Background
Hepatocellular carcinoma (HCC) is one of the most common malignant tumours, causing a substantial global health burden [
1]. Reasonable methods of prevention, monitoring, early detection, diagnosis and treatment have been developed [
2], however, the survival of HCC patients after radical resection is poor [
3]. Investigation of the underlying mechanisms of HCC invasiveness and metastasis is of great significance for finding new therapeutic targets that can improve the prognosis of HCC.
Newly discovered types of noncoding RNAs (ncRNAs) derived from pre-transfer RNA (tRNA) or mature tRNA by precise site-specific cleavage are tRFs (tRNA-derived small RNA fragments) and tiRNAs (tRNA-derived stress-induced RNA) [
4]. Abnormal expression of tRFs and tiRNAs has been observed in many diseases, including tumours, neurodegenerative diseases, and metabolic and infectious diseases [
5,
6]. tRFs and tiRNAs have been detected in a variety of body fluids and tissues [
7], and their expression are highly abundant [
8,
9], heavily modified and not easily degraded [
10]; thus, they are more stable than other ncRNAs and increasingly becoming a popular topic in oncology research [
11]. Accumulating evidence shows that tRFs and tiRNAs play crucial roles in human cancers, including breast cancer [
12‐
15], prostate cancer [
16,
17], and colorectal cancer [
18,
19], by participating in multiple biological functions, including gene expression and silencing, translation regulation and epigenetic regulation [
20].
A recent study showed that glycine tRNA-derived fragment (Gly-tRF) expression is upregulated in ethanol-fed mice and promotes alcoholic fatty liver disease (AFLD) [
21]. AFLD is one of the early forms of liver injury. Some patients with simple steatosis can develop more severe forms of liver injury, including steatohepatitis, cirrhosis, and eventually HCC [
22]. Here we aimed to explore the impact of Gly-tRF on the biological process of HCC and the roles of Gly-tRF in LCSC.
In the present study, Gly-tRF was found to be upregulated in HCC tissues and cell lines, and increased expression of Gly-tRF triggers EMT and the acquisition of LCSC-like properties.
Furthermore, target genes prediction and Dual luciferase reporter assays indicated that NDFIP2 was a direct target of Gly-tRF. Subsequently, we observed that overexpression of NDFIP2 weakened the promotive effects of Gly-tRF on EMT and LCSC-like cell sphere formation ability. Finally, bioinformatics analysis indicated that Gly-tRF functions by activating the AKT signalling pathway (A flowchart of the article is shown in Additional file
1: Figure S1). Therefore, this study illustrates that Gly-tRF plays tumor-promoting role in HCC and may lead to a potential therapeutic target for HCC.
Materials and methods
Specimen collection, tissue microarray and immunohistochemical staining
Fifteen samples of histologically confirmed tumours and matched adjacent non-tumour tissues obtained from HCC patients who underwent radical hepatectomy at Lanzhou University First Hospital. The study was approved by the hospital ethics committee, and according to the institutional review committee's procedures, all patients signed an informed consent form before the study. A tissue microarray containing 90 tumour tissues and matched adjacent non-tumour tissues was purchased from Shanghai Outdo Biotech Co., Ltd (Shanghai, China). All patients provided written informed consent and were followed up for 5–6 years with clear prognostic information. Immunohistochemical staining was performed as previously described [
23]. For immunohistochemical images, two experienced pathologists independently performed immunohistochemical staining scores according to the staining intensity (0: no staining; 1: weak staining; 2: moderate staining; 3: strong staining) and the percentage of positive cells (0: 0%; 1: < 25%; 2: 26–50%; 3: > 50%). The staining intensity score and the staining percentage score were summed to calculate the final immunohistochemical score. We defined an immunohistochemical of score 0 to 4 as low expression and a score of 5 to 6 as high expression.
Cell culture
The human liver cancer cell lines HepG2, Huh7 and HCCLM3 were purchased from the China Center for Type Culture Collection (CCTCC, Wuhan, China) and were identified by short tandem repeat (STR). L02 hepatocytes were gift from Zhongshan Hospital of Fudan University (Shanghai, China). The embryonic kidney cell line HEK-293 T was a gift from Shanghai GeneChem Co., Ltd. (Shanghai, China). All cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; pH = 7.2, Gibco Company, Grand Island, NY, USA) containing 10% (v/v) foetal bovine serum (FBS, HyClone, Logan, UT, USA). All cells were cultured in a humidified incubator (Thermo Fisher Scientific, Waltham, MA, USA) at 37 °C and 5% CO2. All cells were tested for mycoplasma contamination.
RNA isolation
Total RNA was harvested from cells and tissues using RNAiso Plus (Takara Holdings Inc., Kyoto, Japan), and the protocol recommended by the manufacturer protocol was followed for isolation of total RNA. NanoDrop 2000 (Thermo Fisher Scientific) was used to measure the quality and quantity of the isolated RNA.
3′ and 5′ Adaptor ligation, first-strand complementary DNA (cDNA) synthesis and real-time PCR
Heavy modifications contained in tRNAs, such as 3′-aminoacyl, 3′-cP, m1A, m1G, and m3C modifications will severely interfere with reverse transcription. Therefore, conventional PCR methods may not be able to reflect the true expression characteristics of tRNA-derived fragments [
24]. In this work, an rtStar™ tRF&tiRNA Pretreatment Kit (Arraystar Inc., Rockville, MD, USA. Cat #AS-FS-005) was used to remove various modifications from Gly-tRF before 3′ and 5′ adaptor and cDNA synthesis. cDNA was synthesized using APExBIO First-strand cDNA Synsthesis Supermix (APExBIO Inc., Houston, TX, USA; Cat #K1073). All steps, such as 3′-terminal deacylation, 3′-cP removal and 5′-P addition, demethylation and reverse transcription, were carried out in accordance with the manufacturer's instructions. All reactions were performed in an Mx3000P QPCR system (Agilent Technologies Inc., Santa Clara, CA, USA) using TB Green Premix Ex Taq II (Takara Holdings Inc., Kyoto, Japan) for real-time PCR according to the manufacturer's instructions. The primers are listed in Table
1. U6 or GAPDH was used as the normalized endogenous control for expression. The relative expression levels of Gly-tRF were analysed by the 2
−ΔΔCt method.
Table 1
Sequences information in this study
Gly-tRF | GCAUUGGUGGUUCAGUGGUAGAAUUCUCGC |
Forward: CATTGGTGGTTCAGTGGTAGAAT Reverse: AGTGCAGGGTCCGAGGTATT |
Gly-tRF NC-inhibitor | TTCTCCGAACGTGTCACGT |
Gly-tRF inhibitor | GCGAGAATTCTACCACTGAACCACCAATGC |
Gly-tRF NC-mimic | CON238 |
Gly-tRF mimic | GCCTTGTTAAGTGCTCGCTTCGGCAGCACATATACTATGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCGACGAGAATTCTACCACTGAACCACCAATGCTAGTGAAGCCACAGATGTAGCATTGGTGGTTCAGTGGTAGAATTCTCGCTGCCTACTGCCTCGCAATTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTTTTCAATTGGAAGACTAATGCGTTTAAACACGCGGCG |
NDFIP2 | Forward: TCAAACCCAGCACCGCAGATTG Reverse: CGCAGATAGCACCATACCTTCCAG |
ABHD17B | Forward: GCTGCTTGGCTTGCTCTTAGGAC Reverse: TTCAACCCAGAGAGGCTCCACAG |
KCNK10 | Forward: ATGAAGTGGAAGACGGTGGTTGC Reverse: AGTGGCTGCTGTTGTTGGAAGAG |
RNF103 | Forward: TCATGGGTAAGGGCAGACTGGATG Reverse: AAAGAAGCAATCGGGTGGAAGAGG |
CXXC4 | Forward: TCCTCCTCCGCCTCCTCCTC Reverse: TGGCAATTTGAAACGCACTGTCTG |
OXTR | Forward: GGTGGTGGCAGTGTTTCAGGTG Reverse: CAGGCAGCGAGCACGATGAC |
WDR44 | Forward: CAGTGGAAGTCAAAGGAGGTGGTG Reverse: GCCATGCTTGCGGTTAGGAGAG |
OSER1 | Forward: AGCACCAGTCAGAACAGCAACAG Reverse: TTGGGTAGCGTCAGAGGAGTCTTC |
GAPDH | Forward: CCCACTAACATCAAATGGGG Reverse: CCTTCCACAATGCCAAAGTT |
U6 | Forward: CGCTTCGGCAGCACATATAC Reverse: GAACGCTTCACGAATTTGCGT |
Cell transfection
HCCLM3 and Huh7 cells were seeded in 6-well plates (Corning Life Sciences, USA) at a density of 4 × 10
5 cells per well. When the cells were 40–50% confluent, Gly-tRF negative control, Gly-tRF inhibitor, and Gly-tRF mimic lentiviruses were used to transduce cells according to the manufacturer's instructions (Shanghai GeneChem Co., Ltd, Shanghai, China). The sequences of all lentiviral products are shown in Table
1. After 72 h of transduction, cells were cultured in complete medium containing 2 µg/µL puromycin for 72 h. Cells stably transduced with Gly-tRF were used for subsequent experiments.
Proportional staining analysis of representative LCSC markers
HCC cells were prepared as single-cell suspensions for staining. All antibodies used for staining were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany), and included a phycoerythrin (PE)-conjugated anti-CD133 antibody (Cat #130-110-962), a PE-Vio770-conjugated anti-CD13 antibody (Cat #130-120-727), an allophycocyanin (APC)-conjugated anti-EpCAM antibody (Cat #130-111-000), an APC-Vio770-conjugated anti-CD44 antibody (Cat #130-113-339) and anti-REA control antibody (Cat # 130-113-438, 130-113-440, 130-113-434, 130-113-445). The percentages of CD133+, CD13+, EpCAM+, and CD44+ within the HCC cell population were determined according to the manufacturer’s instructions. In brief, 1 × 106 cells were centrifuged and resuspended in 98 µL of buffer, 2 µL antibody was added, and the cells were incubated for 10 min in the dark at 4 °C. The cells were washed with 1 mL of buffer, centrifuged at 300 g for 10 min, and resuspended in 400 µL of buffer for detection. Data were acquired with a BD LSRFortessa. All samples were analysed in triplicate.
Cells (2000 cells per well) were planted in a 6-well ultra-low adhesion plate (Corning, USA). After 8 days of incubation, spheres were counted and photographed (15 random fields/well) under a stereomicroscope (Olympus, Tokyo, Japan). The diameter of the spheres was measured with Image-Pro Plus 6.0 software (Media Cybernetics Inc., Rockville, MD, USA), and colonies with a diameter greater than 20 µm were considered positive for sphere formation.
Transwell assays
Cell migration experiments were performed in a 24-well Transwell plate (8.0 µm pore size, Corning Life Sciences, Costar, USA). Stably transduced cells were starved for 6 h in serum-free medium, trypsinized and adjusted to 2 × 105 cells/mL after counting. Then, 600 µL of complete medium containing 30% (v/v) serum was added to the lower chamber, 200 µL of the cell suspension was added to the upper chamber, and the cells were cultured for 48 h. The cells in the upper chamber were removed, and the cells remaining on the membrane were fixed with 4% paraformaldehyde (Solarbio, Beijing, China). After staining with 0.5% crystal violet (Solarbio, Beijing, China), the cells were observed under a microscope and imaged. All experiments were repeated three times.
Wound healing assay
Stably transduced cells were trypsinized and seeded in a 6-well plate. When the cells were 90% confluent, a 200 µL sterile pipette tip was used to uniformly make vertical scratches in the wells of the 6-well plate. Cells were removed by washing 3 times with PBS and multiple random fields were selected to observe cell migration at 0 h, 24 h, and 48 h. The area and width of the scratches were quantified with Image-Pro Plus 6.0.
Protein extraction and western blot analysis
Western blotting was performed as previously described [
25]. The primary antibodies used for Western blotting were as follows: anti-NDFIP2(1:1000, Bioss Antibodies Inc., Beijing, China; Cat # bs-19059R), anti-pan AKT (1:1000, Abcam, Cambridge, UK; Cat # ab8805), anti- phospho-AKT1 (1:1000, Abcam, Cat # ab66138), anti-N-cadherin (1:1000, Abcam, Cat # ab18203), anti-E-cadherin (1:10,000, Abcam, Cat # ab40772). An anti-β-actin antibody (1:2000, Sigma, USA) was used as an internal control to ensure equal amounts of protein loading.
Immunofluorescence staining
Stably transduced cells were grown overnight on glass coverslips. The cells were fixed with 4% paraformaldehyde for 10 min at room temperature. The cells were washed 3 times with -cold PBS. The cells were then incubated with PBS (containing 0.3% Triton X-100) for 10 min. The cells were washed 3 times with PBS for 5 min each. The cells were blocked 3% BSA for 30 min at room temperature. The cells were then incubated with an anti-NDFIP2 antibody (1:200, Bioss Antibodies Inc., Beijing, China; Cat # bs-19059R) overnight at 4 °C. The cells were washed 3 times with PBS-T, and were then incubated with Cy3-conjugated goat anti-rabbit (1:400, Servicebio, Wuhan, China; Cat # GB21303) at room temperature in the dark for 60 min. The cells were then incubated with 4′,6-diamidino-2-phenylindole (DAPI, Servicebio) for 5 min. After washing with PBS, images were acquired using a fluorescence microscope (Nikon Eclipse C1; Nikon Corporation). Fluorescence quantitative analysis was performed using Image-Pro Plus 6.0.
Plasmid construction, plasmid transfection and luciferase assay
pcDNA3.1 was used as the vector to construct the NDFIP2 overexpression plasmid (pcDNA3.1 + NDFIP2 OE), and pGL6 (Beyotime, Shanghai, China) was used as the vector to construct the NDFIP2 3' UTR wild-type (NDFIP2 wt) and NDFIP2 3' UTR mutant (NDFIP2 mut) luciferase reporter plasmids. All constructed plasmids were verified by sequencing (TSINGKE, Beijing, China). The Renilla luciferase reporter plasmid pRL-TK and the pGL6 promoter empty vector were co-transfected with NDFIP2 wt or NDFIP2 mut into the HEK-293T cells in each well using Exfect Transfection Reagent (Vazyme Biotechnology Co., Ltd, Nanjing, China) following the manufacturer's instructions. In brief, 50 ng of pRL-TK and 400 ng of NDFIP2 wt, NDFIP2 mut or pGL6 were added to Opti-MEM, mixed with 1 µL liposomes and incubated for 10 min at room temperature. Forty-eight hours after transfection, the cells were lysed, and a Dual-Luciferase® reporter analysis system (Promega, Madison, WI, USA) was used to perform dual-luciferase reporter assays. A GLOMAX 20/20 luminometer (Promega, Madison, WI, USA) was used to detect luciferase activity. All samples were analysed in triplicate. The same method was used to transfect HCCLM3 cells with pcDNA3.1 + NDFIP2 OE and pcDNA3.1 empty vector (pcDNA3.1 + vector). In brief, 3 µg of pcDNA3.1 + NDFIP2 OE or pcDNA3.1 + vector and 9 µL of liposomes were added to the cells. After 48 h of culture, follow-up experiments were performed.
Gene expression profiles and clinical data were downloaded from the TCGA XENA database (
https://xena.ucsc.edu/) to identify differentially expressed genes (DEGs) between HCC tissues and matched non-tumour tissues. Gene Ontology (GO) enrichment analysis was performed with the for DEGs.
Statistical analysis
GraphPad Prism 8 (La Jolla, CA, USA) was used for all statistical analysis and plotting. P < 0.05 was considered statistically significant. Student’s t-test or one-way ANOVA was used for intergroup comparisons of quantitative data.
Discussion
The idea that transfer RNA derived fragments (tRFs and tiRNAs) play key roles in mechanisms of tumorigenesis and tumour development is supported by accumulating research evidence. However, the effect of tRFs and tiRNAs on HCC is still unknown, and further research is needed. In this regard, current research has identified a tRNA derived fragment, Gly-tRF, that is upregulated in HCC cell lines and HCC tissues. Furthermore, our results confirm that elevated Gly-tRF promotes HCC cell migration These results support the important roles of Gly-tRF in the mechanism of HCC, which is of great significance for the development of new research focuses on strategies for the diagnosis and treatment of HCC.
Previous studies have shown the biological function and potential molecular mechanism of dysregulated functional tRFs and tiRNAs in HCC. Deep-sequencing analysis of small RNAs identified a tRF named tRF_U3_1, that exhibits increased abundance in the Huh7 cell line and negatively regulates viral gene expression [
38]. High-throughput sequencing results of small RNAs in liver tissues of patients with advanced hepatitis B or C and HCC showed that tRFs and tiRNAs have the highest abundance in chronically infected liver tissue, and that their abundance is changed in HCC [
39]. Accumulating evidence reveals the potential relationship between tRFs and HCC. Although the tRNA-derived fragment subtypes and tumour types were different from those studied previously, those of previous studies indicate that elevated levels of tRNA-derived fragments act as a cancer-promoting factor [
40‐
42]. However, the expression levels of tRFs are affected by the cellular context, and the transcription characteristics of tRFs are related to personal attributes [
43]. These variations make discovering the function of tRFs extremely complicated. Currently, tRFs represent an emerging, elusive, challenging and promising field, and their regulation of biological activities requires more in-depth evaluation and more convincing evidence.
tRF usually targets mRNA 3′ UTR through miRNA-like effects and plays potential roles in post-transcriptional regulation [
44]. The tRF/miR-1280 derived from tRNA
Leu and pre-miRNA inhibits Notch signaling pathway by directly targeting Notch ligand JAG2 mRNA 3′ UTR, inhibiting the growth and metastasis of colorectal cancer cells [
18]. tRF-17-79MP9PP targets THBS1 3′ UTR to attenuate breast cancer cell invasion and migration [
45]. In this study, we confirmed that NDFIP2 is the direct target of Gly-tRF. We also found that the promotive effects of Gly-tRF on HCC can be reduced by NDFIP2 overexpression.
There have been discussions about the role of tRNA-derived fragments in stemness regulation. In mouse stem cell models, 5′ tRNA accumulation has been found to regulate the undifferentiated stem cell status in tumours through differential translation of proteins that regulate cell migration, adhesion, and stress response [
46]. PUS7-mediated pseudouridylation activates tRF biogenesis to control protein synthesis and stem cell fate determination, and this post-transcriptional regulatory network directly affects tumorigenesis [
47]. The results of the present study indicate that Gly-tRF increases the expression of markers indicating a stem cell-like phenotype and promotes LCSC-like properties. Collectively, the above findings and our results suggest that it is meaningful to integrate the study of tRNA-derived fragments into research on cancer stem cells.
The potential mechanism by which tRNA-derived fragments control the biological processes of HCC cells is multi-step and complex. Importantly, we found that the tumour -promoting effect of Gly-tRF on HCC cells depends on the AKT signalling pathway. Overexpression of NDFIP2 weakened the tumour-promoting effect of Gly-tRF on HCC cells and restored the level of phosphorylated AKT. Accumulating evidence also indicates the activation of the AKT signalling pathway in HCC biogenesis [
48,
49]. NDFIP2 regulates the stability of its target proteins by activating E3 ubiquitin ligases [
36]. Our GO-MF analysis result also implied that NDFIP2 is involved in ubiquitin mediated proteolysis. We thus speculate that NDFIP2 regulates the AKT signalling pathway through the ubiquitination of downstream target proteins. However, our current research has not verified this speculation. Additionally, the number of human tRFs identified to date exceeds the number of human protein-coding genes, the mechanism of tRFs involved in biogenesis has not yet been elucidated, and multiple mechanisms may be responsible [
43].
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.