Skip to main content
Erschienen in: Cancer Cell International 1/2015

Open Access 01.12.2015 | Primary research

GSK3β mediates pancreatic cancer cell invasion in vitro via the CXCR4/MMP-2 Pathway

verfasst von: Xu Ying, Li Jing, Shijie Ma, Qianjun Li, Xiaoling Luo, Zhenguo Pan, Yanling Feng, Pan Feng

Erschienen in: Cancer Cell International | Ausgabe 1/2015

Abstract

Background

Glycogen synthase kinase-3β (GSK3β) expression and activity are upregulated in pancreatic cancer tissues. In our previous study, we found that stromal cell-derived factor-1/ chemokine receptor C-X-C motif chemokine receptor 4 (SDF-1α/CXCR4) upregulated matrix metalloproteinase 2 (MMP-2) and promoted invasion in PANC1 and SW-1990 pancreatic cancer cells by activating p38 mitogen-activated protein kinase (p38 MAPK). Additionally, inhibition of GSK3β reduced MMP-2 secretion.

Methods

To investigate the molecular mechanism of GSK3β in pancreatic cancer tissues, we created stable PANC1 cells up-regulation of GSK3β by transfecting GSK3β overexpression plasmid, and down-regulation of GSK3β using two different types of RNA interference.

Results

Western blotting showed that overexpression of GSK3β up-regulated CXCR4 and MMP-2 expression; suppression of GSK3β down-regulated CXCR4 and MMP-2 protein expression. Up-regulation of MMP2 induced by overexpression of GSK3β was blocked by inhibition of CXCR4. Overexpression of GSK3β promoted PANC1 cell invasion, and down-regulation of GSK3β suppressed PANC1 cell invasion in the transwell invasion assays. However, inhibition of CXCR4 using shRNA attenuated the ability of GSK3β to promote PANC1 cell invasion.

Conclusions

This study demonstrated that GSK3β promotes PANC1 cell invasion via the CXCR4/MMP-2 pathway.
Begleitmaterial
Additional file 1: Figure S2. The transcript levels for CXCR4 and MMP2 were quantified by real-time quantitative transcription polymerase chain reaction (real-time PCR). Total RNA of PANC-1 cells were extracted by TRIzol reagent (Invitrogen) and 1 μg total RNA was used for reverse transcription to cDNA according to the manufacturer’s instructions. The cDNA aliquots were used for quantification of mRNA by real-time PCR using ABI Prism 7000 sequence detection system (Applied Biosystems, Foster City, CA), using SYBR Green PCR master mix (Applied Biosystems). All data were analyzed using β-actin gene expression as an internal standard. The specific primers were as follows: β-actin forward: 5′-TCACCAACTGGGACGACAT-3′, and reverse: 5′-GCACAGCCTGGATAGCAAC-3′, CXCR4 (NM_001008540.1) forward: 5′-CGAGGCCCTAGCTTTCTTCC-3′, and reverse: 5′-GAGGATCTTGAGGCT GGACC-3′, MMP2 (NM_001302509.1) forward: 5′-GGATGGCAAGTACGGCTTCT-3′, and reverse: 5′-GTT CCCACCAACAGTGGACA-3′. The thermal cycler was programmed as: denaturation at 95 °C for 5 min, followed by 33 cycles at 95 °C for 30 s and annealing at 60 °C for β-actin, 60 °C for CXCR4, and 56 °C for MMP2 for 30 s, extension in all was carried at 72 °C for 1 min, with a final extension step of 10 min. (A) Overexpression of GSK3β upregulates CXCR4 and MMP-2 expression respectively, compared to control PANC1 cells and vector control cells. (B) Suppression of GSK3β expression significantly reduces CXCR4 and MMP-2 expression approximately 2.3 folds and 5.8 folds in PANC1 cells, compared to scrambled control cells.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s12935-015-0216-y) contains supplementary material, which is available to authorized users.
Xu Ying and Li Jing contributed equally to this work.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

XY, LJ, and SM conducted the molecular studies, and carried out the data collection; QL, XL, ZP, and YF conducted part of the molecular studies, and wrote this paper; and PF designed this study. All authors read and approved the final manuscript.
Abkürzungen
GSK3β
Glycogen synthase kinase-3β
CXCR4
Chemokine receptor C-X-C motif chemokine receptor 4
MMP-2
Matrix metalloproteinase 2
SDF-1
Stromal cell-derived factor-1

Background

Pancreatic cancer is one of the most aggressive human cancers worldwide. Despite the introduction of improved and/or combined treatments such as surgery, chemotherapy and radiation therapy, the prognosis of patients with pancreatic cancer remains poor. Novel, effective therapeutic strategies are urgently required to improve the prognosis of patients with this malignancy. Improvements to chemotherapy strategies require the development of novel target-directed therapies. Therefore, further studies are needed to identify novel molecular therapeutic targets which determine the sensitivity of pancreatic cells to chemotherapeutic agents and ionizing radiation [1].
The serine/threonine kinase glycogen synthase kinase-3 (GSK3) was originally identified as a regulator of glycogen synthesis [2, 3]. GSK3β phosphorylates and inactivates the enzyme glycogen synthase. However, GSK3β is also involved in diverse cellular processes such as cell proliferation, apoptosis, invasion and inflammation. Altered GSK3β expression is associated with numerous pathological processes, including type 2 diabetes, Alzheimer’s disease, and cancer [47]. Recent studies suggested that GSK3β can promote the invasion of pancreatic, lung, breast and liver cancer cells, and inhibition of GSK3β induces apoptosis [810]. These results have led researchers to propose GSK3β as a potential therapeutic target in cancer. Recent studies have also indicated that GSK3β promotes the proliferation and invasion of pancreatic cancer cells. Inhibition of GSK3β triggered an apoptotic response in pancreatic cancer cells via a JNK-dependent mechanism [11], and attenuated cell survival and proliferation and induced apoptosis in pancreatic cancer cell lines [5].
Chemokine receptor C-X-C motif chemokine receptor 4 (CXCR4) and its natural ligand stromal cell-derived factor-1 (CXCL12, SDF-1) play a role in a variety of physiological and pathological processes, including cell proliferation, migration and invasion [12]. Matrix metalloproteinase 2 (MMP-2) promotes the invasion of a variety of cancer cells, including pancreatic cancer cells [13]. SDF-1/CXCR4 and MMP-2 are overexpressed in pancreatic cancer tissues, and have been found to act as prognostic markers in various types of cancer, including pancreatic cancer. SDF-1/CXCR4 are thought to promote pancreatic cancer cell invasion by upregulating the expression and activity of MMP-2 [1417]. Inhibition of GSK3β enhanced Mesenchymal stromal cells (MSCs) migration by increasing expression of CXCR4 [18]. SDF1/CXCR4 had effect on resident c-kit(+) CSPCs by increasing GSK3β activity [19]. Silencing of GSK3β decreased CXCL12 expression (the ligand of CXCR4) [20].
Here, we investigated the relationship between GSK3β and CXCR4/MMP-2 in pancreatic cancer cells, in order to further characterize the cellular and molecular mechanisms involved in pancreatic cancer.

Results

Overexpression of GSK3β upregulates CXCR4 and MMP-2

To elucidate the effect of GSK3β on the expression of CXCR4 and MMP-2 in pancreatic cancer cells, we overexpresses GSK3β in PANC1 and SW-1990 cells. Fig. 1a show that, compared to control PANC1 cells and vector control cells, GSK3β expression increases by about 2.3-fold in the stable cell clone; this clone is used as a cellular model of GSK3β overexpression in the remainder of the study.
We determine the expression of CXCR4 and MMP-2 in PANC1 cells overexpressing GSK3β using Western blotting. Overexpression of GSK3β upregulates CXCR4 and MMP-2 expression by about 2.4- and 2.1-fold, respectively, compared to control PANC1 cells and vector control cells (Fig. 1b and Additional file 1: Figure S2A). And the same phenomenon was aslo observed in SW-1990 cells (Fig. 1c and d).

Inhibition of GSK3β downregulates CXCR4 and MMP-2 expression

Furthermore, we assesse whether inhibition of GSK3β affected CXCR4 and MMP-2 expression in PANC1 and SW-1990 cells. Using two different types of RNA interference, GSK3β expression is successfully down-regulated (Fig. 2a and b). Scrambled shRNA is used as a control. Suppression of GSK3β expression significantly reduces CXCR4 and MMP-2 expression approximately 2.3 folds and 5.8 folds in PANC1 cells, compared to scrambled control cells (Fig. 2a, b and Additional file 1: Figure S2B). And the same phenomenon was aslo observed in SW-1990 cells (Fig. 2c and d). We also detected the effect of GSK3β inhibition on the expression of CXCR4 and activity of downstream signaling molecular β-catenin using GSK3-specific inhibitor AR-A014418. Additional file 2: Figure S1 showed that inhibition of GSK3β downregulated CXCR4 expression and suppressed phosphorylation of β-catenin.

GSK3β promotes PANC1 cell invasion

We examine the effect of GSK3β on cell invasion in PANC1 cells using the in vitro cell invasion assay. As shown in Fig. 3a and b, the cell invasion assay demonstrates that overexpression of GSK3β promoted the invasion of PANC1 cells compared to vector control cells; suppression of GSK3β decreases the invasion of PANC1 cells compared to the scrambled cells. These results indicate that GSK3β induces PANC1 cell invasion.

PANC1 cell invasion induced by overexpression of GSK3β is attenuated by suppression of CXCR4

MMP-2 degrades the extracellular matrix, which promotes cancer cell invasion, and we previousl [21] found that CXCR4 promoted human cancer cell invasion by upregulating MMP-2. In this study, we observe that GSK3β regulated CXCR4 and MMP-2 expression (Figs. 1 and 2). Therefore, we investigated whether GSK3β regulated MMP-2 expression and cell invasion via CXCR4 signaling. To determine the effect of CXCR4 on cell invasion induced by GSK3β overexpression, PANC1 cells overexpression GSK3β were transfected with the CXCR4 silencing plasmids, or scrambled vector as a control, and stable cell clones were selected. Western blotting result showes that CXCR4 protein is successfully suppressed (Fig. 4a and b).
As shown in Fig. 4a and b, up-regulation of MMP-2 induced by overexpression of GSK3β is attenuated by the CXCR4 inhibition using transfecting with CXCR4 shRNA plasmids. Fig. 4c shows that overexpression of GSK3β also increased the invasion of PANC1 cells compared to the control cells. However, the ability of GSK3β to promote cell invasion is reduced by the CXCR4 inhibition. These results indicate that GSK3β induces MMP-2 expression and cell invasion via a CXCR4-dependent mechanism in PANC1 cells.

Discussion

Among the current range of novel target molecules, GSK3β has emerged as a therapeutic target in pancreatic cancer [8, 22, 23]. GSK3β expression and activity are upregulated in pancreatic cancer [2428]. In spite of this evidence, the precise role of GSK3β and its potential as a therapeutic target in pancreatic cancer still require further research. The focus of this study was to determine the effects of GSK3β and investigate its molecular mechanism of action, specifically via the GSK3β-CXCR4/MMP-2 pathway, in PANC1 pancreatic cancer cells.
Previous studies have shown that inhibition of GSK3β reduced the proliferation and survival of pancreatic cancer cells, which was associated with decreased cyclin D1 expression, Rb phosphorylation and secretion of matrix metalloproteinase-2 (MMP-2) [26, 29, 30]. Inhibition of GSK3β also suppressed pancreatic cancer growth and angiogenesis by decreasing the expression of Blc-2 and vascular endothelial growth factor (VEGF), and abrogating NFκB activity [17, 31]. GSK3β also maintained constitutive NFκB signaling in pancreatic cancer cells [9, 3234]. The GSK3β/β-catenin pathway has also been linked to pancreatic cancer [35]. These results led us to propose GSK3β as a potential therapeutic target in pancreatic cancer; therefore, further studies on the molecular mechanism of action of GSK3β are required. The effect of GSK3β on SDF-1/CXCR4 is complicated. Kim YS et al. sugguested that inhibition of GSK3β upregulated expression of CXCR4 but Tamura M et al. said that silencing of GSK3β decreased SDF-1 expression [18, 20]. SDF-1 might increase GSK3β phosphorylation [19]. SDF-1/CXCR4 aslo mediated GSK3β-induced physiological migration of stem cells [36]. Activation of CXCR4-mediated cell signal resulted in the inhibition of GSK3β [37].
In our previous study [21], we found that SDF-1α/CXCR4 upregulated MMP-2 expression and induced the invasion of PANC1 and SW-1990 pancreatic cancer cells by activating p38 MAPK. Additionally, inhibition of GSK3β reduced the secretion of MMP-2 [26]. These results shed light on the molecular mechanism of action of GSK3β in pancreatic cancer. In this study, we demonstrated that GSK3β induced PANC1 pancreatic cancer cell invasion via the CXCR4/MMP-2 pathway.

Conclusions

This study provides further insight into the molecular mechanism of GSK3β-induced pancreatic cancer invasion, and will allow exploration of novel therapeutic strategies for pancreatic cancer that target GSK3β and/or CXCR4/MMP-2.

Materials and methods

Reagents

Dulbecco’s modified Eagle’s medium (DMEM; #11965-084) was purchased from Life TechnologiesTM (USA). The α-Tubulin antibody (#T5168) and AR-A014418 (#487021-52-3, an inhibitor of GSK3) were purchased from Sigma-Aldrich (USA). Antibodies against GSK3β (#9315) and MMP-2 (#4022) were purchased from Cell Signaling Technology (USA). Antibodies against CXCR4 (#ab2074) was purchased from Abcam.

Cell culture

The human pancreatic cancer cell line PANC1 (CRL-1469) and SW-1990 (CRL-2172), which was established from human pancreatic cancer ducts, was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). PANC1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10 % fetal bovine serum, 100 U/ml penicillin and 100 mg/ml streptomycin sulfate, and maintained at 37 °C in a 5 % CO2 humidified incubator.

Construction of GSK3β overexpressing plasmid and generation of stable clones

The overexpressing plasmid pcDNA3.1A(-)-myc-GSK3β was constructed as follows: full-length human GSK3β cDNA was amplified by RT-PCR from mRNA isolated from human white adipose tissue. The primer sequences were: forward, 5'-CGTGAATTCATCATGTCAGGGCGGCCCA -3' and reverse, 5'-GCTGTCGACG GGATCCGTCAGGTGGAGTTGGA-3'. The PCR product was cloned into the expression vector pcDNA3.1A(-)-myc, and then transfected into PANC1 cells using X-tremeGENE HP DNA Transfection Reagent. At 48 h after transfection, the cells were cultured in selection medium containing 800 μg/ml G418 (Sigma) to select resistant colonies for further analysis.

Construction of miRNA-GSK3β expression plasmids and stable clone selection

Two distinct domains within the coding region of the human GSK3β cDNA were targeted for RNA interference. For this purpose, two pairs of reverse complementary oligonucleotides were designed and synthesized as Table 1. The oligonucleotides were annealed and inserted into the pcDNA6.2-GW/EmGFP-miR expression vector (Invitrogen, #K4936-00) to create GSK3β shRNA1 and shRNA2. A control scrambled shRNA was also created. We used X-tremeGENE HP DNA Transfection Reagent to separately transfect the three kinds of plasmids into PANC-1. At 48 h after transfection, the cells were cultured in selection medium containing 800 μg/ml G418 (Sigma) to select resistant colonies for further analysis. CXCR4 shRNA plasmids are gifts from the Department of Gastroenterology, The First Affiliated Hospital of Nanjing Medical University [38].
Table 1
Reverse complementary oligonucleotides
Oligo
5’ to 3
1-F
TACATAGTAAGTGGGCCTTCAGGCGCCTTTTGCGGTTTGACTGATGCTCTGAACTGCCGGCCTA
1-R
AGTGTAGTACTAGAGAACAGGCTAGGGAGTTTGGCCCCAACCACTGCCTGTTCTGTCCTTGCTC
2-F
GAAGAGGCAGGGATCAGTAGCGTAGGGTTTAAAACACTGACTGCTGCCTAGTTACTCCACTGAA
2-R
GCCAACAGTGTTGGAGCTAGGGACCGGTCAAACAGGCCAAAGCCTCCTAGCTACTTCCGGTTCC
Scrambled-F
TGTCTGAACATACTGCCTGAGAGACGTTCTGACCACTAAGAACGTCTCTGAACAGTACTGAT
Scrambled-R
TACTAAAGTCAACTGCGAAGGAGAAGTCAGTTGAGGCCCAGAACGTAGCCACGCTTACTACTA

Western blotting analysis

PANC1 cells were lysed using RIPA buffer. Equal amounts of protein (60 μg) were separated on 10 % SDS-PAGE gels and transferred to Immobilon-P membranes (Millipore, Bedford, MA, USA). The membranes were probed overnight at 4 °C with antibodies against GSK3β, CXCR4 or MMP-2 in TBST containing 1 % (w/v) BSA, incubated with the appropriate anti-rabbit or anti-mouse secondary antibodies for 2 h, and immune complexes were detected using the ECL plus detection kit (Pierce, Rockford, IL, USA) and quantified using a scanning densitometer and molecular analysis software (Bio-Rad, Hercules, CA, USA).

Cell invasion assay

PANC1 cell invasion was assayed using 24-well Transwell plates (Corning Costar, Schiphol-Rijk, Netherlands). ECM gel solution (60 μl) was added to the top compartment of each cell culture insert and dried overnight in a laminar flow cabinet. PANC1 cells were washed twice with phosphate-buffered saline (PBS), resuspended in serum-free DMEM containing 0.1 % BSA, and adjusted to a final concentration of 1 × 106 cells/ml. Serum-free DMEM/0.1 % BSA (600 μl) and 200 μl cell suspension were added to the matrigel-coated upper compartment, and the same medium was added to the lower compartment, and the plates were incubated for 48 h at 37 °C. Cells remaining on the upper side of the filter were removed by gentle wiping, and cells that had migrated through the filter were counted using a light microscope (six fields were counted in each chamber for each condition; 200× magnification).

Statistical analysis

Data were analyzed by two-tailed Student t test for single comparisons and by one-way analysis of variance for multiple group comparisons. Differences were considered significant at *p < 0.05 versus control.

Acknowledgments

This work was supported by grants from Science and Technology Support Program of Huaian (No.HAS2010023).
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
The Creative Commons Public Domain Dedication waiver (https://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

XY, LJ, and SM conducted the molecular studies, and carried out the data collection; QL, XL, ZP, and YF conducted part of the molecular studies, and wrote this paper; and PF designed this study. All authors read and approved the final manuscript.
Anhänge

Additional files

Additional file 1: Figure S2. The transcript levels for CXCR4 and MMP2 were quantified by real-time quantitative transcription polymerase chain reaction (real-time PCR). Total RNA of PANC-1 cells were extracted by TRIzol reagent (Invitrogen) and 1 μg total RNA was used for reverse transcription to cDNA according to the manufacturer’s instructions. The cDNA aliquots were used for quantification of mRNA by real-time PCR using ABI Prism 7000 sequence detection system (Applied Biosystems, Foster City, CA), using SYBR Green PCR master mix (Applied Biosystems). All data were analyzed using β-actin gene expression as an internal standard. The specific primers were as follows: β-actin forward: 5′-TCACCAACTGGGACGACAT-3′, and reverse: 5′-GCACAGCCTGGATAGCAAC-3′, CXCR4 (NM_001008540.1) forward: 5′-CGAGGCCCTAGCTTTCTTCC-3′, and reverse: 5′-GAGGATCTTGAGGCT GGACC-3′, MMP2 (NM_001302509.1) forward: 5′-GGATGGCAAGTACGGCTTCT-3′, and reverse: 5′-GTT CCCACCAACAGTGGACA-3′. The thermal cycler was programmed as: denaturation at 95 °C for 5 min, followed by 33 cycles at 95 °C for 30 s and annealing at 60 °C for β-actin, 60 °C for CXCR4, and 56 °C for MMP2 for 30 s, extension in all was carried at 72 °C for 1 min, with a final extension step of 10 min. (A) Overexpression of GSK3β upregulates CXCR4 and MMP-2 expression respectively, compared to control PANC1 cells and vector control cells. (B) Suppression of GSK3β expression significantly reduces CXCR4 and MMP-2 expression approximately 2.3 folds and 5.8 folds in PANC1 cells, compared to scrambled control cells.
Literatur
1.
Zurück zum Zitat Tamburrino A, Piro G, Carbone C, Tortora G, Melisi D. Mechanisms of resistance to chemotherapeutic and anti-angiogenic drugs as novel targets for pancreatic cancer therapy. Front Pharmacol. 2013;doi: 10.3389/fphar.2013.00056. Tamburrino A, Piro G, Carbone C, Tortora G, Melisi D. Mechanisms of resistance to chemotherapeutic and anti-angiogenic drugs as novel targets for pancreatic cancer therapy. Front Pharmacol. 2013;doi: 10.3389/fphar.2013.00056.
2.
Zurück zum Zitat Klamer G, Song E, Ko KH, O’Brien TA, Dolnikov A. Using small molecule GSK3β inhibitors to treat inflammation. Curr Med Chem. 2010;17(26):2873–81.PubMedCrossRef Klamer G, Song E, Ko KH, O’Brien TA, Dolnikov A. Using small molecule GSK3β inhibitors to treat inflammation. Curr Med Chem. 2010;17(26):2873–81.PubMedCrossRef
4.
Zurück zum Zitat Bilim V, Ougolkov A, Yuuki K, Naito S, Kawazoe H, Muto A, et al. Glycogen synthase kinase-3: a new therapeutic target in renal cell carcinoma. Br J Cancer. 2009;101(12):2005–14.PubMedCentralPubMedCrossRef Bilim V, Ougolkov A, Yuuki K, Naito S, Kawazoe H, Muto A, et al. Glycogen synthase kinase-3: a new therapeutic target in renal cell carcinoma. Br J Cancer. 2009;101(12):2005–14.PubMedCentralPubMedCrossRef
5.
Zurück zum Zitat Mai W, Kawakami K, Shakoori A, Kyo S, Miyashita K, Yokoi K, et al. Deregulated GSK3{beta} sustains gastrointestinal cancer cells survival by modulating human telomerase reverse transcriptase and telomerase. Clin Cancer Res. 2009;15(22):6810–9.PubMedCrossRef Mai W, Kawakami K, Shakoori A, Kyo S, Miyashita K, Yokoi K, et al. Deregulated GSK3{beta} sustains gastrointestinal cancer cells survival by modulating human telomerase reverse transcriptase and telomerase. Clin Cancer Res. 2009;15(22):6810–9.PubMedCrossRef
6.
Zurück zum Zitat Naito S, Bilim V, Yuuki K, Ugolkov A, Motoyama T, Nagaoka A, et al. Glycogen synthase kinase-3beta: a prognostic marker and a potential therapeutic target in human bladder cancer. Clin Cancer Res. 2010;16(21):5124–32.PubMedCrossRef Naito S, Bilim V, Yuuki K, Ugolkov A, Motoyama T, Nagaoka A, et al. Glycogen synthase kinase-3beta: a prognostic marker and a potential therapeutic target in human bladder cancer. Clin Cancer Res. 2010;16(21):5124–32.PubMedCrossRef
7.
Zurück zum Zitat Wang L, Zuo B, Xu D, Ren Z, Zhang H, Li X, et al. Alternative splicing of the porcine glycogen synthase kinase 3β (GSK-3β) gene with differential expression patterns and regulatory functions. PLoS One. 2012;7(7), e40250.PubMedCentralPubMedCrossRef Wang L, Zuo B, Xu D, Ren Z, Zhang H, Li X, et al. Alternative splicing of the porcine glycogen synthase kinase 3β (GSK-3β) gene with differential expression patterns and regulatory functions. PLoS One. 2012;7(7), e40250.PubMedCentralPubMedCrossRef
8.
Zurück zum Zitat Miyashita K, Nakada M, Shakoori A, Ishigaki Y, Shimasaki T, Motoo Y, et al. An emerging strategy for cancer treatment targeting aberrant glycogen synthase kinase 3 beta. Anticancer Agents Med Chem. 2009;9(10):1114–22.PubMedCrossRef Miyashita K, Nakada M, Shakoori A, Ishigaki Y, Shimasaki T, Motoo Y, et al. An emerging strategy for cancer treatment targeting aberrant glycogen synthase kinase 3 beta. Anticancer Agents Med Chem. 2009;9(10):1114–22.PubMedCrossRef
9.
Zurück zum Zitat Ougolkov AV, Fernandez-Zapico ME, Bilim VN, Smyrk TC, Chari ST, Billadeau DD. Aberrant nuclear accumulation of glycogen synthase kinase-3beta in human pancreatic cancer: association with kinase activity and tumor dedifferentiation. Clin Cancer Res. 2006;12(17):5074–81.PubMedCentralPubMedCrossRef Ougolkov AV, Fernandez-Zapico ME, Bilim VN, Smyrk TC, Chari ST, Billadeau DD. Aberrant nuclear accumulation of glycogen synthase kinase-3beta in human pancreatic cancer: association with kinase activity and tumor dedifferentiation. Clin Cancer Res. 2006;12(17):5074–81.PubMedCentralPubMedCrossRef
10.
Zurück zum Zitat Phukan S, Babu VS, Kannoji A, Hariharan R, Balaji VN. GSK3beta: role in therapeutic landscape and development of modulators. Br J Pharmacol. 2010;160(1):1–19.PubMedCentralPubMedCrossRef Phukan S, Babu VS, Kannoji A, Hariharan R, Balaji VN. GSK3beta: role in therapeutic landscape and development of modulators. Br J Pharmacol. 2010;160(1):1–19.PubMedCentralPubMedCrossRef
11.
Zurück zum Zitat Marchand B, Tremblay I, Cagnol S, Boucher MJ. Inhibition of glycogen synthase kinase-3 activity triggers an apoptotic response in pancreatic cancer cells through JNK-dependent mechanisms. Carcinogenesis. 2012;33(3):529–37.PubMedCrossRef Marchand B, Tremblay I, Cagnol S, Boucher MJ. Inhibition of glycogen synthase kinase-3 activity triggers an apoptotic response in pancreatic cancer cells through JNK-dependent mechanisms. Carcinogenesis. 2012;33(3):529–37.PubMedCrossRef
12.
Zurück zum Zitat Hattermann K, Mentlein R. An Infernal Trio: The chemokine CXCL12 and its receptors CXCR4 and CXCR7 in tumor biology. Ann Anat. 2013;195(2):103–10.PubMedCrossRef Hattermann K, Mentlein R. An Infernal Trio: The chemokine CXCL12 and its receptors CXCR4 and CXCR7 in tumor biology. Ann Anat. 2013;195(2):103–10.PubMedCrossRef
13.
Zurück zum Zitat Lekstan A, Olakowski M, Jabłońska B, Labuzek K, Olakowska E, Filip I, et al. Concentration of gelatinases and their tissue inhibitors in pancreatic inflammatory and neoplastic tumors and their influence on the early postoperative course. Pol Przegl Chir. 2013;85(2):65–72.PubMed Lekstan A, Olakowski M, Jabłońska B, Labuzek K, Olakowska E, Filip I, et al. Concentration of gelatinases and their tissue inhibitors in pancreatic inflammatory and neoplastic tumors and their influence on the early postoperative course. Pol Przegl Chir. 2013;85(2):65–72.PubMed
14.
Zurück zum Zitat Durlik M, Gardian K. Metalloproteinase 2 and 9 activity in the development of pancreatic cancer. Pol Przegl Chir. 2012;84(8):377–82.PubMed Durlik M, Gardian K. Metalloproteinase 2 and 9 activity in the development of pancreatic cancer. Pol Przegl Chir. 2012;84(8):377–82.PubMed
15.
Zurück zum Zitat Luo G, Long J, Cui X, Xiao Z, Liu Z, Shi S, et al. Highly lymphatic metastatic pancreatic cancer cells possess stem cell-like properties. Int J Oncol. 2013;42(3):979–84.PubMed Luo G, Long J, Cui X, Xiao Z, Liu Z, Shi S, et al. Highly lymphatic metastatic pancreatic cancer cells possess stem cell-like properties. Int J Oncol. 2013;42(3):979–84.PubMed
16.
Zurück zum Zitat Wang H, Rana S, Giese N, Büchler MW, Zöller M. Tspan8, CD44v6 and alpha6beta4 are biomarkers of migrating pancreatic cancer-initiating cells. Int J Cancer 2013;doi: 10.1002/ijc.28044. Wang H, Rana S, Giese N, Büchler MW, Zöller M. Tspan8, CD44v6 and alpha6beta4 are biomarkers of migrating pancreatic cancer-initiating cells. Int J Cancer 2013;doi: 10.1002/ijc.28044.
17.
Zurück zum Zitat Zhou W, Wang L, Gou SM, Wang TL, Zhang M, Liu T, et al. ShRNA silencing glycogen synthase kinase-3 beta inhibits tumor growth and angiogenesis in pancreatic cancer. Cancer Lett. 2012;316(2):178–86.PubMedCrossRef Zhou W, Wang L, Gou SM, Wang TL, Zhang M, Liu T, et al. ShRNA silencing glycogen synthase kinase-3 beta inhibits tumor growth and angiogenesis in pancreatic cancer. Cancer Lett. 2012;316(2):178–86.PubMedCrossRef
18.
Zurück zum Zitat Kim YS, Noh MY, Kim JY, Yu HJ, Kim KS, Kim SH, et al. Direct GSK-3β inhibition enhances mesenchymal stromal cell migration by increasing expression of β-PIX and CXCR4. Mol Neurobiol. 2013;47(2):811–20.PubMedCrossRef Kim YS, Noh MY, Kim JY, Yu HJ, Kim KS, Kim SH, et al. Direct GSK-3β inhibition enhances mesenchymal stromal cell migration by increasing expression of β-PIX and CXCR4. Mol Neurobiol. 2013;47(2):811–20.PubMedCrossRef
19.
Zurück zum Zitat Dimova N, Wysoczynski M, Rokosh G. Stromal cell derived factor-1α promotes C-Kit + cardiac stem/progenitor cell quiescence through casein kinase 1α and GSK3β. Stem Cells. 2014;32(2):487–99.PubMedCentralPubMedCrossRef Dimova N, Wysoczynski M, Rokosh G. Stromal cell derived factor-1α promotes C-Kit + cardiac stem/progenitor cell quiescence through casein kinase 1α and GSK3β. Stem Cells. 2014;32(2):487–99.PubMedCentralPubMedCrossRef
20.
Zurück zum Zitat Tamura M, Sato MM, Nashimoto M. Regulation of CXCL12 expression by canonical Wnt signaling in bone marrow stromal cells. Int J Biochem Cell Biol. 2011;43(5):760–7.PubMedCrossRef Tamura M, Sato MM, Nashimoto M. Regulation of CXCL12 expression by canonical Wnt signaling in bone marrow stromal cells. Int J Biochem Cell Biol. 2011;43(5):760–7.PubMedCrossRef
21.
Zurück zum Zitat Pan F, Ma SJ, Cao W, Liu H, Chen F, Chen X, et al. SDF-1α upregulation of MMP-2 is mediated by p38 MAPK signaling in pancreatic cancer cell lines. Mol Biol Rep. 2013;40(7):4139–46.PubMedCrossRef Pan F, Ma SJ, Cao W, Liu H, Chen F, Chen X, et al. SDF-1α upregulation of MMP-2 is mediated by p38 MAPK signaling in pancreatic cancer cell lines. Mol Biol Rep. 2013;40(7):4139–46.PubMedCrossRef
22.
Zurück zum Zitat Kitagishi Y, Kobayashi M, Kikuta K, Matsuda S. Roles of PI3K/AKT/GSK3/mTOR Pathway in Cell Signaling of Mental Illnesses. Depress Res Treat. 2012;2012(752563). Kitagishi Y, Kobayashi M, Kikuta K, Matsuda S. Roles of PI3K/AKT/GSK3/mTOR Pathway in Cell Signaling of Mental Illnesses. Depress Res Treat. 2012;2012(752563).
23.
Zurück zum Zitat Watson RL, Spalding AC, Zielske SP, Morgan M, Kim AC, Bommer GT, et al. GSK3beta and beta-catenin modulate radiation cytotoxicity in pancreatic cancer. Neop;asia. 2010;12(5):357–65. Watson RL, Spalding AC, Zielske SP, Morgan M, Kim AC, Bommer GT, et al. GSK3beta and beta-catenin modulate radiation cytotoxicity in pancreatic cancer. Neop;asia. 2010;12(5):357–65.
24.
Zurück zum Zitat Gaisina IN, Gallier F, Ougolkov AV, Kim KH, Kurome T, Guo S, et al. From a natural product lead to the identification of potent and selective benzofuran-3-yl-(indol-3-yl)maleimides as glycogen synthase kinase 3beta inhibitors that suppress proliferation and survival of pancreatic cancer cells. J Med Chem. 2009;52(7):1853–63.PubMedCentralPubMedCrossRef Gaisina IN, Gallier F, Ougolkov AV, Kim KH, Kurome T, Guo S, et al. From a natural product lead to the identification of potent and selective benzofuran-3-yl-(indol-3-yl)maleimides as glycogen synthase kinase 3beta inhibitors that suppress proliferation and survival of pancreatic cancer cells. J Med Chem. 2009;52(7):1853–63.PubMedCentralPubMedCrossRef
25.
Zurück zum Zitat Jiang PH, Motoo Y, Sawabu N, Minamoto T. Effect of gemcitabine on the expression of apoptosis-related genes in human pancreatic cancer cells. Worl J Gastroenterol. 2006;12(10):1597–602. Jiang PH, Motoo Y, Sawabu N, Minamoto T. Effect of gemcitabine on the expression of apoptosis-related genes in human pancreatic cancer cells. Worl J Gastroenterol. 2006;12(10):1597–602.
26.
Zurück zum Zitat Kitano A, Shimasaki T, Chikano Y, Nakada M, Hirose M, Higashi T, et al. Aberrant glycogen synthase kinase 3β is involved in pancreatic cancer cell invasion and resistance to therapy. PLoS One. 2013;8(2), e55289.PubMedCentralPubMedCrossRef Kitano A, Shimasaki T, Chikano Y, Nakada M, Hirose M, Higashi T, et al. Aberrant glycogen synthase kinase 3β is involved in pancreatic cancer cell invasion and resistance to therapy. PLoS One. 2013;8(2), e55289.PubMedCentralPubMedCrossRef
27.
Zurück zum Zitat Ou YQ, Zhu W, Li Y, Qiu PX, Huang YJ, Xie J, et al. Aspirin inhibits proliferation of gemcitabine-resistant human pancreatic cancer cells and augments gemcitabine-induced cytotoxicity. Acta Pharmacol Sin. 2010;31(1):73–80.PubMedCentralPubMedCrossRef Ou YQ, Zhu W, Li Y, Qiu PX, Huang YJ, Xie J, et al. Aspirin inhibits proliferation of gemcitabine-resistant human pancreatic cancer cells and augments gemcitabine-induced cytotoxicity. Acta Pharmacol Sin. 2010;31(1):73–80.PubMedCentralPubMedCrossRef
28.
Zurück zum Zitat Ristorcelli E, Beraud E, Mathieu S, Lombardo D, Verine A. Essential role of Notch signaling in apoptosis of human pancreatic tumoral cells mediated by exosomal nanoparticles. Int J Cancer. 2009;125(5):1016–26.PubMedCrossRef Ristorcelli E, Beraud E, Mathieu S, Lombardo D, Verine A. Essential role of Notch signaling in apoptosis of human pancreatic tumoral cells mediated by exosomal nanoparticles. Int J Cancer. 2009;125(5):1016–26.PubMedCrossRef
29.
Zurück zum Zitat Shimasaki T, Ishigaki Y, Nakamura Y, Takata T, Nakaya N, Nakajima H, et al. Glycogen synthase kinase 3β inhibition sensitizes pancreatic cancer cells to gemcitabine. J Gastroenterol. 2012;47(3):321–33.PubMedCrossRef Shimasaki T, Ishigaki Y, Nakamura Y, Takata T, Nakaya N, Nakajima H, et al. Glycogen synthase kinase 3β inhibition sensitizes pancreatic cancer cells to gemcitabine. J Gastroenterol. 2012;47(3):321–33.PubMedCrossRef
30.
Zurück zum Zitat Shimasaki T, Kitano A, Motoo Y, Minamoto T. Aberrant glycogen synthase kinase 3β in the development of pancreatic cancer. J Carcinog. 2012;doi: 10.4103/1477-3163.100866. Shimasaki T, Kitano A, Motoo Y, Minamoto T. Aberrant glycogen synthase kinase 3β in the development of pancreatic cancer. J Carcinog. 2012;doi: 10.4103/1477-3163.100866.
31.
Zurück zum Zitat Johnson JL, Rupasinghe S, Stefani F, Schuler MA, Gonzalez de Mejia E. Citrus flavonoids luteolin, apigenin, and quercetin inhibit glycogen synthase kinase-3β enzymatic activity by lowering the interaction energy within the binding cavity. J Med Food. 2011;14(4):325–33.PubMedCentralPubMedCrossRef Johnson JL, Rupasinghe S, Stefani F, Schuler MA, Gonzalez de Mejia E. Citrus flavonoids luteolin, apigenin, and quercetin inhibit glycogen synthase kinase-3β enzymatic activity by lowering the interaction energy within the binding cavity. J Med Food. 2011;14(4):325–33.PubMedCentralPubMedCrossRef
33.
Zurück zum Zitat Garcea G, Manson MM, Neal CP, Pattenden CJ, Sutton CD, Dennison AR, et al. Glycogen synthase kinase-3 beta; a new target in pancreatic cancer? Curr Cancer Drug Targets. 2007;7(3):209–15.PubMedCrossRef Garcea G, Manson MM, Neal CP, Pattenden CJ, Sutton CD, Dennison AR, et al. Glycogen synthase kinase-3 beta; a new target in pancreatic cancer? Curr Cancer Drug Targets. 2007;7(3):209–15.PubMedCrossRef
34.
Zurück zum Zitat Wilson 3rd W, Baldwin AS. Maintenance of constitutive IkappaB kinase activity by glycogen synthase kinase-3alpha/beta in pancreatic cancer. Cancer Res. 2008;68(19):8156–63.PubMedCentralPubMedCrossRef Wilson 3rd W, Baldwin AS. Maintenance of constitutive IkappaB kinase activity by glycogen synthase kinase-3alpha/beta in pancreatic cancer. Cancer Res. 2008;68(19):8156–63.PubMedCentralPubMedCrossRef
35.
Zurück zum Zitat Al-Aynati MM, Radulovich N, Riddell RH, Tsao MS. Epithelial-cadherin and beta-catenin expression changes in pancreatic intraepithelial neoplasia. Clin Cancer Res. 2004;10(4):1235–40.PubMedCrossRef Al-Aynati MM, Radulovich N, Riddell RH, Tsao MS. Epithelial-cadherin and beta-catenin expression changes in pancreatic intraepithelial neoplasia. Clin Cancer Res. 2004;10(4):1235–40.PubMedCrossRef
36.
Zurück zum Zitat Lapid K, Itkin T, D’Uva G, Ovadya Y, Ludin A, Caglio G, et al. GSK3β regulates physiological migration of stem/progenitor cells via cytoskeletal rearrangement. J Clin Invest. 2013;123(4):1705–17.PubMedCentralPubMedCrossRef Lapid K, Itkin T, D’Uva G, Ovadya Y, Ludin A, Caglio G, et al. GSK3β regulates physiological migration of stem/progenitor cells via cytoskeletal rearrangement. J Clin Invest. 2013;123(4):1705–17.PubMedCentralPubMedCrossRef
37.
Zurück zum Zitat Liu Z, Habener JF. Stromal cell-derived factor-1 promotes survival of pancreatic beta cells by the stabilisation of beta-catenin and activation of transcription factor 7-like 2 (TCF7L2). Diabetologia. 2009;52(8):1589–98.PubMedCentralPubMedCrossRef Liu Z, Habener JF. Stromal cell-derived factor-1 promotes survival of pancreatic beta cells by the stabilisation of beta-catenin and activation of transcription factor 7-like 2 (TCF7L2). Diabetologia. 2009;52(8):1589–98.PubMedCentralPubMedCrossRef
38.
Zurück zum Zitat Rihua Zhang XP, Huang Z, Weber GF, Zhang G. Osteopontin Enhances the Expression and Activity of MMP-2 via the SDF-1/CXCR4 Axis in Hepatocellular Carcinoma Cell Lines. PLoS One. 2011;6(8), e23831.PubMedCentralPubMedCrossRef Rihua Zhang XP, Huang Z, Weber GF, Zhang G. Osteopontin Enhances the Expression and Activity of MMP-2 via the SDF-1/CXCR4 Axis in Hepatocellular Carcinoma Cell Lines. PLoS One. 2011;6(8), e23831.PubMedCentralPubMedCrossRef
Metadaten
Titel
GSK3β mediates pancreatic cancer cell invasion in vitro via the CXCR4/MMP-2 Pathway
verfasst von
Xu Ying
Li Jing
Shijie Ma
Qianjun Li
Xiaoling Luo
Zhenguo Pan
Yanling Feng
Pan Feng
Publikationsdatum
01.12.2015
Verlag
BioMed Central
Erschienen in
Cancer Cell International / Ausgabe 1/2015
Elektronische ISSN: 1475-2867
DOI
https://doi.org/10.1186/s12935-015-0216-y

Weitere Artikel der Ausgabe 1/2015

Cancer Cell International 1/2015 Zur Ausgabe

Umsetzung der POMGAT-Leitlinie läuft

03.05.2024 DCK 2024 Kongressbericht

Seit November 2023 gibt es evidenzbasierte Empfehlungen zum perioperativen Management bei gastrointestinalen Tumoren (POMGAT) auf S3-Niveau. Vieles wird schon entsprechend der Empfehlungen durchgeführt. Wo es im Alltag noch hapert, zeigt eine Umfrage in einem Klinikverbund.

CUP-Syndrom: Künstliche Intelligenz kann Primärtumor finden

30.04.2024 Künstliche Intelligenz Nachrichten

Krebserkrankungen unbekannten Ursprungs (CUP) sind eine diagnostische Herausforderung. KI-Systeme können Pathologen dabei unterstützen, zytologische Bilder zu interpretieren, um den Primärtumor zu lokalisieren.

Sind Frauen die fähigeren Ärzte?

30.04.2024 Gendermedizin Nachrichten

Patienten, die von Ärztinnen behandelt werden, dürfen offenbar auf bessere Therapieergebnisse hoffen als Patienten von Ärzten. Besonders gilt das offenbar für weibliche Kranke, wie eine Studie zeigt.

Adjuvante Immuntherapie verlängert Leben bei RCC

25.04.2024 Nierenkarzinom Nachrichten

Nun gibt es auch Resultate zum Gesamtüberleben: Eine adjuvante Pembrolizumab-Therapie konnte in einer Phase-3-Studie das Leben von Menschen mit Nierenzellkarzinom deutlich verlängern. Die Sterberate war im Vergleich zu Placebo um 38% geringer.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.