Eosinophils may play regionally disparate roles in influencing IgA⁺ plasma cell numbers during large and small intestinal inflammation

At day 21 and 35 following a low dose (20 egg) T. muris infection, we quantified large intestine eosinophilia and analysed eosinophil distribution using immunohistochemical staining with the eosinophil-specific marker Siglec-F [17]. A significant intestinal eosinophilia was observed in wild-type mice, with an influx of eosinophils primarily into the lamina propria of the large intestine evident at day 21 post-infection, subsiding back to naïve levels by d35 post-infection (Fig. 1a–c; One-way ANOVA F (2,13) = 7.835, p = 0.0059 with a post-hoc Dunnett’s test showing an effect at d21 compared to naïve (p < 0.01)). To determine if the same trend was also observed in the small intestine post-infection, mice were orally infected with 1 million T. gondii tachyzoites, using a Type II strain (Pruginaud). Infection with T. gondii also resulted in a significant eosinophilia, this time in the small intestine at d10 post-infection, returning to naïve levels by d13 post-infection, and with eosinophils residing primarily in the lamina propria (Fig. 1d–f; One-way ANOVA F (2,12) = 19.83, p = 0.0002 with a post-hoc Dunnett’s test showing an effect at d10 compared to naïve (p < 0.001)).

To determine the effect of eosinophil-deficiency on plasma IgA⁺ cell numbers post-infection, ΔdblGATA-1 and wild-type mice on a BALB/c background were infected with T. gondii. ΔdblGATA-1 mice harbour a deletion within the Gata1 promoter, which prevents the development of mature eosinophils [18]. IgA⁺ cells in the GIT sections were quantified by immunohistochemistry, staining with an anti-IgA antibody which has been described as a marker of gut plasma cells [19]. In the small intestine ΔdblGATA-1 mice had a non-significant decrease in the number of IgA⁺ cells in steady state, compared to BALB/c mice, which reached significance following T. gondii infection (Fig. 2a, c–f; Two-way ANOVA showed a significant effect of genotype F (1,30) = 28.72, p < 0.001 with a post-hoc Bonferonni test showing a significant effect at d10 (p < 0.0001) and d13 (p < 0.05) post-infection), although there was no significant increases in IgA⁺ cell numbers in mice of either genotype post-infection. In contrast, in the large intestine, which is not exposed to the parasite, no significant changes in IgA⁺ cell numbers were observed post-infection or in the absence of eosinophils (Fig. 2b). Additionally, plasma cells, defined as B220^loCD138⁺, were analysed in mesenteric lymph nodes (MLN). No significant changes were observed post-infection or in the absence of eosinophils (Fig. 2g). Importantly, ΔdblGATA-1 and wild-type mice harboured similar parasite burdens, with no significant differences in brain cysts at the time points analysed (Fig. 2h); this allows the parasite to be used purely as a driver of inflammation without the addition of any confounding factor.

Although IgA⁺ plasma cells numbers was assessed in the large intestine following T. gondii PRU infection, the infection does not reach the large intestine. We therefore chose to analyse large intestinal IgA⁺ cell numbers during inflammation driven by a T. muris low dose infection of ΔdblGATA-1 and wild-type mice on a BALB/c background. T. muris specifically infects the caecum and proximal colon of mice and drives a large-intestinal inflammatory response. In naïve mice we detected no significant differences in IgA⁺ cell numbers between BALB/c and ΔdblGATA-1 mice (Fig. 3a). However, we observed an increase in IgA⁺ cells in the large intestine of both ΔdblGATA-1 mice and BALB/c mice post-infection (Fig. 3a–e) (Two-way ANOVA showed a significant effect of infection F (2,42) = 63.79, p < 0.0001 with a post-hoc Bonferonni test showing a significant effect at d21 (p < 0.0001, BALB/c and ΔdblGATA-1 mice) and d35 (p < 0.05 ΔdblGATA-1 mice; p = NS BALB/c). Moreover as well as changes post-infection, an unanticipated significant effect of genotype was observed with significantly higher numbers of IgA⁺ plasma cells in the ΔdblGATA-1 mice (F (1,42) = 17.51, p = 0.0001 with a post-hoc Bonferonni test showing a significant effect (p < 0.0001) at d21 post-infection). Flow cytometry analysis of MLN cells demonstrated no significant effect of eosinophil-deficiency on plasma cells under steady state conditions, or at d21 or day 35 post-infection, suggesting that the observed changes were only local to the site of infection. However, there was a significant increase in plasma cells detected post-infection (Fig. 3f) (effect of time F (2,29) = 7.819, p = 0.0019 with a post-hoc Bonferonni test showing significance compared to naïve at d35 in BALB/c mice (p < 0.05), and at d21 (p < 0.01) and d35 (p < 0.05) post-infection in ΔdblGATA-1 mice). Comparably to the T. gondii infection, analysis of worm burden at d21 and d35 post-infection showed no significant differences between ΔdblGATA-1 and wild-type mice (Fig. 3g), allowing the infection to be used purely as a driver of inflammation without any confounding factors.

Although both types of infection utilised (chronic T. muris and PRU strain T. gondii) drive intestinal inflammation in mice, T. muris is a helminth whereas T. gondii is an intracellular protozoan parasite. In order to remove this confounding factor, mice were infected with the RH strain of T. gondii and the IgA⁺ plasma cell phenotype analysed in the two areas of the GIT. The RH type I strain of T. gondii is more virulent than the type II PRU strain, with the parasite reaching and causing inflammation in both the small and large intestine (unpublished observations). Analyses of ΔdblGATA-1 and BALB/c mice infected with RH demonstrated that the changes in IgA⁺ plasma cell numbers were independent of the type of parasitic infection. Thus, consistent with previous observations, significantly more IgA⁺ cells (Fig. 4a; p = 0.0302, Student’s t-test) were present in the large intestine, while significantly fewer IgA⁺ cells (Fig. 4b; p = 0.0239, Student’s t-test) were detected in the small intestine in ΔdblGATA-1 mice compared to BALB/c mice post-infection.

Having confirmed regional differences in the importance of the eosinophil in sustaining IgA⁺ plasma cells using the same parasitic infection (T. gondii RH), all subsequent experiments utilised low dose T. muris infections for analyses of the large intestine and T. gondii PRU infections for analyses of the small intestine, respectively. Although infection with T. gondii RH allowed simultaneous analysis of both the small and large intestine, the more virulent infection was associated with higher morbidity and therefore not utilised in further experiments.

As survival factors derived from eosinophils are important in the maintenance of plasma cells in the bone marrow [5], we analysed production of these factors in the small and large intestine of naïve and infected mice. Analyses of APRIL, IL-6, GM-CSF and BAFF by qPCR in the large intestine of naïve BALB/c and ΔdblGATA-1 mice and at d21 post-infection with T. muris revealed no significant differences in levels of any of the survival factors (Fig. 5a-d). Analyses of small intestine naïve tissue or d10 post-infection with T. gondii revealed an increase in APRIL mRNA in ΔdblGATA-1 mice (Two-way ANOVA showed a significant effect of genotype F (1,19) = 6.086, p = 0.0233, post-hoc Bonferonni tests were non-significant), but there were no significant differences in any other survival factors (Fig. 5e–h). The increase in APRIL expression in the small intestine of ΔdblGATA-1 mice is unlikely to underlie the decreased plasma cells observed in the small intestine of these mice as, if anything, an increased number of plasma cells would be expected.

As we observed no change in plasma cell survival factors that correlated with the regional changes in IgA⁺ plasma cell numbers observed in eosinophil-deficient mice, we investigated whether a change in plasma cell recruitment post-infection in the absence of eosinophils, might underlie the marked changes in plasma cell numbers. Both MAdCAM-1 [19] and CCL25 [20] are important in recruitment of plasma cells to the intestine. Following infection with T. muris, a significant increase in the number of MAdCAM-1 expressing cells was observed in the large intestine of both ΔdblGATA-1 and BALB/c mice (Fig. 6a-c; Two-way ANOVA showed a significant effect of infection F (1,26) = 9.413, p = 0.0050). In contrast, following infection with T. gondii no significant changes in MAdCAM-1 expression was observed in the small intestine (Fig. 6d–f; Two-way ANOVA, effect of infection p = NS). Importantly, we saw no difference in MAdCAM-1 protein expression between ΔdblGATA-1 and BALB/c mice in either the naïve or infected mice in the small or large intestine following infection with T. gondii or T. muris respectively (Fig. 6a–f) (Two-way ANOVA, effect of genotype p = NS). Moreover, no significant differences in CCL25 message were found in the large intestine in either naïve mice or following infection with T. muris, in the presence or absence of eosinophils (Fig. 6g). In contrast, in the small intestine there was an increase in CCL25 message following infection (Fig. 6h; Two-way ANOVA, significant effect of infection F (1,19) = 12.62, p = 0.0021; effect of genotype p = NS), with a significant increase detected at d10 post-infection between ΔdblGATA-1 and control mice (post-hoc Bonferroni test p < 0.05). Given that the number of plasma cells in the small intestine post-T. gondii infection was significantly lower in the absence of eosinophils, the importance of the upregulation of CCL25 in the small intestine of ΔdblGATA-1 mice is unclear, but may potentially reflect a compensatory mechanism. Collectively, our data suggests that eosinophil-dependent regulation of MAdCAM-1 or CCL25 does not underlie the reduction in plasma cell numbers in the small intestine and elevated plasma cell numbers in the large intestine observed in the ΔdblGATA-1 compared to wild-type mice.

Finally, to determine if the effect of eosinophil-deficiency on plasma cell numbers is due to altered local plasma cell proliferation, co-staining for Ki67 and IgA was performed on GIT sections from the small intestine of naïve and T. gondii-infected mice by double immunofluorescence. In both naïve and infected ΔdblGATA-1 and wild-type mice, no proliferating IgA⁺ plasma cells (Fig. 6i; IgA⁺Ki67⁺) were observed in any of the stained sections, suggesting that the lamina propria-resident plasma cells do not proliferate in situ.

BALB/c mice were purchased from Harlan U.K. (Bicester, U.K.). ΔdblGATA-1 mice on a BALB/c background were bred in-house. Male mice were used for all experiments. For T. muris infections mice were infected with 20 infective T. muris eggs when 8 –10 weeks old and sacrificed at various time points after infection. The maintenance of T. muris and the method of infection were as previously described [27], worm burden in the large intestine was assessed as previously described [28]. Tachyzoites of the type I eYFP expressing RH and the tandem dimeric tomato RFP- tagged type II Pruginaud (PRU) strains of Toxoplasma gondii, from Boris Striepen [29], were maintained by serial passage through confluent monolayers of human foreskin fibroblasts [30]. Mice were infected by oral gavage with 10⁶ RH or PRU tachyzoites and sacrificed at various time points post infection by exposure to carbon dioxide gas in a rising concentration. In order to ameliorate animal suffering mice were regularly weighed during infection and general appearance monitored, if any mice lost more than 20 % bodyweight they were humanely killed. All animal experiments were approved by the University of Manchester Animal Welfare and Ethical Review Board and performed under the regulation of the Home Office Scientific Procedures Act (1986) and the Home Office approved grant 40/3217.

Tissue samples from the junction of the caecum and large intestine, jejunum or brain were placed in TRIsure (Bioline, London, UK) and frozen on dry ice. Samples were homogenised using a FastPrep 24 and lysing matrix D (MP Biomedicals, Illkirch, France) and total RNA extracted according to the manufacturer’s instructions for TRIsure. Resulting RNA was quantified on a Nanodrop ND-1000 spectrophotometer (Labtech International, East Sussex, U.K.) and stored at −80 °C until used. 1.0 μg of RNA was treated with RNase-free DNase (Promega, Southampton, UK) and reverse transcribed using BioScript (Bioline) in a final volume of 30 μl according to the manufacturer’s instructions and stored at -20 °C.

Quantitative PCR was performed using KAPA SYBR FAST qPCR kit (KapaBiosystems) on a BioRad MyQ² Cycler with Optical System software version 2.1. Housekeeping genes GAPDH and YWAHZ were used as internal controls for gene expression. Expression levels of genes of interest are shown as fold change after normalisation to two housekeeping genes.

Parasite burden was assessed as previously described [31]. Briefly, Quantitative PCR was performed using KAPA SYBR FAST qPCR kit (KapaBiosystems) on a BioRad MyQ² Cycler with Optical System software version 2.1. Relative mRNA levels were calculated for toxoplasma cysts (Forward: CGTTTGGAGAAATGGTGTCCCAG; Reverse: CCGCCTGAGTATCCGCTTTTAC) by using an included standard curve for each individual gene and normalised to the housekeeping gene TBP (Forward: AACAGCAGCAGCAACAACAGCAGG; Reverse: TGATAGGGGTCATAGGAGTCATTGG).

Histological sections were prepared from proximal large intestine or jejunum and preserved in OCT. 6-μm sections were cut using a microtome and placed on polysine adhesion slides. Immunohistochemical staining for IgA was performed as follows. Slides were fixed in 4 % PFA on ice for 10 mins. Endogenous peroxidase was quenched by incubation with 1.5 U/ml glucose oxidase (Sigma, Gillingham, Dorset, U.K.) in the presence of 1.8 mg/ml glucose and 0.064 mg/ml sodium azide for 20 min at 37 °C. Non-specific binding was blocked with 7 % rat serum (Sigma) and endogenous avidin and biotin binding sites were blocked using a kit according to the manufacturer’s instructions (Invitrogen, Paisley, UK). Sections were then incubated with biotinylated rat anti-mouse IgA (5 μg/ml, BD Biosciences) in phosphate-buffered saline, followed by ABC (avidin-biotin complex) (Vector Laboratories) and 3,3′ Diaminobenzidine (DAB; Vector) and colour development monitored. Sections were counter-stained in HaemQS (Vector Laboratories) for 1 min, and mounted in aquamount (BDH, Lutterworth, UK). For MAdCAM-1 and Siglec F staining the same protocol was used but non-specific binding sites were blocked with 7 % goat serum (Invitrogen), a MAdCAM-1 (5 μg/ml, eBiosciences) or Siglec F primary antibody (5 μg/ml, BD Biosciences) was used followed by a biotinylated secondary goat anti rat Fab’ fragment antibody (1 μg/ml, Santa Cruz). For IgA staining 0.05 % Saponin was utilised in all washing and staining steps.

Slides were blinded and positive cells counted in a minimum of 20 crypts or 10 VCUs from 3 sections evenly distributed across the specimen. Images were acquired using a 20×/0.80 Plan Apo objective using the 3D Histech Pannoramic 250 Flash II slide scanner. Isotype control staining was performed and examined to confirm there was no non-specific staining (Additional file 1: Figure S1).

Histological sections were prepared from proximal large intestine or jejunum and preserved in OCT. 6-μm sections were cut using a microtome and placed on polysine adhesion slides. Slides were fixed in 4 % paraformaldehyde at 4 °C for 10 min. Sections were blocked using the tyramide blocking kit (PerkinElmer, Cambridge, UK) for 30 min. Endogenous biotins were blocked using the avidin/biotin blocking kit as per the manufacturer’s instructions (Invitrogen). Slides were first stained with biotinylated rat anti-mouse IgA (5 μg/ml, BD Biosciences), followed by a secondary avidin Texas-Red (Vector Lab, 30μg/ml). Slides were then incubated with the primary antibody Ki67-Alexa Flour® 488 (5μg/ml, BD Biosciences). Slides were washed and mounted with vector shield containing 4’,6-diamidino-2-phenylindole (Vector Lab). 0.05 % Saponin was utilised in all washing and staining steps.

The proportion of PCs in the MLN was assessed by flow cytometry. Single cell suspensions were incubated with Fc block prior to staining with Biotinylated-B220 or FITC-B220 and APC-CD138 (BD Biosciences) and subsequently Streptavidin-QDOT605 (Invitrogen). Samples were acquired using an LSRII (BD Biosciences) and data were analysed with FACSDiva (BD Biosciences) and FlowJo 10 (Tree Star).

Statistical analysis was performed using the Student’s t test or 2 WAY ANOVA with post-hoc Bonferonni’s test, as appropriate with the statistical package GraphPad Prism 6.04 (GraphPad Software, San Diego, U.S.A.). A probability value of <0.05 was considered significant (*p < 0.05, **p < 0.01, ***p < 0.001).