Introduction
In most double-stranded DNA (dsDNA) bacteriophages and eukaryotic DNA viruses, such as adenovirus and herpesvirus, a key step in virion assembly is the packaging of the viral genome into a preformed empty capsid by the action of an ATP-powered molecular motor [
1,
6,
24,
25,
27]. This packaging process is initiated by recognition and endonucleolytic cleavage of viral concatemeric DNA. Concatemeric DNA, which consists of head-to-tail unit-length molecules, is generally produced via recombination [
21] or rolling-circle replication [
34,
37]. Next, the cleaved DNA end is linked to the portal vertex of the empty prohead through specific interactions between the terminase and the portal protein [
19,
20,
38,
41]. Thus, a packaging motor is assembled, which drives directional translocation of DNA into the prohead, powered by the energy of ATP hydrolysis. When the viral head has been filled with one (
cos phages) or slightly more than one (
pac phages) genome length, the DNA is cut again, and the packed head attaches the neck and tail components to complete the assembly of an infectious virion [
1,
2,
33]. Finally, the undocked terminase reassociates with another empty prohead to continue head filling in a processive manner [
9,
27,
33].
Terminase is a key component of this highly dynamic process. The terminase enzyme is normally a heteromultimer composed of one large and one small subunit. The small subunit can specifically bind the viral DNA and is hypothesized to be involved in recognition of the viral genome substrate. The large subunit, which is the main component of the terminase holoenzyme, is required for DNA cleavage to generate single genome-length molecules, linkage of cleaved DNA to the connector, and translocation of DNA into the empty prohead [
4,
27]. Because the packaging reaction catalyzed by terminase is highly specific, terminase enzymes represent ideal models to investigate protein-protein and nucleotide-protein interactions.
Our laboratory is interested in the genetic and biochemical basis of phage-bacteria interactions and, in particular, the application of genetic remodeling in the improvement of phage therapy. We previously isolated and identified three new strains of
Pseudomonas aeruginosa phages from our affiliated hospital sewage and designated them as PaP1, PaP2, and PaP3. PaP1 is virulent, while PaP2 and PaP3 are both temperate phages. Recently, we determined the complete nucleotide sequence of the PaP3 genome (GenBank accession number NC_004466) and discovered the mechanism by which it is integrated into the host bacterial chromosome [
35]. In the current study, we identified two important genes encoding PaP3 terminase subunits that are required for the DNA packaging process.
Materials and methods
Bacteria, phage, and plasmids
The phage, bacterial strains, and plasmids used in this study are listed in Table
1.
P. aeruginosa phage PaP3 was propagated on
P. aeruginosa strain PA1 which belongs to the International Antigenic Typing System (IATS) serotype 6. All bacterial cultures were grown in Luria-Bertani (LB) medium or on 1.5 % agar plates at 37 °C. If required, 100 μg/ml of ampicillin (Amp) (Sigma) was added for cloning procedures.
Table 1
Phage, bacterial strains, and plasmids used in this study
Strains
|
Phage strain
|
PaP3 |
P. aeruginosa phage isolated from hospital sewage | Lab collection |
Bacterial strains
|
P. aeruginosa PA1 | Clinical isolate of P. aeruginosa, serotype 6 | Lab collection |
E. coli DH5α | Cloning host for maintaining recombinant plasmids | Lab collection |
E. coli BL21(DE3) | Expression host for recombinant protein production | Lab collection |
Plasmids
|
pMD™18-T | T-cloning vector; AmpR
| TaKaRa |
pMD-cos
| Derivative of pMD™18-T with a cloned 239-bp PCR product containing the cos end sequence of PaP3 | This work |
pET-22b(+) | C-terminal His tag fusion expression vector; AmpR
| Novagen |
pQE-31 | N-terminal His tag fusion expression vector; AmpR
| Qiagen |
pQE31-p01
| Derivative of pQE-31 containing the PaP3 terminase small subunit coding gene orf1
| This work |
pET22b-p03
| Derivative of pET-22b(+) containing the PaP3 terminase large subunit coding gene orf3
| This work |
Expression and purification of terminase proteins
The
orf1 gene was PCR-amplified from PaP3 genomic DNA using primers
p01-F and
p01-R and cloned into the
BamH I/
Hind III sites of the pQE-31 expression vector, creating a fusion protein with an N-terminal His
6 tag. Plasmid pET22b-
p03 was generated by inserting
orf3 PCR products (amplified with primer pair
p03-F/
p03-R) into the
Nde I/
Xho I sites of the pET-22b(+) vector, creating a C-terminally His
6-tagged fusion protein. The sequences of the primers used are listed in Table
2.
E. coli BL21 (DE3) cells harboring the recombinant expression vectors were grown overnight in 50 ml LB broth containing ampicillin at 37 °C. A 1:100 dilution of the overnight culture was used to inoculate 2 L of fresh LB medium containing ampicillin, which was then shaken at 25 °C to an OD
600 of 0.6. Isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM to induce overexpression of the recombinant proteins. Following 5 h of induction, the cells were harvested by centrifugation at 6,000 g for 10 min, and the pellet was resuspended in a lysis buffer containing 20 mM Tris-HCl (pH 8.0), 50 mM NaCl, and 5 % glycerol. Lysis was completed by sonication on ice, and the soluble fractions were collected by centrifugation and loaded onto a Ni-NTA affinity column (QIAGEN) that had been equilibrated with cell lysis buffer. The His
6-tagged proteins were eluted with a gradient of 20-500 mM imidazole and then purified by Superdex-75 big gel filtration chromatography. Peak elution fractions were analyzed by electrophoresis on 10 % (p03) or 15 % (p01) SDS-PAGE followed by Coomassie blue staining. Fractions containing pure proteins were pooled and concentrated in an Amicon apparatus (Millipore) with a 10-kDa molecular weight cutoff membrane and then stored in 0.1-ml aliquots at −80 °C. The concentrations of proteins were determined with a BCA protein assay kit (Pierce) according to the manufacturer’s protocol.
Table 2
Primers used in this study for PCR and gene expression analysis
cos-F | GAGCCTGAGTCATGGTCGTTTCAT | Amplification of the cos239 fragment |
cos-R | GATGGGTTAGTGTCGAAGGCTTAG |
cos239-F | ATACTCCCCGTCGCGCTTGAACCA | Amplification of the cos239dn fragment |
cos239-R | AGGGTTGACAAGGCAAGCCCACGG |
p01-F | GGATCCAATGTCAGACGAAAAGGT (BamH I) |
orf1 expression |
p01-R | AAGCTTAGCGGTCGGGAAAGAAA (Hind III) |
p03-F | CATATGGATACCCAAGAGCGGTTG (Nde I) |
orf3 expression |
p03-R | CTCGAGGACAATACTCCCAAACCA (Xho I) |
In vitro cos cleavage assays
A 239-bp fragment containing the PaP3 cos site (designated cos239) was amplified from the PaP3 genome using PCR primers cos-F and cos-R. The resulting PCR products were cloned into pMD18-T, creating pMD-cos. The plasmid pMD-cos (10 nM) was used as substrate DNA and was incubated with the proteins of interest in a reaction buffer containing 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, and 50 mM NaCl at 37 °C for 60 min. Acetylated BSA was used as a negative protein control. The cos cleavage reactions were terminated by the addition of EDTA to a final concentration of 20 mM, and the samples were electrophoresed on 0.9 % (w/v) agarose gels followed by ethidium bromide staining. Gel images were captured digitally, and the amount of cos cleavage was determined by analyzing band intensities quantified with Quantity One software (Bio-Rad). The yield of cleaved, linearized (L) DNA was calculated after correction for the relative fluorescence of the L form of DNA to the covalently closed circular (CCC) plasmid DNA.
DNA binding assays
To evaluate the DNA binding ability of the small terminase subunit via electrophoretic mobility shift assays (EMSAs), the abovementioned cos239 fragment was used as substrate DNA, and the immediately downstream 239-bp segment (designated cos239dn) was used as a nonspecific DNA control. The DNA substrate used to analyze the binding activity of the large subunit of PaP3 terminase was the 20-bp cos end sequence of PaP3. A 24-bp non-cos DNA (5′-GCACTGCAGTAACTTGTCAGTCAT-3′) was served as a nonspecific control. Purified proteins of interest were mixed with various 5′-end biotin-labeled DNAs (1.5 μM) in 20 μl buffer containing 50 mM Tris-HCl (pH 8.0), 50 mM NaCl, 10 mM MgCl2, and 5 % glycerol. The DNA/protein binding reactions were incubated at 37 °C for 30 min and terminated by adding EDTA to a final concentration of 20 mM. All mixtures were loaded and separated on 5 % non-denaturing PAGE gels in 0.5 × TBE buffer and then transferred onto Hybond-N + nylon membranes (Amersham Pharmacia). The biotin end-labeled DNAs were detected using a streptavidin–horseradish peroxidase conjugate and a chemiluminescent substrate developed for the LightShift Chemiluminescent EMSA Kit (Pierce) according to the standard protocol. The signals were then detected with X-ray films.
ATPase assays
The purified p03 or p01 or the control buffer was incubated in a 20-μl reaction mixture containing 5 μCi of [γ-32P]ATP (specific activity 3000 Ci/mmol, GE Healthcare) at 37 °C in ATPase buffer (50 mM Tris-HCl, pH 7.5, 0.1 M NaCl, and 5 mM MgCl2) for 30 min. The ATP hydrolysis reactions were terminated by the addition of EDTA to a final concentration of 50 mM, and the products were separated by thin-layer chromatography on PEI plates (Sigma). Phosphorimaging (Storm 820, Molecular Dynamics) was used for data quantification.
Discussion
Phages have been a useful model system for studying assembly processes for over half a century. Much of our current knowledge about phage DNA packaging mechanisms comes from Enterobacteria phages (such as λ and T4) and Bacillus phages (such as φ29 and SPP1). DNA packaging in other phages has so far received limited attention. However, studying the packaging reactions of diverse phages both provides an opportunity to identify alternative mechanisms and can extend our understanding of the packaging process, as well as the formation and function of nucleoprotein complexes in general.
Although phage D3 is one of the relatively well-studied
P. aeruginosa phages, its DNA-packaging mechanism still remains largely unknown [
12,
30]. In the present work, we provide a relatively detailed functional characterization of the DNA-packaging terminase from
P. aeruginosa phage PaP3. The DNA-packaging terminase of phage PaP3 is a multi-subunit complex composed of the small subunit p01 and the large subunit p03, products of the
orf1 and
orf3 genes, respectively. In nearly every tailed phage with a gene order that is known, terminase subunit genes are adjacent and located on the same DNA strand. However, some interesting exceptions exist. In the case of
Yersinia phage PY100, ORF2 and ORF18, which encode the small and large terminase subunits, respectively, are widely separated and located on opposite strands [
29]. Actually, during the initial annotation of the PaP3 genome, the leftmost gene,
orf1, was predicted to encode a polypeptide of unknown function with similarities to a number of phage hypothetical proteins, not a small terminase subunit. This is due to the fact that the small terminase subunits of various phages display considerable sequence heterogeneity and distinct domain architectures. The previously identified terminase small subunits of phages T4 (gp16), P22 (gp3), SPP1 (G
1P), SF6 (G1P), and λ (gpNu1) generally lack sequence similarity with one another [
22].
Consistent with previous studies of other well-defined DNA packaging systems, the purified PaP3 terminase subunits possess typical properties such as ATPase, nuclease, and specific DNA-binding activities. However, two new observations were made during this study. First, the p03 large terminase was found to bind to DNA when it is unassembled. To our knowledge, this has not been observed previously. Second, a small terminase of a new type was informatically found and functionally identified. The lack of sequence similarity to other known small subunits and the absence of a typical HTH motif in the N-terminus suggest that it may have a unique DNA recognition and binding pattern in the PaP3 packaging reaction.
ATP hydrolysis is required
in vitro for phage DNA packaging. ATP both provides an energy source for DNA translocation into the prohead and acts as an allosteric effector to control terminase holoenzyme specificity [
15,
31]. Sequence analysis indicated that the PaP3 large terminase subunit has an N-terminal ATPase domain, which is consistent with our present experimental demonstration that p03 possesses an ATPase activity that is stimulated by the p01 small subunit. In T4, the large subunit displays a DNA-dependent ATPase activity [
26], but the situation is different for PaP3 p03, which did not require the presence of DNA in our ATPase assays (Fig. S1). Terminase possesses ATPase catalytic sites that modulate the nuclease activity of the enzyme, drive its strand-separation activity, and power translocation during active DNA packaging [
27]. In the
Bacillus phage φ29, the packaging motor translocates 2 bp of DNA per ATP hydrolyzed and generates up to ~60 pN of force (a power density twice that of an automobile engine), similar to that measured with phage λ and T4, thus making the phage DNA packaging motor among the strongest biological machines reported to date [
10,
11,
32].
In conclusion, we performed a preliminary functional characterization of the terminase from P. aeruginosa phage PaP3. The results presented here provide a necessary first step towards developing an in vitro DNA packaging system of PaP3. Detailed protein-protein interactions and biophysical studies are currently underway in our laboratory for a better mechanistic understanding of the complex assembly process of this interesting phage.
Acknowledgments
This work was supported by the National Natural Science Foundation of China (No. 31070153 & 30470082), Chongqing Municipal Natural Science Foundation, China (No. 2011jjA0560), and the Pre-Research Foundation of Third Military Medical University (No. 2009XYY02).