Background
Folliculogenesis is under the control of growth factors and two pituitary gonadotropin hormones; follicle-stimulating hormone (FSH) and luteinizing hormone (LH). These heterodimeric glycoproteins bind in the ovary to specific G-protein coupled receptors, FshR and LhR respectively, to facilitate the growth and differentiation of ovarian cells and also to control the production of the two steroid hormones estradiol and progesterone, for review see [
1,
2].
Amongst the several autocrine and/or paracrine growth factors produced by the follicle itself, prostaglandins are critical for multiple stages of reproduction [
3,
4]. Mice lacking the
cyclo-oxygenase-2 (
Cox-2) gene encoding the rate limiting step in prostaglandin synthesis, show pre-implantation deficiencies throughout ovulation and fertilization [
5]. This phenotype is also seen in the absence of prostaglandin E2 (PGE2) receptor EP2 [
6]. A surge in LH levels in granulosa cells of pre-ovulatory follicles induces expression of
Cox-2 and EP2 [
7], while elevated PGE2 in turn, stimulates cumulus expansion by elevating cAMP [
8]. It has also been shown that PGE2 increases expression of the
aromatase Cyp19A1 gene, the key gene in estrogen biosynthesis in granulosa cells [
9], as well as acting as a luteotrophic component to stimulate luteal progesterone secretion through a cAMP-mediated pathway in both human and ruminants [
10]. Besides PGE2, prostaglandin PGF2α secretion via
cyclo-oxygenase COX-1 expression and the action of its receptor FP, also plays an important role in diminishing progesterone levels and stimulating luteolysis, a crucial stage in inducing labor and pup delivery during parturition in human and mice [
11,
12]. Whereas PGE2 and PGF2α are both involved in regulating ovulation, luteinization, luteolysis and fertility [
13‐
16], the role(s) of PGD2 signaling in folliculogenesis and ovarian physiology is not precisely understood.
PGD2 has been implicated as a signaling molecule in the mediation or regulation of various biological processes such as platelet aggregation, broncho-constriction and allergic diseases [
17,
18], whilst also being identified as a partner of the embryonic sex-determining male cascade [
19,
20]. Secreted PGD2 interacts with two receptors: (i) the specific membrane-bound DP receptor (DP1) associated with adenylcyclase and intracellular cAMP production [
21,
22], and (ii) chemo attractant receptor Th2 (CRTH2) cells (DP2) which is coupled to Ca
2+ signaling. A metabolite of PGD2, PGJ2, has also been shown to bind the peroxisome proliferator-activated receptor PPARγ a member of the orphan nuclear receptor superfamily implicated in key female reproductory roles [
23]. PGD2 is produced by two prostaglandin D synthases (Pgds) responsible for mediating the final regulatory step in the biosynthetic pathway of PGD2 production [
24]: (i) the lipocalin-type Pgds (L-Pgds), a member of the lipocalin ligand-carrier protein family [
24,
25] and (ii) the hematopoietic-type Pgds (H-Pgds) or GSH-requiring enzyme [
26].
The
L-Pgds transcript initially found in the brain [
27], represents one of the ten most abundant transcripts in the cortex, hypothalamus and pituitary gland [
28]. However, it is not expressed in either the embryonic or the adult ovary [
20,
29,
30] whereas
H-Pgds is expressed in the embryonic gonad of both sexes (submitted data). H-Pgds is a cytosolic protein responsible for the biosynthesis of PGD2 in immune and inflammatory cells such as mast cells or Th2 cells, and is also expressed in the spleen, thymus, skin and liver [
26], in the microglia where H-Pgds-produced PGD2 is responsible for the neuroinflammation associated with brain injury and neurodegenerative diseases [
31], as well as in trophoblasts, uterine epithelium and endometrial glands at the implantation site of the human decidua [
32]. H-Pgds expression was also found in the hypothalamus-pituitary axis of hens and has been associated with high egg production [
33]. Recently, PGD2 produced by H-Pgds and its metabolite PGJ2 have been shown to induce transcription of the
Lhb subunit gene in the primary culture of chicken anterior pituitary cells, via the PPARα and PPARγ signaling pathways [
34]. On the other hand, a stimulatory effect of PGD2 on progesterone secretion has been found
in vitro in isolated human corpus lutea [
35]. However, the precise
H-Pgds expression profile and function of PGD2 signaling in the adult ovary remain unknown.
Here, we report the characterization and ovarian localization of H-Pgds mRNA and provide evidence of a role of H-Pgds-produced PGD2 signaling in the FSH signaling via the increase of FshR and LhR receptor expression, leading to activation of steroidogenic Cyp11A1 and StAR gene expression and progesterone secretion. We found that in vivo inhibition of H-Pgds activity failed to modify PGE2 and PGF2α synthesis in the ovary and also identify a role for H-Pgds-produced PGD2 in follicular growth regulation. Our results provide evidence that PGD2 signaling is a modulator of the differentiation and steroidogenic activity of granulosa cells.
Methods
Mouse strain and treatments
Female C57BL/6J mice (Charles River Laboratories, Saint Germain sur l'Arbresle, France) were housed at the IGH animal care facility under controlled environmental conditions (12 h light/12 h darkness, temperature 21°C). Animal care and handling conformed to the Réseau des Animaleries de Montpellier (RAM) and all procedures were approved by the Languedoc-Roussillon Regional Ethic committee (permit number 34-366, 2008 to BBB).
HQL-79 (4-benzhydryloxy-1-[3-(1
H-tetrazol-5-yl)-propylpiperidine) [
36], an inhibitor of H-Pgds activity, was purchased from Cayman Chemical (SpiBio, Interchim Montluçon, France). A HQL-79 solution (2.5 mg/ml) was made in methanol as recommended by the supplier and diluted to 0.125 mg/ml in 0.6% saline solution. Daily oral administration of HQL-79 was performed on 8 weeks old- cycling female mice for 5 to 9 days (for ovaries analyzis at the estrous phase) or for 16 days (for study of the length of the estrous cycle (three to four cycles)), as mentioned in the text. According to previous studies [
36‐
38], 0.1, 1 or 10 mg/kg/day were administrated for the first experiment and then 1 mg/kg/day was administrated in the following experiments since the three doses had the same impact on the expression of ovarian markers. As a control, the same volume of vehicle (0.5% methanol) was orally administrated into control cycling mice during the same period.
Young cycling female mice (6 weeks) were treated with 5 I. U. PMSG (pregnant mare serum gonadotropin, Sigma-Aldrich, St Louis, MO, USA) without or with administration of HQL-79 inhibitor (1 mg/kg/day). PMSG was dissolved in 0.6% saline solution and injected s.c. in a total volume of 0.1 ml, at the diestrous or proestrous stages of the cycle to initiate follicular development. Ovaries were dissected 48 h later for analysis.
Determination of estrous cycle
To determine the stages of estrous cycle, vaginal washes were collected for 16 days (three to four cycles) from five wild type (WT) and five HQL-79 mice. Diestrous phase was defined by the exclusive presence of leukocytes; proestrous phase by leukocytes and nucleated epithelial cells; estrous phase by large and squamous-type epithelial cells without nuclei; and metestrous by leukocytes and epithelial cells with translucent nuclei.
Histology, immunofluorescence and in situ hybridization
For each female mouse, one ovary was processed for immunofluorescence and the other one was subjected to quantitative RT-PCR. Tissues were fixed in 4% paraformaldehyde at 4°C overnight and then embedded in OCT [
39]. Cryosections (10 mm) were processed for immunofluorescence, after rehydration. Sections were then incubated overnight at room temperature with primary antibodies at the indicated dilutions: rabbit anti-CYP11A1 (1/200 dilution, gift of Dr Nadia Cherradi, CEA Grenoble) [
40], rabbit anti-phospho-histone H3 (1/100 dilution, sc-8656, Santa Cruz Biotechnology, SantaCruz, CA, USA)), rat anti-H-Pgds (1/100 dilution, Cayman Chemical (SpiBio, France)), mouse anti- laminin (1/500 dilution, Sigma Aldrich), goat anti-FOXL2 (1/100 dilution, Santa Cruz Biotechnology) and goat anti-AMH (1/200 dilution, sc- 6886, Santa Cruz Biotechnology). After washing, sections were incubated with appropriate secondary antibodies (1/800 dilution, Alexa) (Molecular Probes, Invitrogen, Carlsbad, CA, USA) for 40 min.
The antisense
H-
Pgds and
FoxL2 RNA probes were PCR-amplified from embryonic mouse cDNAs, cloned in a pCRII Topo vector (Invitrogen) and sequenced using an ABI automatic sequencer. Digoxigenin-labeled riboprobes were synthesized using a digoxigenin RNA labeling kit, following the manufacturer's instructions (Roche Diagnostics, Indianapolis, IN, USA) and used for
in situ hybridization experiments on cryosections of WT ovaries, as previously described [
20,
41].
RNA isolation and quantitative RT-PCR analysis of gene expression
RNA isolation using the RNeasy Midi kit (Qiagen, Valencia, CA, USA) from frozen ovaries, reverse transcriptase and quantitative RT-PCR using a LightCycler480 apparatus (Roche Diagnostics) were carried out as previously described [
20]. Gene expression levels were investigated using different pairs of primers (Table
1) and normalized to those of
Gapdh or
Hprt .
Table 1
Sequences of oligonucleotides for real time PCR
mFSHRfwd | gtgcgggctactgctacact | mGapdhFwd | tggcaaagtggagattgttgcc |
mFSHRrev | caggcaatcttacggtctcg | mGapdhRev | aagatggtgatgggcttcccg |
mLHRqFwd | gatgcacagtggcaccttc | mP27Fwd | gagcagtgtccagggatgag |
mLHRqRev | cctgcaatttggtggaagag | mP27Rev | tctgttctgttggccctttt |
mStARqFwd | ttgggcatactcaacaacca | mCycD2Fwd | ctgtgcatttacaccgacaac |
mStARqRev | acttcgtccccgttctcc | mCycD2Rev | cactaccagttcccactccag |
mSCCqFwd | aagtatggccccatttacagg | mCox-1Fwd | cctctttccaggagctcaca |
mSCCqRev | tggggtccacgatgtaaact | mCox-1Rev | tcgatgtcaccgtacagctc |
mDP1Fwd | cccagtcaggctcagactaca | mCox-2Fwd | gctcttccgagctgtgct |
mDP1Rev | aagtttaaaggctccatagtacgc | mCox-2Rev | cggttttgacatggattgg |
mDP2Fwd | catcgtggttgccttcgt | mPges-2Fwd | cccaggaaggagacagctt |
mDP2Rev | gcctccagcagactgaagat | mPges-2Rev | aggtaggtcttgagggcactaat |
mSF-1Fwd | cacgaaggtgcatggtctt | mHPgdsFwd | cacgctggatgacttcatgt |
mSF-1Rev | cagttctgcagcagtgtcatc | mHpgdsRev | aattcattgaacatccgctctt |
mCYP19Fwd | cctcgggctacgtggatg | mLPgdsFwd | ggctcctggacactacacct |
mCYP19Rev | gagagcttgccaggcgttaaa | mLPgdsRev | atagttggcctccaccactg |
mEP2Fwd | tgctccttgcctttcacaat | mFPFwd | ctggccataatgtgcgtct |
mEP2Rev | ctcggaggtcccacttttc | mFPRev | tgcaatgttggccattgtta |
hGapdhFwd | gagaaggctggggctcat | hHPgdsFwd | gagaatggcttattggtaactctgt |
hGapdhRev | tgctgatgatcttgaggctg | hHPgdsRev | aaagaccaaaagtgtggtactgc |
Hormone and prostaglandin assays
Hormone assays for estradiol and progesterone were performed from sera, by using ELISA kits (Cayman Chemicals, Progesterone EIA kit 582601 and Estradiol EIA kit 582251). Mice (n = 20 for WT and n = 20 for HQL-79-treated) at the estrous phase of their cycle, were anesthetized and blood was collected by cardiac puncture into plastic eppendorf tubes containing heparin. After centrifugation, the serum was extracted twice with methylene chloride; after evaporation, steroid extracts were stored at -80°C until assays were performed. Determination of the hormone concentrations was performed in triplicate at two different dilutions according to the kits'manufacturer. In each case, the twenty values were averaged.
PGD2, PGE2 and PGF2α levels were determined using the PGD2 - MOX EIA Kit (Cayman Chemical 500151), PGE2 express EIA kit (500141, Cayman Chemical) and 13,14-dihydro-15keto PGF2α (516671, Cayman Chemical), respectively. Ovaries were collected from mice treated (n = 8) or not (n = 8) by HQL-79 and immediately frozen on dry ice and then stored at -80°C. Ovaries were lyzed and proteins were extracted with cold acetone on ice and lyzates were evaporated under nitrogen flow. Prostaglandins were resuspended in 500 μl EIA buffer and assayed as recommended by the kits supplier. Two dilutions (1 and 1/20) were assayed for prostaglandins content. The eight values for each group were averaged and statistical analysis was performed using Student's t test, and results were considered statistically significant at a P < 0.05.
Statistical analysis
Quantified real time RT-PCR signals were normalized to Gapdh or Hprt levels and the hormone levels of treated ovaries were compared to those of untreated ovaries. All values were presented as means ± SE. Student's t test was used to determine the significance of differences in expression and hormone data. Results were considered significant at P < 0.05 for two-sided analysis.
Discussion
In this study, we describe the expression of
H-Pgds mRNA in the adult mouse ovary. This localization includes granulosa cells from growing follicles through primary to antral and pre-ovulatory stages, and the corpus luteum formed after ovulation. H-Pgds is thus the sole source of PGD2 in the ovary since the second enzyme able to produce PGD2 (L-Pgds) is not expressed [
19]. In the embryonic gonad, L-Pgds secreted PGD2 signals through the adenylcyclase-coupled receptor DP1 to activate expression of the Sertoli cell differentiating gene
Sox9 and contribute to the nuclear translocation of SOX9 protein [
19,
30]. In the adult ovary, the Ca
++ coupled DP2 receptor is exclusively expressed in granulosa cells. Considering how Sertoli and granulosa cells have common ancestor precursor cells [
42], this differential expression of both receptors and the dual functional convergence between L- and H-Pgds might constitute part of the antagonistic regulation between male and female pathways [
43,
44] and be a key regulatory step in maintaining the differentiation of both Sertoli and granulosa cell types [
45]. PGD2 is metabolized to 15d-PGJ2, the high affinity natural ligand for the PPARγ receptor expressed in granulosa cells of developing follicles [
46,
47]. These results thus suggest that both receptors DP2 and PPARγ might relay PGD2 signaling in the adult ovary.
The process of granulosa cell differentiation occurring throughout progression from a pre-antral to pre-ovulatory follicle is dependent on sufficient FSH stimulation [
48,
49] and is marked by the acquisition of
FshR and
LhR expression and increased steroidogenesis. In this study, we demonstrated that H-Pgds enzymatic activity is required in order for FSH to regulate expression of both
FshR and
LhR receptors, suggesting PGD2 to be an autocrine positive regulator of
FshR and
LhR expression in the ovary. This regulation may act directly on the FSH-induced
FshR promoter activity as in the case of inhibin-A [
50], or might otherwise act indirectly by increasing
FshR mRNA stability, as in the case of IGF-I [
51]. The inhibition of H-Pgds enzymatic activity leads to a decrease in
FshR and
LhR expression but does not affect that of
SF-1, the major activator of steroidogenesis gene expression [
52]. This supports the implication of PGD2 signaling in the FSH-induced expression of the
StAR gene, independently on SF-1. SF-1 is essential for the development and function of the reproductive axis at multiple levels [
52] and FSH has been shown to activate SF-1-mediated transcription using various mechanisms [
53]. Thus, regulation of
FshR expression might be one of the causes of
LhR and steroidogenic gene down-regulation, and of the decrease in progesterone production upon PGD2 signaling inhibition [
54].
In contrast, following the decrease in
Cyp11A1 and
StAR expression levels upon PGD2 depletion, we found that levels of both aromatase expression and serum estradiol increased in treated female mice compared to untreated animals. On the other hand, we observed that granulosa cells partially depleted of PGD2 signaling show increased proliferation based on immunostaining for mitosis marker phosphohistone H3, which we confirmed at the molecular level through the significantly decreased expression of
CDKN1B (p27). This increased proliferation lead to an increased number of the maturating follicles that might explain the higher levels of
Cyp19A1 mRNA expression and secreted estradiol upon HQL-79 treatment, rather than being a consequence of the
Cox-2 up-regulation that was detected in HQL-79 ovaries. The up-regulation of
Cyp19A1 gene expression via COX-2 was shown to be dependent on PGE2 synthesis and cAMP signaling in undifferentiated rat granulosa cells [
9] or in human breast tumor cells [
55]. Our data showed that
Cox-2 expression is up-regulated, however, PGE2 synthesis was not modified. Indeed, the side-effect of HQL-79 treatment (i.e. increased PGE2 production) [
26] related in the lung tissues of sensitized guinea pigs [
56] was not detected in our system as it has not been seen in sheep vesicular gland microsomes [
56] or
in vivo in H-
Pgds transgenic mouse strain [
36].
In this study, we measured high levels of
Cox-2 and H-
Pgds transcripts whereas no modification of
Cox-1 has been measured in HQL-79 treated ovaries. The functional coupling between H-Pgds/Cox-1 or H-Pgds/Cox-2 has been demonstrated respectively, in the immediate or the delayed response in mast cells during the cytokine stimulation [
38], even though tightly coupling between H-Pgds and Cox-1 is preferentially documented [
36,
57]. The up-regulation of Cox-2 associated with the down-regulation of H-Pgds protein expression upon HQL-79 treatment has been previously described in the mouse ischemic brain [
58]. In the ovary, we can assume that partial depletion of PGD2 might induce
Cox-2 gene expression that in turn, might activate H-Pgds expression in order to restore the intraovarian PGD2 content. PGJ2, a PGD2 metabolite was shown to inhibit osteoblastic differentiation through PPARγ activation and down-regulation of Cox-2 [
59]. This process would take place without any interaction with other prostanoid-synthetizing mechanisms as it has been previously reported in other systems, induction of fever [
60] or induction of inflammation in muscle necrosis [
61], since PGE2 and PGF2α prostaglandin pathways are not modified upon HQL-79 treatment.
Using the H-Pgds specific inhibitor HQL-79 known to exactly mimic the phenotype of
H-Pgds KO mice in various systems such as inflammation, muscle necrosis [
31,
38], we identify an important and unappreciated role for PGD2 signaling in modulating the balance of proliferation, differentiation and steroidogenic activity of the granulosa cells, through both FSH dependent and independent mechanisms. Thus, these results suggest PGD2 as a modulator of follicle development, even though no reproductive defects have been reported in female H-
Pgds KO mice [
31,
62]. The physiological importance of PGD2 for ovarian function and normal female fertility might be assessed in this mouse strain or in mice conditionnally invalidated for H-Pgds in the ovary under the control of Anti-Müllerian hormone (Amh) promoter (Amh-cre, [
63]) to overcome a putative central effect of H-Pgds produced PGD2.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
All authors read and approved the final manuscript. Conceived and designed the experiments: FP, BBB. Performed the experiments: AF, PP, FP, BBB. Analyzed the data: AF, PP, CS, FP, BBB. Contributed reagents/materials/analysis tools: CS, FP, BBB. Wrote the paper: BBB.