FSH regulates acetycholine production by ovarian granulosa cells

Paraffin-embedded, fixed human ovaries (n = 3) were from patients undergoing gynecological surgery. The procedures were approved by the local Ethics Committees and patients gave written consent to the use of tissues. Additional samples (n = 4) were from a tissue bank, as described [17]. Sections (10 μm) were cut and used for immunohistochemistry.

Monkey ovarian samples (obtained at necropsy or during surgery for unrelated reasons at the ONPRC-OHSU) were from postnatal day 0, 1, and 3–17 years of age, total of 10 samples). The care and housing of rhesus macaces (Macaca mulatta) at the ONPRC was previously described [11, 17]. Animal protocols and experiments were approved by the ONPRC Animal Care and Use Committee, and studies were conducted in accordance with the NIH Guide for the Care and Use of Laboratory Animals. Sections (10 μm) were cut from all paraffin-embedded samples and were used for immunohistochemistry.

Mouse and rat ovarian samples used (from embryonic stages, i.e. post coitus (p.c.) 17, 18, 20, postnatal day 0, day 1 and adult) were derived from previous studies [7, 18‐20].

ChAT knockout (-/-) mice were generously provided by Fred Gage and Kuo-Fen Lee [21]. Mice were genotyped as described [21] using primers ATGATGACAGGCAACAAGAAGC, CTTCCATTTGTCACGTCCTGC and AGGGATGAGAATGGGTGGAGCC, which resulted in PCR products of 240 bp for the wildtype gene and 364 bp for the knockout gene, respectively. Heterozygous males and females were mated and the day of conception was determined by presence of a vaginal plug or sperm in the vagina. Fetuses were obtained by caesarian section on day 18 p.c. and ovaries dissected out. Fetuses were genotyped from tail DNA and ovaries from ChAT (-/-) and wildtype control mice (+/+) were fixed in Bouin's and embedded in paraffin. Sections (10 μm) of 5 ovaries of each group were made and were stained with H.E.

The ABC method and DAB as a chromogen were used for immunohistochemistry, while FITC-labeled secondary antiserum was used for immunofluorescence. All procedures were performed as described [9, 11, 20, 22]. A specific mouse anti ChAT monoclonal antibody (1:500 to 1:1,000; Boehringer Mannheim, Mannheim, Germany) was used. For controls, incubation with mouse normal serum, IgG or buffer without the specific antibody was employed, as described. Incubations with the primary antibody were carried out overnight at 4°C, incubations with the secondary antiserum were done at room temperature for 2 h.

We studied whether ACh is present in adult rat ovaries. To this end ovaries from 11 adult rats, used in unrelated experiments, were examined. Animals were kept at the animal house of the Technical University of Munich and killed according to NIH/local animal care guidelines.

Ovaries were rapidly removed, frozen on liquid nitrogen and ACh was either determined using the HPLC method, as described previously (n = 6 adults; see [7, 8]) or a fluorescence-based method (5 adults). To perform the latter, each ovary was homogenized in 500 μl cold 10 mM PBS on ice and samples were either stored at -80°C until use or were used immediately. Before measurement they were centrifuged and the supernatant was subjected to ACh detection using the Amplex Red Acetylcholine Assay kit (Molecular Probes/Invitrogen GmbH, Karlsruhe, Germany).

Briefly, in this assay ACh is hydrolyzed by ACh esterase (AChE), the choline formed is then oxidized by choline oxidase, and the H₂O₂ resulting from this reaction, interacts with Amplex Red (7-dihydroxyphenoxazine) in the presence of horseradish peroxidase to form the highly fluorescent resorufin. The samples were transferred into a 96-well plate and measured in a fluorescence plate reader (BMG Labtech GmbH, Offenburg, Germany) every 5 min for 40 min. All measurements were performed in triplicates. As this assay detects not only ACh, but also choline, we measured each sample in the absence of AChE, as well. Sensitivity of the assay was as low as 0.3 μM, with a range of detection from 0.3 μM to 100 μM ACh. For quantification purposes, ACh solutions in the range of 0 μM to 3 μM were measured, and a calibration curve was generated from the values obtained. The ratio of fluorescence intensities obtained in the presence of AChE divided by those in its absence was 1.2 ± 0.1 (n = 5 ovaries from 5 animals; mean ± SD; one-sample t-test, P = 0.0014). A value larger than one indicates that ACh was present in the samples. The choline detected by the assay can derive from endogenous sources and/or originate from non-enzymatic hydrolysis of ACh and/or from enzymatic hydrolysis of ACh by intrinsic esterase activity of the tissue. Thus, to semi-quantitatively assess ACh concentrations we subtracted the choline values obtained in absence of AChE from those in its presence.

GFSHR-17 cells are derived from antral rat follicles, but are not able to produce estrogens [23]. Yet, they respond to FSH [6, 23]. All methods, including description of culture conditions have been reported in detail [23]. In brief, cells were cultured with Dulbecco modified Eagle medium Ham's F12 (1:1 (v/v); Biochrom KG, Berlin, Germany) containing 5% fetal calf serum (Biochrom KG, Berlin, Germany). Cells were maintained in culture for up to 25 passages and were treated as indicated with/without porcine (p) FSH (0.5 IU/ml; Sigma, Deissenhofen, Germany) for 24 h and with lower concentrations for pilot studies. As reported previously, pFSH only slightly stimulates progesterone production by GFSHR-17 cells [23]. Cellular content of ACh was determined (8 samples/group from 3 independent experiments) as described previously [7, 8, 16] and was normalized to cellular protein. Results are expressed as means ± SEM. Statistical significance of changes was determined using t-test.

ChAT immunoreactivity, as expected, was observed in human, monkey and rat adult ovaries only in GCs of large antral follicles, but not in small follicles (see Fig. 1 and 2). Immunoreactive nerve fibers, expected to be present in interstitial or thecal areas and around blood vessels, were not observed. ChAT was absent from neonatal or postnatal (day 0 and 6) rat ovary (Fig. 2). Likewise, neonatal (day 1) monkey ovaries were devoid of ChAT immunoreactivity, as were rat and mouse embryonic (p.c. 18) ovaries (Fig. 2, 3; rat not shown).

Furthermore ovarian development in embryonic mutant mice null for ChAT was normal with respect to organ size and cellular composition, ruling out an involvement of ACh in the early ovarian development (Fig. 3).

Expression of ChAT in adult rat ovaries is associated with the presence of ACh (n = 6); the mean value was 2.47 ± 0.90 pmol (mean ± SEM) as detected by a HPLC technique. The presence of ACh in rat ovaries was corroborated using a fluorescence technique (n = 5), and the values obtained ranged between 22 and 60 pmol (mean ± SEM: 43 ± 7 pmol).

Since follicular growth and GC development depend on FSH, we hypothesized that ACh production may be stimulated by the gonadotrophin. To test this possibility we determined the production of ACh in the rat GFSHR-17 cell line challenged with pFSH for 24 h. This cell line stably expresses the FSH receptor and is immunoreactive for ChAT (Fig. 4). Using a HPLC detection system, we found a statistically signifcant increase in ACh production (p < 0.05; Fig. 4C).