Background
Theca cells form a multilayer cover that surrounds the follicle beginning in its early developmental stages. The main physiological roles recognized for theca cells are the initial steps in the steroidogenic process; specifically, these cells convert acetate or cholesterol to androgens [
1], which are secreted into the intra-follicular medium and taken up by granulosa cells to serve as substrate for estrogen synthesis. In addition, theca cells could be an important signal integrator and regulator of aspects of follicular growth, because it represents the last follicular layer in contact with blood flow and receives chemical information from the peripheral nervous system [
2].
Several studies in recent years indicate that the purinergic signaling system is functionally expressed in the ovary of several species [
3] and represents another regulatory element in ovarian physiology; however, the physiological role of ATP in this context and its membrane receptors is unknown.
ATP is an important neurotransmitter in the peripheral nervous system [
3], and nerve terminals from this system are potential sources for ATP release in the ovary. For example, the ovary is innervated by sympathetic terminals through the superior ovarian nerve and ovarian plexus [
2,
4]. It has been shown in other tissues that ATP is co-released with noradrenaline by sympathetic terminals and that it participates in several physiological events such as the induction and regulation of smooth muscle contraction [
5] and the modulation of cardiac muscle excitation [
6]. In addition, several cell types are able to release ATP in a basal manner and/or in response to different stimuli, such as mechanical stimulation, changes in pH, or hypotonic stress [
7‐
9].
As a cellular messenger, ATP exerts its action through membrane receptors named P2, which are grouped into two subfamilies: P2X receptors that are cationic channels, and P2Y receptors that belong to the G protein-coupled receptor (GPCR) super family. In mammals, 8 subtypes of P2Y receptors have been described: 1, 2, 4, 6, and 11-14. Subtypes P2Y1, 2, 4, 6, and 11 are mainly coupled to Gα
q/11 proteins, and they activate phospholipase C (PLC) and consequently diacylglycerol and phosphoinositide-Ca
2+ turnover; subtypes 12-14, on the other hand, are coupled to Gα
i/0 proteins that signal primarily by inhibiting adenylyl cyclase [
10].
P2Y2, P2Y4, and P2Y6 form a subgroup of receptors sensitive to uridine nucleotides [
11]; P2Y2 and P2Y4 show selectivity for nucleoside triphosphates, while P2Y6 prefers mainly nucleoside diphosphates, specifically UDP [
12]. Uridine P2Y-activated receptors are involved in a broad variety of physiological processes such as cell proliferation, smooth muscle contraction, transmitter release, and others [
3,
10]. In the ovary, expression of UTP-sensitive P2Y receptors has been described in granulosa luteal cells [
13,
14], in the cumulus cell-oocyte complex [
15], and in
Xenopus ovarian follicles [
16,
17].
Recently, it was demonstrated that functional P2X7 receptors are expressed in mammalian TIC and can induce apoptotic cell death [
18]. In the same study, it was also observed that the application of UTP evoked intracellular [Ca
2+]
i changes, suggesting that multiple P2 receptor subtypes are expressed in theca cells. Here, we studied this response in order to elucidate in more detail the molecular elements involved and the physiological implications of their activation. We found that uridine-sensitive P2Y2 and P2Y6 receptors are expressed in the TIC membrane and that P2Y activation promoted three important responses in these cells: 1) elicited Ca
2+ mobilization from intracellular reservoirs, increasing the concentration of this important second messenger in the cytoplasm; 2) increased cell proliferation through a mechanism dependent on the activation of protein kinase C (PKC) as well as MAPK p44 and p42, and; 3) down regulated hCG-dependent phosphorylation of CREB, an important element in steroidogenesis cascade control.
Methods
Materials
ATP, UTP, UDP, suramin, human chorionic gonadotropic hormone (hCG), porcine follicle stimulating hormone (FSH), and PPADS were purchased from Sigma Chemical Co. (St. Louis, MO), and staurosporin, wortmanin, and phorbol 12-myristate 13-acetate (PMA) were from Calbiochem (Gibbstown, NJ). DMEM-F12 medium, fetal bovine serum, antibiotic-antimycotic mix, and other cell culture reagents were from Gibco Invitrogen Co. (Grand Island, NY). Antibodies against mouse total or phosphorylated MAPK p44 and p42 and total or phosphorylated CREB were from Cell Signaling (Danvers, MA), and antibody against poly(ADP-ribose) polymerase-1 (PARP) was from Santa Cruz Biotechnology (Santa Cruz, CA). Oligonucleotides, reverse transcriptase, oligo dT, taq polymerase, and other molecular biology reagents were purchased from Invitrogen Co. (Carlsbad, CA), and Fluo4-AM was from Molecular Probes Invitrogen Co. (Eugene, OR). Automatic sequencing was done in the Molecular Biology Unit of the Instituto de Neurobiología, UNAM.
Theca cell isolation and culture
Mouse theca/interstitial cells were purified by a discontinuous Percoll gradient [
19,
20]. Immature mice were used to avoid cultures enriched in luteal cells. Thus, intact 4- to 5-week-old mice of the strain C57 were sacrificed by cervical dislocation, a procedure approved by the ethical committee of Instituto de Neurobiología-UNAM. The ovaries were dissected and incubated in collagenase (100 mg/ml) for 20 min, and the ovarian epithelium was removed by passing the complete ovary repeatedly in and out through the orifice of a Pasteur pipette. Most granulosa cells were then eliminated by puncturing the isolated, epithelium-free ovaries with a fine hypodermic needle. The ovary, free of epithelium and most granulosa, was cut into fine pieces that were then incubated in a mix of collagenase (4 mg/ml), DNase I (10 μg/ml), and BSA (10 mg/ml) for 30 min. The homogenate was fractioned on a discontinuous gradient: bottom layer 44% Percoll; top layer Percoll of density 1.055 g/ml. The cells were centrifuged for 20 min at 400 × g, and TIC were collected from the interface by aspiration, then cultured in DMEM-F12 medium containing 10% fetal bovine serum supplemented with antibiotic-antimycotic at 37°C in a humidified atmosphere with 5% CO
2. Cultures were maintained 48 h before using them in experiments, to allow proper recovery after the isolation procedure. With this method we usually obtained 1 × 10
6 cells per mouse; purity was assayed by RT-PCR and immunocytochemistry against CYP11A protein (> 96% of cells were positive). To exclude contamination with granulosa, the expression of the FSH receptor transcript and the responsiveness of CREB phosphorylation to hCG or FSH were assayed.
Reverse Transcription Polymerase Chain Reaction
Total RNA of TIC cultures or from the indicated organ was purified using the guanidine isothiocyanate method [
21]. First strand cDNA was synthesized using 2 μg of DNase-treated RNA as template, 1 mg of oligo(dT), random hexamers, and reverse transcriptase.
The cDNA was used as template in a polymerase chain reaction to amplify cDNA fragments for β-actin, p2y2r, p2y4r, and p2y6r transcripts, and for cyp11A, cyp17A, star, and fshr as positive and negative theca cell markers, respectively. All the PCR programs started at 96°C for 3 min and finished at 72°C for 1 min. The amplification cycles consisted in 40 s at 96°C, 40 s at the specific annealing temperature for each primer set, and 40 s at 72°C.
The sequences of the oligonucleotides, the annealing temperatures, and the number of PCR cycles used were as follows: p2y2r, forward GGACGAACTGGGATACAAGTGT, reverse GTGGACTCTGTCCGTCTTGAGT, annealing temperature 55°C, 30 cycles; p2y4r, forward GGGACTAACTGCAGGCAGAG, reverse GATACACATCAGGCCCGTCT, annealing temperature 60°C, 40 cycles; p2y6r, forward TTTCAAGCGACTGCTGCTAA, reverse TGGCATAGAAGAGGAAGCGT, annealing temperature 55°C, 30 cycles; cyp11A, forward GCTGGAAGGTGTAGCTCAGG, reverse CACTGGTGTGGAACATCTGG, annealing temperature 55°C, 30 cycles; cyp17A, forward TGGTCGGCCCCAGATGGTGA, reverse ATCTCGGGACTCCCCGTCGT, annealing temperature 56°C, 30 cycles; star, forward AACCAGGAAGGCTGGAAGAAG, reverse AGCAGCCAAGTGAGTTTAGTC, annealing temperature 55°C, 30 cycles; fshr, forward TGGATGTCATCACTGGCTGT, reverse CAAATCTCAGTTCAATGGCG, annealing temperature 58°C, 30 cycles; and β-actin, forward GGGTCAGAAGGATTCCTATG, reverse GGTCTCAAACATGATCTGGG, annealing temperature 55°C, 25 cycles.
The amplified products were gel-isolated, phenol-chloroform purified, and subcloned into the pCR4-TOPO vector (Molecular Probes Invitrogen Co.). Their nucleotide sequences were confirmed by automatic sequencing.
Fluorescence microscopy
Mouse ovarian TIC were grown on 12-mm diameter cover slides. Semi-confluent cultures were loaded for 15 min with 5 mM fluo-4/AM and 0.1% pluronic acid in Krebs solution (in mM: 150 NaCl, 1 KCl, 1 MgCl2, 1.5 CaCl2, 4 glucose, 10 HEPES, and 0.05% BSA, pH 7.4). The cells were washed with Krebs solution for 10 min to eliminate excess dye and then placed in a constant-flow recording chamber that allowed them to be visualized with an inverted fluorescence microscope (Olympus IX70, Melville, NY). Drugs were applied by superfusion and responses were recorded with an Evolution QEi camera (Media Cybernetics, Bethesda, MD). Sequences of images were analyzed using the Image-Pro Plus software (Media cybernetics, Bethesda, MD) and Imagenes software, a program developed specifically for this analysis (Dr. Ivan Terol, CIDETEQ, México). In the Ca2+-free Krebs solution, CaCl2 was replaced by 3 mM MgCl2.
Western blot
For MAPK p42 and p44 or CREB phosphorylation experiments, cultured TIC (5 × 105) were harvested 24 h before the experiment to reduce serum-dependent kinase activity. After that, cells were stimulated with the indicated drugs, scraped in Laemmli buffer, and boiled for 5 min. For electrophoresis, samples were fractionated in a 10% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane (BioRad, Hercules, CA). Membranes were blocked for 1 h at room temperature in 150 mM NaCl, 20 mM Tris, pH 7.4, and 0.1% Tween 20 (TBS-T) containing 5% nonfat dry milk and then incubated overnight at 4°C with the appropriate rabbit primary antibody (1:1000) directed against the phosphorylated form of MAPK p44 and p42 or CREB (Cell signaling, Danvers, MA). After washing with TBS-T, membranes were incubated 1 h at 37°C with HRP-conjugated goat anti-rabbit antibody (Zymed, Invitrogen Co., Grand Island, NY) in TBS-T. The immunoreactive proteins were detected by chemiluminescence, and images were analyzed by pixel density with ImageJ Software (NIH, USA); the results were expressed in terms of optic density normalized against the basal condition, a parameter that is proportional to the change in protein phosphorylation. To analyze total p44/p42 or other load controls, such as PARP, the same membranes were incubated for 30 min in striping solution (50 mM, Tris pH 6.8, 100 mM β-mercaptoethanol, and 2% SDS) at 55°C, washed twice with TBS-T, and then reprobed with a primary antibody against the indicated protein.
Immunoprecipitation
TIC (1 × 106) were scraped in ice-cold TNTE buffer (Tris-HCl pH 7.4,150 mM NaCl, 50 mM and 0.5 mM EDTA) containing 5% Triton X-100 and a protease inhibitor cocktail (Roche Co., Basel, Switzerland); the lysate was centrifuged for 10 min at 14,000 rpm at 4°C, and the soluble fraction was incubated overnight with 3 μl of anti-P2Y6 antibody (Alomone, Jerusalem, Israel). After that, 50 μl of protein G agarose was added to the lysate and incubated for 1 h at room temperature; the agarose beads were washed 3 times with TNTE containing 1% Triton X-100 and protease inhibitors, resuspended in Laemmli buffer, boiled for 5 min, and analyzed by Western blot.
Proliferation assay
Cell proliferation was analyzed using [3H]-thymidine incorporation. For this, cells (104) were cultured in 48-well plates and after 48 h of culture, they were harvested and incubated for 24 h in serum-free DMEM-F12 media; then the culture medium was changed to DMEM-F12 with 0.1% fetal bovine serum containing the experimental treatment (UTP, UDP, or ATP at the indicated concentration). Then cultures were incubated for another 48 h, with the addition of 1 μ Ci/well of [3H]-thymidine after the first 24 h. At the end of the incubation, each well was washed 3 times with 5% trichloroacetic acid, and then the cells were lysed by addition of 250 μl of boiling 250 mM NaOH, incubated 5 min, and transferred to vials containing 5 ml of scintillation liquid. Samples were counted in a scintillation counter.
Statistical analysis
All data are expressed as mean ± S.E.M. Statistical analysis was performed using GraphPad Prism (La Jolla, CA) software. The means of two groups were compared using a Student's t-test. ANOVA was used to compare several groups, and differences were considered to be significant at p < 0.05.
Discussion
It has been recognized that neurotransmitters might play distinct, regulatory roles in ovarian physiology; for example, it has been proposed that, in addition to the regulatory actions of gonadotropins, the activity of sympathetic fibers that innervate the ovary controls different aspects of ovarian function, such as steroidogenesis, folliculogenesis, and ovulation [e.g., [
30,
2,
31,
32]]; most of these studies have examined the role of the catecholaminergic system and specifically, of norepinephrine [
30‐
32], but there is also a great deal of important evidence for participation of an ovarian cholinergic system [
33,
34]. Although knowledge about the purinergic system in the ovary is scarce, it is well established that ATP and norepinephrine are co-released at similar concentrations from sympathetic terminals in many cell systems [
5,
7], and release of ATP by the oocyte has already been documented in other species [
8,
16]. Thus, the study in the ovary of the molecular components expressed and cellular mechanisms activated by the purinergic system will be of importance to understand the possible role of ATP in ovarian physiology and pathology. Here, we present clear evidence of functional expression of UTP-sensitive P2Y receptors in TIC cultures, suggesting a role for these receptors in ovarian physiology.
RT-PCR and Western blot studies indicated that cultured TIC express P2Y2 and P2Y6 receptors. In functional experiments, UTP and UDP, specific agonists for P2Y2 and P2Y6, respectively, induced robust Ca
2+ signals in normal Krebs or in Ca
2+-free solution, which indicated that the nucleotides promoted the response mainly through Ca
2+ release from intracellular reservoirs, in agreement with the canonical Gαq-PLC pathway for these receptors [
10]. UTP or high concentrations of UDP (1 mM) also induced the phosphorylation of MAPK p44 and p42; at high concentrations, UDP acted principally on the P2Y2 receptor, since P2Y6 is stimulated by UDP in the low μM range [
11]. Phosphorylation of MAPK was inhibited by suramin, a potent antagonist for P2Y2 and weak for P2Y6, but it was not affected by PPADS, which is inactive toward P2Y2 but able to antagonize P2Y6 activation [
11]. Taken together, our data indicated a main role of the P2Y2 receptor in MAPK activation. There is ample evidence that these protein kinases are involved in the proliferative phenomenon activated by G protein-coupled receptors in various cell systems [e.g., [
27,
28]]; in addition, p44 and p42 MAPK activation dependent on P2Y2 or P2Y6 receptors has been described, e.g., in granulosa-luteal cells [
14], glioma cells [
35], and embryonic stem cells [
36]. Staurosporin or long-term (18 h) incubation with PMA blocked UTP-induced p44 and p42 MAPK phosphorylation. In addition, p44 and p42 MAPK phosphorylation was blocked in BAPTA-loaded cells, strongly suggesting that a calcium-dependent PKC participates in this response.
Activation of MAPK p44 and p42 is directly related to induction of cell proliferation [
37]. Our results demonstrated that UTP and UDP induced a robust proliferative response similar to that of 10% FBS used as positive control. ATP induced a proliferative response at 10 μM, but no effect was observed with higher concentrations. This supports the idea that P2Y2 is the main receptor involved in the response, but an ancillary participation of P2Y6 cannot yet be excluded. The regulation of theca cell proliferation is relevant during folliculogenesis [
1], and it might be involved in pathological processes, such as the altered androgen-estrogen balance associated with polycystic ovary syndrome, a common disease characterized by uncontrolled theca cell proliferation [
38]. In this context, purinergic signaling can activate a feedback mechanism by inducing a proliferative or an apoptotic response in TIC.
ATP actions to stimulate TIC proliferation through P2Y2 (and P2Y6) receptor activation should be taken into account, together with the effects described for other neurotransmitters that seem to regulate specific processes in the ovary. For example, previous evidence showed that human granulosa-luteal cells express M1 and M5 muscarinic receptors [
34] as well as P2Y2 purinergic receptors [
13,
14]; stimulation of either system by acetylcholine or ATP can promote granulosa-luteal cell proliferation. Stimulation of β-adrenergic receptors also modulates steroidogenic activity and ovulation [
31] and, given that neurotransmitters released from catecholaminergic terminals might include ATP, it would be of interest to know the effect of activating purinergic receptors in these processes.
The results also showed that P2Y2 receptor activation had an important effect on the LH signaling pathway. It has been shown before that LH induces CREB phosphorylation [
22,
39] and that expression of a dominant negative CREB variant was enough to block androgen biosynthesis in rat TIC cells [
22]. We observed that preincubation with UTP (10 or 100 μM), completely blocked the hCG-induced CREB phosphorylation, which suggests that the purinergic system potently modulates LH-activated pathways, an action that might have important consequences in ovarian theca physiology.
Is well known that during folliculogenesis LH exerts regulatory actions beginning around the formation of early secondary follicles, which is concurrent with theca layer differentiation; from this stage throughout folliculogenesis up to ovulation, LH is the main regulator of theca layer development, because it controls the steroidogenesis process [
40]. However, during this period, important phenomena such as follicular selection or dominance processes cannot be explained solely by LH action; paracrine and autocrine follicular molecules seem to be essential for the final outcome [
41]. It is possible that P2Y2 activation represents one of the mechanisms by which LH regulates the cohort of follicles that will or will not become dominant. Thus, the process of purinergic regulation demonstrated here might be involved in maintaining the proper balance between the rate of cell division and death in the ovary, and in essential physiological actions such as steroidogenesis, functioning as a local, fine-tuning modulator to complement the systemic control exerted by hormones and nervous system afferents. Hence, purinergic regulation is a potential therapeutic target in ovarian pathologies where proliferation or the steroidogenesis processes are affected.
Specifically in regulating the balance between theca proliferation and death, our data suggest that activation of the purinergic system by ATP could have dual effects on theca cell physiology; i.e., depending on the concentration, ATP might induce: 1) apoptotic cell death through P2X7 receptors (18) and 2) cell proliferation through P2Y2/P2Y6 receptors, as shown here. This is similar to what has been demonstrated in other systems in which the cells seem to co-express multiple purinergic receptor subtypes, leading to activation of multiple signaling pathways. For example, macrophages express a variety of P2X and P2Y purinergic receptors, and their activation modulates diverse physiological process such as apoptosis, activation of cell proliferation pathways, or activation of the inflammatory response machinery [
42,
43]. The final physiological outcome of the effect exerted by ATP in a given process will be determined by several factors including, for example, the purinergic receptor affinities, source and availability of ATP, ecto-ATPase activity, and also cross-talk between different G protein-coupled receptor types or subunits of receptor channels [see e.g., [
17]]. In this context, it is important to mention that high concentrations of ATP (0.1 - 1 mM), but not of UTP, were consistently unable to increase cell proliferation, which might be a result of P2X7 receptor activation that can induce apoptotic cell death [
18], among other possibilities, such as a regulatory effect of ATP on P2Y2/P2Y6 receptor function. Distinguishing among the various possibilities will require further analysis of the functional interaction among the different P2 receptors expressed in the ovarian theca.
Data presented in the present work are the first evidence that UTP-sensitive P2Y receptors are expressed and functional in theca cells. Although extensive studies are necessarily to establish with detail the main physiological activities, experimental data suggested these receptors have a role in p44/p42 MAPK phosphorylation, proliferation increase, and cross talk with LH-activated pathways. These observations raise the possibility that the purinergic signaling system represents an important physiological regulator of theca cells.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
FGVC and ROA conceived and designed the study, carried out experiments, performed the data analysis, and drafted the manuscript; EPZD and GE performed experiments and participated in the analysis of data. All authors read and approved the final manuscript.