Dengue virus (DENV), the causative agent of human Dengue hemorrhagic fever, is a mosquito-borne virus found in tropical and sub-tropical regions around the world. Vaccines against DENV are currently unavailable. Guanylate-binding protein 1 (GBP1) is one of the Interferon (IFN) stimulated genes (ISGs) and has been shown important for host immune defense against various pathogens. However, the role of GBP1 during DENV infection remains unclarified. In this study, we evaluated the relevance of GBP1 to DENV infection in in vitro model.
Findings
Quantitative RT-PCR (qRT-PCR) and Western blot showed that the expression of mouse Gbp1 was dramatically upregulated in DENV-infected RAW264.7 cells. The intracellular DENV loads were significantly higher in Gbp1 silenced cells compared with controls. The expression levels of selective anti-viral cytokines were decreased in Gbp1 siRNA treated cells, while the transcription factor activity of NF-κB was impaired upon GBP1 silencing during infection.
Conclusions
Our data suggested that GBP1 plays an antiviral role during DENV infection.
The online version of this article (doi:10.1186/1743-422X-9-292) contains supplementary material, which is available to authorized users.
Wen Pan, Xiangyang Zuo contributed equally to this work.
Competing interests
The authors declare that they have no competing interests.
Abkürzungen
GBP1
Guanylate-binding protein-1
DENV
Dengue virus
Ifnβ1
Type I interferon
Il6
Interleukin-6
Cxcl1
Chemokine (C-X-C motif) ligand 1
Cxcl2
Chemokine (C-X-C motif) ligand 2
Ccl5
Chemokine (C-C motif) ligand 5
Ccr5
C-C chemokine receptor type 5
NF-κB
Nuclear factor kappa B
AP1
Activator protein 1.
Findings
Dengue virus (DENV), a member of the mosquito-borne flavivirus family, is an icosahedral, enveloped virus with a single-stranded positive sense RNA genome. Millions of cases of DENV infection occur worldwide each year [1, 2]. Dengue hemorrhagic fever, the severe form of DENV infections, can cause serious haemorrhage, sudden drop in blood pressure (shock) and even death. Since no vaccine against DENV is currently available, much effort is needed to explore the host antiviral mechanisms for control of DENV infection and vaccine development [1, 3‐5].
Interferons (IFNs) are major antiviral cytokines released by host cells in response to viral and other pathogenic infections and play crucial roles in induction and regulation of both innate and adaptive immune responses [6]. IFNs establish an antiviral state by activating mainly the Janus kinase/signal transducer and activator of transcription (JAK/STAT) signaling pathway and other signaling cascades. Even though hundreds of genes are characterized as interferon-stimulated genes (ISGs), the roles of many ISGs during infection remain largely unknown [7, 8].
Anzeige
Guanylate-binding protein 1 (GBP1) is one of the ISGs that most strongly induced by IFNs [9] and belongs to a family of GTPases which are divided into three groups: (1) the large GTPases, also known as GBPs; (2) the small GTPases; (3) the Mx proteins. The human large GTPase family is composed of seven members encoded by a gene cluster located on chromosome 1 [10, 11]. The emerging roles of GBP1 in host immune responses have been characterized in in vitro and in vivo models [12‐15]. For example, GBP1 is overexpressed in endothelial cells upon activation of inflammatory cytokines and is involved in intestinal mucosal inflammation [16]. Recently, a study using Gbp1 knockout mice indicated that GBP1 has strong anti-bacterial activity [17]. There are also reports suggesting that GBP1 is involved in host immune response against chlamydia [18] and viruses including vesicular stomatitis virus, encephalomyocarditis virus and Hepatitis C Virus [19‐21]. However, the distinct role of GBP1 during infection of other pathogens, including mosquito-borne flaviviruses remains largely unknown. We hereby investigated the physiological role of GBP1 during DENV infection in different in vitro models.
Gbp1 is upregulated upon DENV infection
Mouse macrophage cell line RAW264.7 can be readily infected by DENV, and served as an in vitro model for the study of host innate immune response to DENV. By using a quantitative RT-PCR (qRT-PCR) based small cDNA array (SABiosciences, Frederick, MD), we measured the expression profile of genes from Jak-Stat signaling pathway in DENV (DENV 2, New Guinea C strain) infected RAW264.7 cells. A number of genes were found up- or down-regulated upon DENV infection, as reported in our previous work (Additional file 1of Ref. [22]). Among them, Gbp1 was upregulated 3.97-fold in DENV infected cells in comparison to uninfected controls. Independent qRT-PCR and Western blotting further confirmed the upregulation of GBP1 (mRNA and protein) upon DENV infection (Figure 1, A and B). Recent studies have identified host genes that upregulated in human patients with acute DENV infection [23, 24]. GBP1 was one of the genes most highly induced in patients’ blood cells during early DENV infection [23], and this is consistent with our result here shown in in vitro study.
×
Gbp1 has antiviral activity against DENV infection
To study the specific role of GBP1 during DENV infection, an siRNA based RNA interference study was performed in RAW264.7 cells. siRNAs specific for Gbp1 or scrambled control (N.C.) were delivered into RAW264.7 cells respectively via electroporation. 24hrs after siRNA transfection, cells were challenged by DENV (MOI=1.0) for another 24hrs. Cells were then harvested and total RNA and cDNA were made according to standard protocols. Gbp1 was silenced efficiently as analyzed by qRT-PCR (Figure 2A) using gene specific primers (Table 1) and by Western blot (Figure 2B). The intracellular viral loads, in terms of the transcript levels of the envelop gene (E), were quantified by qRT-PCR and normalized to mouse beta-actin gene. As shown in Figure 2C, the DENV viral load was increased 5.0-fold (p<0.05) in Gbp1 silenced cells compared with control cells. To measure the production of infectious virus from these cells, a plaque assay was performed in 293T cells. The titers of virus in supernatants from Gbp1 silenced cells were about 10- fold higher compared with that from control cells (Figure 2D). These data suggested that Gbp1 has an anti-viral activity against DENV in RAW264.7 cells.
×
Table 1
siRNA and oligo-primer sequences for this study
No.
Sequence (5’-3’)
Note
1
GGAACGUAUAAAAGCAGAAtt
siRNA seq for mouse gene Gbp1
2
AAGGCAUGUACCAUAAGCUtt
siRNA seq for human gene GBP1
3
AGAGGGAAATCGTGCGTGAC
Forward primer for qRT-PCR of mouse beta-actin
4
CAATAGTGATGACCTGGCCGT
Reverse primer for qRT-PCR of mouse beta-actin
5
GGGCATGGAGTCCTGTGGCA
Forward primer for qRT-PCR of human beta-actin
6
GGGTGCCAGGGCAGTGATCTC
Reverse primer for qRT-PCR of human beta-actin
7
CATTCCAAGTGAGAATCTCTTTGTCA
Forward primer for qRT-PCR of DENV E gene
8
CAGATCTCTGATGAATAACCAACG
Reverse primer for qRT-PCR of DENV E gene
9
GGGCAGCTGTCTTTGGGTAGAC
Forward primer for qRT-PCR of mouse Gbp1 gene
10
AGCATGAGGCCCTAGGAGCTGT
Reverse primer for qRT-PCR of mouse Gbp1 gene
11
AAGAGAGGACCCTCGCTCTTA
Forward primer for qRT-PCR of human GBP1 gene
12
ATGCCTTGGTTAGGGGTGAC
Reverse primer for qRT-PCR of human GBP1 gene
Selective cytokines are downregulated in Gbp1 silenced cells upon DENV infection
In order to examine whether the silencing of Gbp1 would affect the expression of cytokines, the expressions of some representative cytokines and chemokines were measured in Gbp1 siRNA or scrambled siRNA treated cells after DENV infection. Total of six genes were chosen for the study, including type I interferon (Ifnβ1), Interleukin-6 (Il6), Chemokine (C-X-C motif) ligand 1 (Cxcl1), Chemokine (C-X-C motif) ligand 2(Cxcl2), Chemokine (C-C motif) ligand 5(Ccl5) and C-C chemokine receptor type 5(Ccr5). Gene specific primers and probe sets were purchased from Applied Biosystems (Carlsbad, CA). After DENV infection, the transcription levels of Ifnβ1, Il6, and Ccl5 in Gbp1 silenced groups were decreased 2 to 3-fold comparing with controls (p<0.05). However, transcription levels of Cxcl1/2 and Ccr5 were not significantly affected (Figure 3, A-F). Consistent with the mRNA expression, the protein secretion of IFNβ and IL6 were decreased in Gbp1 silenced cells (Figure 3, G and H). These data suggested that antiviral role of Gbp1 is associated with its ability to modulate some antiviral or pro-inflammatory cytokines during DENV infection.
×
Anzeige
Transcriptional factor activity of NF-κB is impaired in GBP1 silenced cells
NF-κ B (nuclear factor- kappa B) and AP1 (activator protein 1) play crucial roles in antiviral innate immune response through promoting the transcription of numerous antiviral or pro-inflammatory genes [25, 26]. Since the expression levels of some cytokines were decreased in Gbp1 silenced cells after DENV infection, we further measured the activities of NF-κB and AP1 upon GBP1 silencing. 293 cells can be robustly infected by DENV[27], and are the most common system to measure the transcriptional factor activity using dual luciferase reporter assay. Reporter plasmids pGL- NF-κB, pGL-AP1 and pRL-TK (internal control) (Promega, Madison, MI) in together with siRNAs specific for human GBP1 or scrambled control (N.C.), were delivered into 293T cells respectively by transfection using Lipofectamine® LTX & PLUS (Invitrogen, Grand Island, NY). 24hrs after transfection, cells were challenged by DENV (MOI=1.0) for another 24hrs, respectively. RNAi efficiency was confirmed by Western blot (Figure 4A). Cells were then harvested and lysed for dual luciferase reporter assay (Promega, Madison, MI). The relative activity of NF-κB was decreased by 40% in GBP1 knockdown cells in comparison with controls; while the AP1 activity was not significantly impaired in this case (Figure 4, B and C). These data suggested that GBP1 may influence activity of NF-κB, thereby contribute to the production of anti-viral or pro-inflammatory cytokines/chemokines. This could also partially address the mechanisms of how GBP1 inhibits DENV replication in cell culture.
×
More and more attention has been focused on the roles of large GTPase family in immune response [12‐14]. GBP1 can be induced by IFNγ as well as IFNα/β, and its induction can be augmented by TNF-α, IL-1 or LPS[12]. The inhibitory roles of GBP1 to different pathogens have been reported [17‐19, 21]. Itsui and his colleague showed that HCV replication was suppressed significantly by overexpression of GBP1, while binding of the HCV-NS5B protein to GBP1 countered the antiviral effect through inhibition of GTPase activity [21]. MacMicking speculated that GBP1 might help to limit the cell-to-cell spread of progeny virus through its anti-cell proliferative activity [13, 28]. GBP1 has modest antiviral activity against the negative strand RNA viruses (such as Rhabdovirus, vesicular stomatitis virus), as well as the positive strand RNA viruses (Picornovirus and encephalomyocarditis virus) in cultured cells [19]. In both anti- chlamydia and antiviral study, the GTPase domain of GBP1 was suggested to be critical for its inhibitory activity [18, 21]. A recent in vivo study further suggested that GBPs can solicit host defense proteins, including the phagocyte oxidase, antimicrobial peptides, and autophagy effectors, to kill intracellular bacteria [17]. While, more work are still needed to address the role and mechanisms of GBP1 in different infection models especially for viruses.
In this study, we confirmed that GBP1 shows inhibitory effect on DENV infection, influences the activity of NF-κB and further contributes to the production of anti-viral and pro-inflammatory cytokine/chemokines. This could be a novel mechanism for GBP1 to exert its antiviral activity in cellular level. Since NF-κB can be activated upon a broad range of pathogen infection, this could be a common action for GBP1 to play its role in different infection models. Further experiments will address the detail mechanisms of GBP1 on influencing NF-κB pathway in various models.
Authors contribution
JD, WP and XS designed the experiments and prepared the manuscript. XZ, WP and TF performed all the experiments. All authors read and approved the final manuscript.
Acknowledgements
This work was supported by a Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), Program for Changjiang Scholars and Innovative Research Team in University (PCSIRT) (IRT1075), National Natural Science Foundation of China (NSFC) (81172812, 81271792, 31200648) and Jiangsu Natural Science Foundation (BK2012180). We thank Prof. Zhenyou Jiang from Jinan University, Guangzhou, China for technical support.
Open Access
This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License (
https://creativecommons.org/licenses/by/2.0
), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Competing interests
The authors declare that they have no competing interests.
Die Therapie von Echinokokkosen sollte immer in spezialisierten Zentren erfolgen. Eine symptomlose Echinokokkose kann – egal ob von Hunde- oder Fuchsbandwurm ausgelöst – konservativ erfolgen. Wenn eine Op. nötig ist, kann es sinnvoll sein, vorher Zysten zu leeren und zu desinfizieren.
Bewegungs-, Dehnungs- und Entspannungsübungen im Wasser lindern die Beschwerden von Patientinnen mit Fibromyalgie besser als das Üben auf trockenem Land. Das geht aus einer spanisch-brasilianischen Vergleichsstudie hervor.
Seit November 2023 gibt es evidenzbasierte Empfehlungen zum perioperativen Management bei gastrointestinalen Tumoren (POMGAT) auf S3-Niveau. Vieles wird schon entsprechend der Empfehlungen durchgeführt. Wo es im Alltag noch hapert, zeigt eine Umfrage in einem Klinikverbund.
Das Risiko, im Lauf des Lebens an Vorhofflimmern zu erkranken, ist in den vergangenen 20 Jahren gestiegen: Laut dänischen Zahlen wird es drei von zehn Personen treffen. Das hat Folgen weit über die Schlaganfallgefährdung hinaus.
Update Innere Medizin
Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.