Expression of methionine adenosyltransferase 2A in renal cell carcinomas and potential mechanism for kidney carcinogenesis

A total of 55 paired ccRCC cancer tissues and adjacent normal tissues samples were obtained from the Biobank of Complex Diseases in Shenzhen between 2010 and 2012 in China. The adjacent normal tissues were defined as kidney tissues located 2.0 cm outside of visible ccRCC lesions. All the 55 patients’ survival information was received by telephone. The median follow-up period was 69 months (range: 4 ~ 116 months). Patients’ clinical characteristics (gender, age, size, nodal status, metastasis and Fuhrman Nuclear Grade) were obtained from the medical records (Table 1). No any treatment (chemotherapy or radiation) was used before the operation.

All resection samples were confirmed to be ccRCC by clinical pathology and carbonic anhydrase 9 (CA-9) measurements (Additional file 1: Figure S1). The collection and use of the patient samples were reviewed and approved by Institutional Ethics Committees of Peking University Shenzhen Hospital, and written informed consent from all patients was appropriately obtained. Frozen tissues from 24 ccRCC cancer and adjacent normal samples were randomly selected from all 55 paired samples for extraction of total RNA.

The human renal cancer cell lines (ACHN, Caki-1,769-P and 786-O) and embryonic kidney cell (HEK293) were obtained from cell resource center of Shanghai Institutes for Biological Sciences, Chinese Academy of Science. All cells were maintained in Dulbecco’s modified Eagle’s medium (GIBCO, Grand Island, USA) supplemented with 10% fetal bovine serum (FBS, Hyclone, Logan, USA), 50 U/mL penicillin and 50 μg/mL streptomycin. Cells were grown in a humidified atmosphere with 5% CO₂ at 37°C. Cells were collected for following study.

Total RNA was extracted from cancer tissues, normal adjacent tissues and 5 cells with Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The concentration of total RNA was determined using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Then, cDNA was synthesized from 1 μg of total RNA using a Fermentas RT system (Thermo Scientific, Wilmington, DE, USA), according to the manufacturer’s instructions. Reverse transcription reactions were carried out at 25°C for 5 mins and followed by 42°C for 60 mins.

The mRNA expression levels were analyzed using SYBR Premix Ex TaqTM II (Takara, Dalian, China), with β-Actin as an internal reference. qRT-PCR was performed in 20 μl reaction mixture containing 10 μl of SYBR Premix, 0.5 μM of forward and reverse primers, and 1 μl template cDNA on LightCycler480 System (Roche, Foster City, CA, USA). The primers were designed according to the human MAT2A, CA-9, heme oxygenase-1(HO-1), cyclooxygenase-2 (COX-2) and β-Actin genes sequences reported in GenBank. The primer sequences were synthesized by Invitrogen (Guangzhou, China) as follows:

MAT2A, Forward primer: 5′-ATGAACGGACAGCTCAACGG-3′,

Reverse primer: 5′-CCAGCAAGAAGGATCATTCCAG-3′;

CA-9, Forward primer: 5′- GGATCTACCTACTGTTGAGGCT-3′,

Reverse primer: 5′- CATAGCGCCAATGACTCTGGT-3′;

HO-1, Forward primer: 5′-ATGACACCAAGGACCAGAGC -3′,

Reverse primer: 5′-GTGTAAGGACCCATCGGAGA -3′;

COX-2, Forward primer: 5′-CTGGCGCTCAGCCATACAG-3′,

Reverse primer: 5′-CGCACTTATACTGGTCAAATCCC-3′;

β-Actin, Forward primer: 5′- CCACTGGCATCGTGATGGACTCC -3′,

Reverse primer: 5′-GCCGTGGTGGTGAAGCTGTAGC-3′;

All reactions were incubated at 95°C for 5 min, followed by 40 cycles of 95°C for 10 s, 60°C for 20 s and 72°C for 30 s. PCR reactions of each sample were conducted in duplicate. Data were analyzed through the comparative threshold cycle (CT) method.

Five cells, cancer tissues and adjacent normal tissues from all patients were homogenized in radioimmunoprecipitation assay buffer (RIPA) containing the protease inhibitors phenylmethylsulfonyl fluoride (100 μg/mL), cocktail (1 mmol/L) and dithiothreitol (0.5 mmol/L). Homogenates were centrifuged and supernatants were collected. Protein concentrations were determined by bicinchoninic acid (BCA) protein assay kit (Thermo Pierce ). A total of 50 μg of protein from each sample was resolved by reducing loading buffer and separated by 10% sodiumdodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by electrophoretic transfer to a polyvinylidene difluoride (PVDF) membrane. The PVDF membrane was saturated with 5% skim milk in TBST (50 mM Tris–HCl, 150 mM NaCl, 0.1% Tween-20) for 2 h and then incubated with primary antibodies at 4°C overnight. The primary antibodies used included rabbit polyclonal antibodies to MAT2A (1:1000, Abcam, Hong Kong, China), HO-1(1:200, Santa Cruz, Shanghai, China) and β-actin (1:5,000, Abcam, Hong Kong, China). The specificity of the MAT2A antibody has been determined (Additional file 2: Figure S2). PVDF membrane was incubated with 1:10,000-diluted peroxidase-coupled goat anti-rabbit immunoglobulin G (IgG) (secondary antibody, EarthOx, San Francisco, USA) for 1 h, after washing three times with TBST (5 min/time) at room temperature. After further washing with TBST four times, the PVDF membrane was exposed to enhanced chemiluminescence substrate (Millipore, Rockford, USA) for 30 min and detection was performed using a film.

Paraffin sections (3 μm) from samples of 55 ccRCC samples and adjacent normal samples were deparaffinized in 100% xylene and re-hydrated in descending ethanol series (100%, 90%, 80%, 70% ethanol) and water according to standard protocol. Heat-induced antigen retrieval was performed in 10 mM citrate buffer for 2 min at 100°C. Endogenous peroxidase activity and non-specific antigen were blocked with peroxidase blocking reagent containing 3% hydrogen peroxide and serum, followed by incubation with rabbit anti-human MAT2A antibody for 1 h at 37°C. After washing, the sections were incubated with biotin-labelled goat anti-rabbit antibody for 10 min at room temperature, and subsequently were incubated with streptavidin-conjugated horseradish peroxidase (HRP) (Maixin Inc, China). The peroxidase reaction was developed using 3, 3-diaminobenzidine chromogen solution in DAB buffer substrate. Sections were visualized with DAB and counterstained with hematoxylin, mounted in neutral gum, and analyzed using a bright field microscope.

All of the IHC staining results were reviewed independently by two pathologists. Positive expression of MAT2A was defined as the brown staining in the cytoplasm and nucleus. The staining results for MAT2A were semiquantitatively scored. Intensity was estimated in comparison to the control and scored as follows: 0, negative staining; 1, weak staining; 2, moderate staining; and 3, strong staining. Scores representing the percentage of tumor cells stained positive were as follows: 0, no positive cell; 1, <5%; 2, 6–25%; 3, 26–50%; 4, 51–75%; and 5, > 75%. A final score was calculated by multiplying the scores for intensity and percentage.

MAT2A expression in ccRCC has yet to be explored. Therefore, we first examined the transcription level of the MAT2A in cancer tissues and adjacent normal tissues from 24 RCC patients using qRT-PCR. Analysis of mRNA levels reveals 19/24 (79.2%) of RCC patients have reduced MAT2A mRNA level in cancer tissues. Moreover, 16/24 patient samples (66.7%) demonstrated a greater than twofold reduction (Figure 1A). Overall, the average reduction in MAT2A mRNA levels was 3.4 fold (P < 0.05, Figure 1B). Otherwise, the mRNA expressions in all four RCC cell lines were also downregulated relative to HEK293.

To support the change in mRNA level, the protein content of MAT2A was further measured by immunohistochemical and western blotting analysis. The immunohistochemical examinations indicated that MAT2A protein is mainly present in nuclei and level of it was obviously downregulated in cancer tissues compared to adjacent normal tissues (Figure 2A-D). The lower level is approximately 3.4 times (P < 0.001, Figure 2E). The western blotting analysis showed similar trend with immunohistochemical result in that protein content of MAT2A was less in cancer tissues relative to adjacent normal tissues (Figure 2F).

In order to understand the potential mechanism of MAT2A, we further measure the expressions of two kidney cancer related genes COX-2 and HO-1 in RCC patients and cell lines. The results indicate that both genes are highly expressed in cancer tissues than in adjacent normal tissues (P < 0.01, Figures 3A and 3B).The mRNA levels are also upregulated in four RCC cell lines than in HEK293 (Figures 3C). The protein content of HO-1 is obviously higher in four RCC cell lines than in HEK293 while MAT2A shows the opposite style (Figures 3D). The statistical analysis reveals a negative correlation between MAT2A and HO-1 expression in RCC patients (P < 0.01, Figures 3E). The correlation between MAT2A and HO-1 is also negative in cell lines (Additional file 3: Figure S3). But, there is no significant correlation between MAT2A and COX-1 (Figures 3F).