The following plasmids were used: pEYFP-N1 (Clontech, Mountain View USA), Rab5Q79L GFP (M. Zerial, MPI-CBG, Dresden), pcDNA3 ∆N-α-Synuclein lacking the residues 2–19 was provided by H. Karube, Dept. of Neurology, Yamagata, Japan [
34], pcDNA3 Myc-SUMO-2, pcDNA3 Myc-SUMO-2 ∆GG, pEYFP SUMO-1, pEYFP SUMO-1 ∆GG (a C-terminal deletion mutant that cannot be conjugated), pcDNA3 Myc-α-Synuclein, pcDNA3 Myc-α-Synuclein 2KR (bearing the double mutation K96R K102R), pcDNA3 Myc-α-Synuclein 2AA (D98A E104A) [
38], pTE1E2S1 (which codes for the expression of SUMO-1 and the E1 and E2 enzymes of the sumoylation pathway [
70]), pT7.7 encoding for human wild-type α-Synuclein (courtesy of the P. Lansbury laboratory, Harvard Medical School, Cambridge, MA). Fusion constructs α-Synuclein hGLuc1 (S1) and α-Synuclein hGLuc2 (S2) were generated as described previously [
51]. SUMO-2-luciferase construct (SUMO-2-S3) was created by cloning the amino-terminal fragment of humanized Gaussia Luciferase including the same linker as used in S2 into
BamHI/EcoRI sites of pcDNA3. SUMO-2 was subsequently subcloned into
EcoRI/XhoI sites. PcDNA3 Myc-α-Synuclein-SUMO-2 ∆GG, pcDNA3 GFP-SUMO-2 ∆GG, pcDNA3 GFP-Ubiquitin ∆GG were cloned as described below. Further plasmids used were pR4 PLP-Myc, pcDNA3 MLV-Gag-GFP (Addgene Plasmid 1813, W. Mothes, Yale University School of Medicine), and GFP-VPS4 (E233Q) (P. Woodman, University of Manchester, UK). PcDNA3 GFP-SUMO-2 ∆GG SIM (with the triple mutation Q30A F31A I33A) was generated by site-directed mutagenesis according to the manufacturer’s protocol (Quick Change site-directed mutagenesis kit, Stratagene, CA, USA). pShuttleCMV GFP-APPsw was kindly provided by Patrick Keller (Max-Planck-Institute for Molecular Cell Biology and Genetics, Dresden, Germany). SUMO-2 cDNA (NM_006936.2) was amplified by PCR using the primers (5′–3′) fwTCATCAGCGGCCGCGATGTCCGAGGAGAA and rev AGCAGCAGACGGCAGCGTAGTCTAGAAAAAAA thereby eliminating the nucleotides that encode the C-terminal diglycine motif (named SUMO-2 ∆GG). SUMO-2 ∆GG was introduced 3′ terminally of GFP-APPsw via NotI and XbaI restriction sites including a linker of 15 nucleotides between APPsw and SUMO-2 ∆GG. For each fusion construct, three PCR reactions were performed. The first PCR reaction was setup for the 5′-part; the second PCR reaction for the 3′ part of the construct. The PCR products of both reactions were combined within the third PCR reaction using the outer primers only. PCR primers for the amplification of SUMO-2 (NM_006936.2) and Ubiquitin (NM_021009.5) were designed to eliminate the nucleotides that encode the C-terminal diglycine motif (named SUMO-2 ∆GG and Ubiquitin ∆GG) and to create a short linker between both constructs that were fused. The product of the third PCR reaction was cloned via
HindIII and
XhoI restriction sites into the pcDNA3 vector (Life Technologies, Darmstadt, Germany). pcDNA 3 Myc-SUMO2 cleft: SUMO2 cDNA with deletion of the C-terminal GG and the mutations Q30A, F31A, K32A, I33A, L42A, and Y46A was cloned into pcDNA 3 Myc vector via BamHI and XhoI restriction sites. SUMO2 cDNA with deletions of the C-terminal GG and the mutations H16A, Q30A, F31A, K32A, I33A, H36A, L42A, Y46A, and D62A (cleft + loop) and Q30A,F31A,K32A,I33A,L42A,Y46A (cleft) were cloned into pcDNA 3 Myc vector via BamHI and XhoI restriction sites. The following primer pairs (5′–3′) were used for the various constructs: GFP-Ubiquitin ∆GG: GFP fw ACCCAAGCTTATGGTGAGCAA, rev ATGGACGAGCTGTACAAGGCAGCGATGCAGATCTT; Ubiquitin fw TACAAGGCAGCGATGCAGATCTTCGTGAA, rev ACCTGGTCCTTCGTCTCAGAGCAGCGTAGCTCGAGTTT; GFP-SUMO-2 ∆GG: GFP fw ACCCAAGCTTATGGTGAGCAA, rev ATGGACGAGCTGTACAAGGCAGCGATGTCCGA; SUMO-2 fw AGCTGTACAAGGCAGCGATGTCCGAGGAGAAGCCC, rev AGCAGCAGACGGCAGCGTAGCTCGAGAAAA; α-Synuclein-SUMO-2 ∆GG: syn fw ATCTGAAGCTTATGGATGTATTCAT, rev TACGAACCTGAAGCCGCAGCGATGTCCGA; SUMO-2: fw AAGCCGCAGCGATGTCCGAGGAGAAGCCC, rev AGACGGCAGCGTAGCTCGAGAAA. The following siRNAs from Qiagen GmbH, Germany, were used: TSG101: sense sequence 5′-CUGUAUAAACAGAUUCUAAdTdT-3′, antisense sequence 5′-UUAGAAUCUGUUUAUACAGdTdT-3′; Alix: sense sequence 5′-GAACCUGGAUAAUGAUGAAdTdT-3′, antisense sequence 5′- UUCAUCAUUAUCCAGGUUCdTdT-3′. The UBC9 siRNA from Dharmacon was CAAAAAAUCCCGAUGGCACUU sense sequence, GUGCCAUCGGGAUUUUUUGUU antisense sequence.