Background
Embryo implantation is a complex process requiring a plethora of regulatory molecules, including proteases, cytokines and chemokines (reviewed in [
1]). Failure of implantation accounts for approximately 75% of human pregnancy loss before 20 weeks of gestation, and is a major limiting factor in assisted reproduction [
2,
3]. Embryo implantation requires a healthy embryo and a receptive uterus that are synchronously developed. The uterus must undergo significant morphological and physiological changes to prepare for implantation [
1]. In humans, two uterine events critical for implantation are the establishment of epithelial receptivity and stromal cell decidualization [
4].
The proprotein convertases (PCs) are a family of 7 proteases that endoproteolytically cleave latent precursor proteins into their biologically active states (reviewed in [
5]). PCs generate a large number of tissue-specific and functionally important bioactive proteins, and as such, they act as regulatory "master switches" by influencing cell proliferation, motility, adhesiveness and invasion [
5]. PCs have been associated with a number of human diseases, including cancer, and are recognised as potentially important therapeutic targets [
5‐
7].
PC5/6 is the only PC member that is associated with uterine remodelling and important for embryo implantation. PC5/6 is up-regulated in the uterus specifically at implantation in the mouse and human [
8‐
10]. In mice, PC5/6 is up-regulated specifically in decidualizing stromal cells adjacent to the implanting embryo at the time of attachment and implantation [
9]. PC5/6 is the only PC involved in decidualization in mice [
10]. In women, PC5/6 is likewise dramatically increased during decidualization prior to implantation and intensifies with implantation establishment [
11,
12]. In contrast to the mouse, PC5/6 is also expressed in the uterine epithelium across the menstrual cycle in women peaking during the receptive phase, in addition to the decidual cells [
12]. PC5/6 is the only PC tightly regulated in this manner [
10,
11,
13]. Therefore, PC5/6 is likely to be involved in the establishment of epithelial receptivity as well as stromal cell decidualization in the human uterus.
Knockdown of PC5/6 prevents decidualization of human endometrial stromal cells in culture [
14], and blocking PC5/6 uterine production inhibits decidualization and embryo implantation in mice [
12], proving PC5/6 is critical for decidualization. The precise mechanisms of PC5/6 action in the uterine epithelium remain to be determined. Given that PC5/6 primarily regulates decidualization in the mouse, mice are a powerful
in vivo model to investigate the functions of PC5/6 in decidualization. However, major uterine epithelial differences exist between rodents and humans, including the presentation of cell surface glycosylation and selectin ligands [
15,
16], and that PC5/6 is not expressed in the non-pregnant mouse uterine epithelium. Thus, an appropriate non-mouse animal model relevant to human implantation is required to investigate the
in vivo function of PC5/6 in the uterine epithelium.
The rabbit is regarded as an excellent model to study the molecular events of embryo adhesion and attachment, as it employs a typical centric or fusion type of implantation in which the blastocyst adheres solely to the apical epithelial cells [
17,
18]. Given that rabbits are obligate ovulators, both pseudo-pregnancy and pregnancy can be precisely triggered, and ovulation (10 h after mating or hormonal treatment), embryo apposition and attachment (day 6.5-7) precisely timed. Furthermore, the rabbit uterus undergoes a dramatic transformation in the days after ovulation, such that days 1-4 and 4-7 are in some degree analogous to the proliferative and secretory phases of the primate menstrual cycle, respectively [
19]. Rabbits have been used previously to investigate molecules associated with embryo attachment and implantation, including integrins, osteopontin, epidermal growth factors, mucin 1 and leukaemia inhibitory factor [
18,
20‐
23].
This study aimed to establish whether uterine PC5/6 is associated with embryo implantation in rabbits. The temporal and spatial expression pattern of PC5/6 was determined in the rabbit uterus during early pregnancy and pseudo-pregnancy. Real-time RT-PCR and Western blot analysis examined PC5/6 mRNA and protein, respectively. The cellular localization and expression pattern were also determined by immunohistochemistry. The results demonstrate that uterine PC5/6 is dynamically regulated in the rabbit during implantation, especially in the epithelium, suggesting that the rabbit will provide a useful animal model to examine the roles of PC5/6 in uterine epithelium for embryo attachment.
Methods
Animals
New Zealand White rabbits aged 3-4 months (2.6-3.2 kg) were maintained at Shanghai Institute of Planned Parenthood Research Animal Facility under controlled conditions (14 h light-10 h dark cycle, 22°C) with free access to food and water. All experimentation was performed in compliance with the laboratory animal care protocols approved by the Institutional Animal Care Committee of the Shanghai Institute of Planned Parenthood Research.
Virgin female rabbits were mated with males of the same strain, with the time of mating designated as day (d) 0 of pregnancy. Animals were euthanased at various time points following mating (d0, 1, 3, 5, 6, 6.5, 7, 8 and 10, n = 3 each) by injecting 20 ml air into the auricular veins. To induce pseudo-pregnancy, rabbits received an i.m. injection of 20 IU pregnant mare serum gonadotrophin, and 72 h later, an i.m. injection of 0.8 μg of gonadotrophin-releasing hormone (GnRH). Ovulation was confirmed in each animal by the presence of the corpus luteum in each ovary.
Uterine tissues were collected at each time point, and either snap-frozen in liquid nitrogen for RNA and protein analysis, or fixed in 4% paraformaldehyde (in 0·1 M sodium phosphate buffer pH 7.4) for 48 h followed by paraffin-embedding for immunohistochemistry. From the pregnant rabbits, implantation (Imp) and inter-implantation (Inter) site tissues were collected separately for RNA (d6.5 onwards, n = 3) and protein (d7.5 onwards) analysis.
RNA isolation and real-time PCR analysis
Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA) as per the manufacturer's instructions. Contaminating DNA was removed using a DNAse free kit (Ambion, Austin, TX). RNA quality and quantity was assessed by optical densitrometry (Nanodrop, ThermoFisher Scientific, Waltham MA). Reverse transcription was performed using 500 ng RNA with SuperScript VILO cDNA synthesis kit (C#11754, Invitrogen, Carlsbad, CA), and the resulting products were snap-frozen and stored at -80°C.
Quantitative real-time PCR analysis was performed using the Corbett Rotorgene 3000 (Corbett Lifesciences, Sydney, Australia) with the FastStart DNA Master SYBR-Green 1 system (Roche Applied Sciences, Basel, Switzerland). Oligonucleotide sequences and conditions for PC5/6 and 18S amplicons are shown in Table
1. For quantification, a reference cDNA was prepared from a rabbit uterine tissue for quality control and standard. After 38 cycles, a melting curve analysis was performed to monitor PCR product purity. In initial experiments, amplification of a single PCR product was confirmed by agarose gel electrophoresis and DNA sequencing. Data was normalised to 18S and the mean from each triplicate samples from three animals were compared.
Table 1
Primer sequences and conditions used for quantitative PCR analysis
PC5/6 | F: TCTGACCTGGAGAGACGTAC R: TGTCTTGATATGTCGATCTG | 221 | 55 | 9 | 3.0 |
18S | F: CGGCTACCACATCCAAGGAA R: GCTGGAATTACCGCGGCT | 187 | 64 | 8 | 3.0 |
Western blot analysis
Frozen uterine tissues were thawed and homogenized using a glass homogenizer in extraction buffer, containing 6.0% (w/v) SDS, 0·14 mol/L Tris-HCl (pH 6.8), 22.4% (v/v) glycerol, soybean trypsin inhibitor (10 μg/mL, Sigma, St. Louis, MO), PMSF (1 mmol/L, Sigma,), leupeptin and aprotinin (10 μg/mL each, Amresco, Solon, OH). The homogenates were centrifuged (14,000g/10 min) at 4 °C, the supernatant containing proteins was collected and protein concentrations were determined using the Bradford assay. Proteins (50 μg) were subjected to reducing 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membranes (ImmobilonTM-NC, Millipore Corporation, Billerica, MA, USA). The membrane was blocked for 1 h in 5% skim milk in 0.2% Tween-20 (Sigma, St. Louis, MO, USA), and probed overnight at 4°C with a previously characterized affinity purified polyclonal sheep anti-human PC5/6 antibody (25 μg/ml in blocking solution, Nie et al., 2005b). The membrane was incubated for 1 h with HRP-conjugated donkey anti-sheep IgG (Milllipore, Billerica, MA, 1:10,000 dilution in blocking solution) at room temperature, and the signal visualized by chemiluminescent detection (Thermo Scientific, Rockford, IN). The membrane was subsequently stripped and re-probed with a β-actin antibody (Cell Signaling, Danvers, MA).
Immunohistochemical analysis
Immunohistochemistry was performed using the sheep PC5/6 antibody (n = 3 sites per animals, n = 3 animals for each time point) as previously described [
8]. Briefly, formalin-fixed paraffin sections (5 μm) were de-waxed in histosol (Sigma), rehydrated, and subjected to antigen retrieval by microwave (5 min/700W followed by 5 min/140 W) in 0·01 mol/L sodium citrate buffer (pH 6.0). Endogenous peroxidase activity was quenched with 6% H
2O
2 (diluted 1:1 v/v in 100% methanol) for 10 min at room temperature. Nonspecific binding was blocked by incubation with 15% normal rabbit serum and 5% fetal calf serum in TBS containing 0.1% Tween-20. Primary antibody was applied (10 μg/mL) at 37 °C for 2 h. Following washing in TBS, slides were incubated with biotinylated rabbit anti-sheep IgG (1:200 dilution, Vector Laboratories, Burlingame, CA) for 30 min at room temperature. Signal was amplified using Vectastain ABC amplification (Vector Laboratories) for 30 min and positive localization visualized using the peroxidise substrate 3, 3'-diaminobenzidine (DAB, Dako, Kingsgrove, Australia) which produced a brown precipitate. Tissue sections were counterstained with Harris' hematoxylin (Sigma Chemicals, St Louis, MO), dehydrated, and mounted with DPX (ProSciTech, Thuringowa, Australia). Negative controls were included for each section, where pre-immune sheep IgG was substituted for the primary antibody at a matching concentration. The localization of staining was assessed by two investigators who noted expression patterns, for which representative images were recorded.
Statistics
Unless otherwise noted, all measurements were on samples from three separate animals, from which the mean and SEM were calculated. All statistics were performed using SigmaStat version 3.5 (Systat Software, Inc., San Jose, CA). Homogeneity of variance was assessed for all groups by normality and equal variance tests. Experiments in which variation followed a normal distribution were assessed using a one-way ANOVA, followed by the Student-Newman-Keuls post hoc multiple group comparisons test for significance. P value of < 0.05 was used as a cut-off for statistical significance.
Discussion
This study established that dynamic expression of PC5/6 in the rabbit uterus is closely associated with embryo implantation and pregnancy. Uterine PC5/6 mRNA was up-regulated just prior to embryo attachment on d6 of pregnancy, which was maintained throughout implantation between d6.5-10. In contrast, no such changes were observed in the pseudo-pregnant rabbits as they displayed a low and static PC5/6 mRNA level throughout the 10 days of pseudo-pregnancy. Western blot analysis revealed a preferential up-regulation of PC5/6 protein at embryo implantation sites. Immunohistochemical analysis confirmed this pattern and illustrated that PC5/6 protein level and cellular localization changed according to pregnancy stage. Prior to embryo attachment, PC5/6 expression is low and localised primarily in the luminal epithelium and endometrial glands. Subsequently, PC5/6 expression increased in the deep basal glands and mucosal folds just prior to embryo attachment, and then strongly intensified in the multinucleated luminal symplasma and decidual cells at the site of embryo implantation from d7-10. In contrast, no obvious change in either PC5/6 expression or cellular localization occurred across 10 days of pseudo-pregnancy. This study thus demonstrates that uterine PC5/6 up-regulation is pregnancy-stage, and implantation-site specific.
The overall pattern and cellular localization of PC5/6 in the rabbit uterus during early pregnancy is more analogous to that of the human than the mouse. In both the human and mouse uterus, PC5/6 is specifically expressed in the decidual cells in the stromal compartment, but glandular and luminal epithelial expression is only observed in the human uterus [
8,
9]. This study identified uterine PC5/6 expression in both the epithelium and decidual cells in the rabbit, as in the human, establishing the basis for using the rabbit as a model system to investigate the function of PC5/6 in the uterine epithelium. It is worth noting that in the rabbit uterus, even though the degree of stromal decidualization is minimal, decidualizing cells at the implantation site clearly expressed PC5/6, making decidual PC5/6 expression a common feature among mice, rabbits and humans.
Rabbit implantation employs a typical fusion type of implantation in which the blastocyst adheres solely to the luminal epithelial cells [
17]. Distinct up-regulation and immunolocalization of PC5/6 in the uterine epithelium at the site of implantation from the very early stages of attachment strongly indicates a role for epithelial PC5/6 in blastocyst adhesion. The apical surface of the endometrial epithelium is constitutively non-adhesive (thus non-receptive) except during implantation. Conversion from a non-receptive to receptive state requires the epithelial cell acquisition of surface components required for receptor-ligand interactions, and alterations/modifications to adhesion molecules. During receptivity, the apical glycocalyx is reduced, and the normally abundant apical microvilli gradually retract, generating a flattened epithelial surface for blastocyst adhesion [
25]. PC5/6 is known to endo-proteolytically activate a number of important adhesion molecules including neural adhesion protein-L1 [
26] and integrins [
27,
28]. Of note, the intergrins are among the best characterized markers of uterine receptivity in a number of species including the rabbit [
25]. Indeed, functional studies have confirmed that the α
vβ
3 integrin complex is important for implantation in the rabbit [
22]. It is thus possible that PC5/6 mediates integrin activation in the epithelium for embryo attachment and implantation in the rabbit.
PC5/6 can interact with heparin sulfate proteoglycans (HSPGs), thereby recruiting itself to the cell surface to activate a number of HSPG-binding proteins at the cell periphery or in the extracellular space [
29,
30]. HSPGs and HSPG-binding proteins participate in cell adhesion during implantation [
25]. One such HSPG molecule is heparin-binding EGF-like growth factor (HB-EGF), whose expression is dramatically increased during pregnancy and restricted to implantation sites [
31]. Since PC5/6 has been suggested activate HB-EGF on the cell surface [
29,
30], it is likely that PC5/6 regulates adhesion molecules and other cell surface proteins, in the endometrial epithelium during embryo attachment.
Pseudo-pregnancy is commonly used to investigate whether the expression of a particular gene is hormone-dependent or requires the presence of a blastocyst. This study suggests that PC5/6 regulation in the rabbit uterus is complex and pregnancy-specific. Prior to embryo attachment, PC5/6 expression and localization was comparable between pregnant and pseudo-pregnant uteri. Immediately prior to initial embryo attachment, PC5/6 mRNA was specifically up-regulated in the pregnant uterus, and PC5/6 protein was distinctly localised at the site of embryo attachment. This pattern of expression is consistent in principle with mouse and human studies. In the mouse, PC5/6 is up-regulated only at the site of embryo attachment, and this expression intensifies with increasing implantation stages [
9]. In the human, PC5/6 expression in the decidual cells increases with implantation establishment [
8]. Further studies are needed to address the contribution of the blastocyst and/or the blastocyst-endometrium interaction to promote PC5/6 expression. Future studies are required to determine the importance of PC5/6 in implantation in the rabbit, by direct inhibition of PC5/6 production or activity in the rabbit uterus
in vivo.
Correspondence to: Guiying Nie, Ph.D., Prince Henry's Institute of Medical Research, 246 Clayton Road, Clayton, Victoria 3168, Australia. E-mail: http://guiying.nie@princehenrys.org. Phone: +61 3 9594 4380. Fax: +61 3 9594 6125
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
PKN carried out the RNA and immunohistological analyses, and assisted in the drafting of the manuscript. ZS carried out the animal studies and assisted in the tissue collection SH carried out the protein analyses YL assisted with the RNA and immunohistological analyses. JW supervised the animal studies and assisted in the tissue collection GN conceived and designed the project, supervised the overall project and prepared the manuscript. All authors read and approved the final manuscript.