio Chile, Santiago, Chile) and ketoconazol (5 mg/l, Laboratorio Chile, Santiago, Chile). The ovaries were stimulated with NGF 100 ng/ml (Sigma Chemicals, St Louis, MO, USA). The optimal dose of NGF was established by previous studies from our group [
17]. The contralateral ovaries cultured with medium alone were used as controls. The times of culture were 2, 4, 8 and 24 h. In the case of mRNA studies, the ovaries were collected and stored at -80°C until RNA extraction. The ovaries collected for immunohistochemistry were fixed in Bouin's fixative.
Ovary denervation
We used 16 prepuberal rats of 23–24 day old (body weight 60 g aprox.). They were anaesthetized with isoflurane 1% v/v, 2.5 l/min (Baxter Healthcare Co, Guayama, Puerto Rico). The dissection of the superior ovarian nerve (SON) was performed in both ovaries under aseptic conditions through a single dorsal midline incision. This procedure has shown to induce an increase of NGF within the gland [
29]. Because denervation induces hypertrophy of the contralateral ovary [
30], controls consisted in different animals submitted to a simulated operation. The ovaries were collected three days later (from a total of 6 rats; 3 controls and 3 denervated) or six days later (from a total of 10 rats; 5 controls and 5 denervated), and stored at -80°C for mRNA studies, or fixed in Bouin's fixative for histochemical procedures. The time for ovary harvesting after denervation was established by previous studies from our group [
29].
Immunohistochemistry
Immunohistochemical detection of VEGF and TGFβ1 in denervated ovaries and cultured tissues was performed as follows: the ovaries were fixed by immersion in Bouin's fixative, embedded in paraffin, serially sectioned at 4 μm and processed for immunohistochemistry using polyclonal antibodies from Santa Cruz Biotechnology (anti-VEGF [C-1], sc-7269 and anti-TGFβ1 [V] sc-146, both in a 1:50 dilution). Tissue sections were incubated overnight at 4°C with the antibody and the immunoreaction was developed the next day using the NBT-BCIP procedure (Sigma Chemicals, St Louis, MO, USA) for VEGF in neonatal rat ovaries, or the DAB procedure (LabVision Co, Freemont CA, USA) for the rest of the detections. Controls consistent of adjacent sections incubated without the primary antibody, or sections incubated with the antibody preabsorbed with the corresponding ligand showed no staining, proving the specificity of the immunoreaction. Whenever a well defined mark was obtained, cell counting was performed by three independent observers and the data were expressed as H-Score. The H-Score is the sum of the proportion of cells showing different degrees of reactivity, and was calculated as follows: 0 times the % of negative cells + 1 time the % of weakly positive cells + 2 times the % of moderately positive cells + 3 times the % of strongly positive cells. The H-Score ranges from 0–300, being the maximum score representative of a 100% of cells with strong positivity [
31]. In the case of diffuse mark, staining intensity was evaluated with an automated digitizing system (UN-SCAN-IT gel 4.1, Silk Scientific Co, USA) and the data were expressed as number of pixels.
Immunohistochemical detection of endothelial cell marker PECAM-1 in denervated ovaries was performed using an antibody from Santa Cruz Biotechnology (anti-PECAM-1 [M-20] in a 1:100 dilution). Tissue sections were incubated with the antibody overnight at 4°C and the immunoreaction was developed the next day using the DAB procedure (LabVision Co, Freemont CA, USA). Controls consisted of adjacent sections incubated without the primary antibody. The area of positive staining was evaluated with an automated system (Image J 1.36b, NIH, USA) and the data were expressed as % area of the ovary section.
RNA extraction and reverse transcription reaction
Total RNA was extracted from rat ovaries using guanidine isothiocyanate and phenol-chloroform extraction (Trizol Reagent, Invitrogen, Foster City CA, USA) following the manufacturer's protocol. Concentration and purity of RNA were measured using a spectrophotometer at 260 and 280 nm. First strand cDNA was synthesized in a 20 ml reaction mixture using 1 μg of total RNA. The reaction tubes contained 0.5 μl random hexamers (500 ng/μl, Invitrogen, Foster City CA, USA), 1 μl dNTPs (10 mM, Invitrogen, Foster City CA, USA), 4 μl 5× reaction buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl2, Invitrogen, Foster City CA, USA), 2 μl DTT (0.1 M, Invitrogen, Foster City CA, USA), 1 μl ribonuclease inhibitor (10 U/μl, Invitrogen, Foster City CA, USA) and 1 μl M-MLV reverse transcriptase (200 U/μl, Invitrogen, Foster City CA, USA). Reactions were incubated at 37°C for 60 minutes and inactivated by freezing.
Polymerase chain reaction
The specific primer sequences for the examined genes and the predicted PCR product sizes are shown in Table
1. The cDNA was amplified in a 25 μl reaction mixture using 1 μl of single-strand cDNA. PCR conditions were as follows: 2.5 μl 10 × reaction buffer (200 mM Tris-HCl pH 8.4, 500 mM KCl, Biotools, Madrid, Spain), 1 μl MgCl2 (50 mM), 0.5 μl dNTPs (10 mM each), 1.25 μl each primer (10 μM, Polyscience, Santiago, Chile), 0.15 μl DNA polymerase (5 U/μl, Biotools, Madrid, Spain). Reaction mixtures were incubated in a thermal cycler (Eppendorf, Foster City CA, USA) for 2 minutes at 94°C. Then 23, 27, or 28 cycles were performed for cyclophilin, VEGF and TGFβ1 respectively including: denaturation at 94°C for 45 seconds, annealing at 62°C for 1 minute and extension at 72°C for 1 minute. The optimal number of cycles was experimentally determined by analyzing the exponential phase of amplification reaction (data not shown). The PCR products were separated on Tris-borate-EDTA 2% agarose gels containing 200 ng/ml ethidium bromide (Invitrogen, Foster City CA, USA). DNA size markers were run in parallel to validate the predicted sizes of the amplified bands (100-bp DNA ladder, Biotools, Madrid, Spain). The gels were visualized under UV light, photographed using a capturing program (Ultra Violet Products Doc-It), and analyzed with an automated digitizing system (UN-SCAN-IT gel 4.1, Silk Scientific Corporation, Orem UT, USA). Differences between the experimental versus control conditions, were obtained by the ratio of the intensity between specific gene and constitutive gene of each sample, determined by densitometry.
Table 1
Primer sequences used for PCR of cDNAs
VEGF | F: GCCAGCACATAGGAGAGATGAG R: ACCGCCTTGGCTTGTCAC | 234, 102 | Adapted from [45] |
TGFβ1 | F: AAGTGGATCCACGAGCCCAA R: GCTGCACTTGCAGGAGCGCA | 246 | [46] |
Cyclophilin | F: CTTTGCAGACGCCGCTGTCTCTTTTCGCCG R: GCATTTGCCATGGACAAGATGCCAGGA | 350 | [47] |
Statistical analysis
The differences in mRNA levels, immunoreactivity and area of positive staining were analyzed using Mann Whitney test.
Discussion
The present study shows that NGF increased the expression of the angiogenic factor VEGF and the area of blood vessels detected by the endothelial cell marker PECAM-1, making a connection between two essential processes in ovarian physiology, such as angiogenesis and ovulation.
There is an increase of both NGF and its receptor trkA a few hours before ovulation in the rat ovary; this seems to be a critical step in the ovulatory cascade, since the use of a neutralizing antibody to NGF or a blocker of trkA activity inhibits the ovulation [
19]. In this periovulatory time and specially following ovulatory rupture, there is period of intensive follicular/luteal vascularization, in which angiogenic growth factors such as VEGF, essential for endothelial cell proliferation, become highly expressed [
1,
7].
Finding VEGF expression in the neonatal ovary suggests that VEGF could also have actions different from neovascularization in early stages of ovarian development (e.g. proliferation of somatic cells or increased vessel permeability to allow extravasation of nutrients and hormones). NGF induced an early VEGF mRNA increase in neonatal rat ovaries. The explanation of this rapid response could lie on the presence of trkA in the rat ovary shortly after birth [
32]. Indeed, NGF has been found necessary not only during the ovulatory process: ovaries from NGF-null mutant mice have a reduced population of primary and secondary follicles, a higher number of oocytes that are not incorporated into follicles, and a reduction in cell proliferation. [
33]. Immunoneutralization of NGF during early postnatal life of the rat impairs the growth of antral follicles and delays puberty [
18]. In this respect, the NGF/trkA complex may act as a regulator of ovarian VEGF expression in the first days of postnatal life of the rat.
This study shows that NGF can increase two mayor angiogenesis-related parameters within the ovary: 1) the expression of VEGF, an ovarian pro-angiogenic molecule, and 2) the amount of ovarian blood vessels. It remains to be elucidated if the increase in blood vessels is a consequence of NGF binding to trkA receptor in endothelial cells, or is mediated by the increase of VEGF, but it is reported that NGF is able to activate endothelial cell proliferation independent of VEGF [
34]. VEGF 120 and VEGF 164 mRNAs did not change after three or six days of SON denervation, a result that could be explained by the early response of neonatal ovaries exposed to NGF.
NGF did not modify TGFβ1 expression, either in neonatal or in prepubertal rat ovaries. This, in addition to previously informed data in the hamster ovary that the expression of TGFβ receptors mRNA changed cyclically [
13], suggest that TGFβ1 action on ovarian cycle might be controlled at TGFβ receptor expression rather than ligand level. On the other hand, it is known that NGF is able to modulate the expression of TGFβ receptors in grafted adrenal chromaffin cells, by reducing the level of TβRII mRNA [
35]. Then, it would be very interesting to study the NGF effect on TGFβ receptors expression in the ovary to better understand this mechanism.
Defects in angiogenesis regulation can be related with a variety of pathologies, like hemangioma, psoriasis and most of neoplasic conditions [
36‐
38]. Women suffering from polycystic ovaries have an increased ovarian blood flow, which is probably associated with the higher serum VEGF levels found in these patients [
39]. An elevation of ovarian NGF and p75 is observed in rats with steroid-induced polycystic ovaries, and the intraovarian administration of a neutralizing antiserum to NGF in conjunction with an antisense to p75 normalized estrous cyclicity and ovulatory capacity in a majority of the animals [
40]. It cannot be discarded that fertility disorders like polycystic ovary, or others associated with impaired angiogenesis have a genesis in a deregulation of NGF expression or function that results in aberrant production of VEGF. Finally, our group has demonstrated that VEGF is regulated by NGF in epithelial ovarian cancer [
41].
Accumulating evidence about the importance of the neurotrophins and their receptors in ovarian physiology has appeared [
14‐
16]. In addition to NGF, also BDNF, NT3 and NT4 have been described in the neonatal ovary [
32,
42] and some of them have been associated with early follicular development [
32]. NGF and trkA have been involved in processes such as steroidogenesis, FSH receptor expression and proliferation of somatic cells in rodent and human ovary [
17,
43,
44]. Our results are the first to relate NGF with ovarian angiogenesis and confirm the angiogenic effects of NGF in the rat ovary, giving new insight for a role of NGF in the mammalian ovarian function.
Conclusion
PCR and immunohistochemistry studies showed that NGF can increase VEGF expression in cultured neonatal rat ovaries. This was verified in an in vivo model: prepubertal rats with a dissection of the superior ovarian nerve – performed to increase the local levels of NGF – had also increased VEGF immunoreactivity within the ovary on the day six after denervation. TGFβ1 expression was not modified by NGF in any of the models under study.
In prepubertal rats NGF is able to increase the area of ovarian vessels, as shown by endothelial cell staining. The % area of PECAM-1 positive staining was increased in rats denervated for 3 and 6 days, when compared to control animals.
In summary, the present study shows that NGF increases the expression of the angiogenic factor VEGF and the area of blood vessels in the rat ovary, two major events of the periovulatory period that are fundamental for ovarian physiology.
Competing interests
The author(s) declare that they have no competing interests.
Authors' contributions
MJ-P carried out the experimental design, performed the tissue cultures, immunohistochemistries and PCR studies, statistical analysis, interpretation of data and drafted the manuscript. HEL performed the rat surgeries and contributed to draft the manuscript. JAB helped with the rat surgeries and contributed to the data analysis and to draft the manuscript. CR participated in the design and coordination of the study, contributed to the data analysis and helped to draft the manuscript. All authors read and approved the final manuscript.