Background
Herpes simplex virus type 2 (HSV-2), a member of
herpesviridae family, is one of the most prevalent human pathogens in the world, which causes genital herpes and can be transmitted to central nervous system (CNS) to establish lifelong infection [
1]. HSV-2 is primarily transmitted through sexual contact and is common among persons infected with HIV-1 [
2,
3]. In the Americas and Europe, HSV-2 seroprevalence is 50% among HIV-1 infected men who have sex with men [
4]. It is well established that HSV-2 infection facilitated the perseverance of HIV-1 epidemic [
5]. Also, HSV-2 infection is an important bacterial vaginosis risk factor, thus it may co-infect with other bacterial pathogen in clinical [
6]. However, until now, there are no effective medicines or preventive vaccine for genital herpes.
The human genital mucosa is an important tissue structure for innate immune systems and is the natural barrier to defense against sexually transmitted pathogens [
7]. Due to the compactness of epithelial cells and their cell-cell tight junctions, genital epithelium could defend against most of pathogens via physical blocking. Certain pathogens are evolving to disrupt epithelium to establish primary infection. For host defense system, mucosal epithelial cells could constitutively express immune-associated molecules to inhibit infection or sense them to activate local inflammation to recruit immune cells. A set of pattern recognition receptors (PPRs) were found to be expressed in genital epithelial cells, which was proven to recognize microorganisms or their associated components, and stimulate downstream anti-microbial immune responses. Toll-like receptors (TLRs), which commonly express on a range of immune cells and epithelial cells, represents an essential components for cellular innate immunity [
8,
9]. There are several published manuscripts reporting the interaction of TLRs and pathogens, and TLRs-mediated downstream anti-microbial activities. Derbigny et al. reported that
Chlamydia induced IFN-β synthesis in infected murine oviduct epithelial cells to modulate the adaptive immune responses via TLR3 [
10]. Nazli et al. demonstrated that HIV-1 envelope glycoprotein gp120 could induce NF-κB activation via TLR2 and TLR4 in human female genital epithelium, which might activate innate immune in reproductive tract [
11]. Another described that natural ligands of TLRs would induce antiviral responses against HSV-2 infection in genital epithelial cells [
12]. Evidently, TLRs-associated signaling activation would sometimes enhance innate immune response and eliminate infection, but in some cases, pathogens would utilize host TLRs-associated responses to facilitate its life cycle to establish persistent infection.
Many published manuscripts related to the studies of the interaction of TLRs and HSV, and reported that TLR2 and TLR9 were involved in innate antiviral responses [
13‐
16]. However, the infection models used in these studies was central neuronal cells, immune-competent cells or transgenic mice models, which were totally distinct with mucosal epithelial cells. Liu et al. firstly reported the association between TLR4-NF-kB pathway and HSV-2 infection in human cervical epithelial cells [
17]. Our previous studies described that HSV-2 infection could stimulate mitogen-activated protein (MAP) kinase pathway and enhance AP-1 activation, and AP-1 activation was essential for effective viral replication [
18]. However, less studies was related to the relationship between MAPK pathway and TLR4 in HSV-2 infected genital epithelial cells. In this study, TLRs expression profiles and changes after HSV-2 infection was evaluated in human genital epithelial cells, and the relationship between TLR4 and AP-1 activation was investigated. Our finding revealed that TLR4 might play a role in HSV-2 sensing and take part in viral life cycle in human genital epithelium.
Methods
Reagents, cell lines, plasmids, viruses
Lipopolysaccharide (LPS) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Acyclovir was obtained from National Institutes for Food and Drug Control in China (Beijing, China). Dual-Glo luciferase assay kit was obtained from Promega Bio-technology (Madison, WI, USA). Odyssey blocking buffer, IRDye 680 and IRDye 800 secondary antibodies were obtained from LI-COR (Lincoln, NE, USA). Anti-human TLR4 (sc-293,072), anti-GAPDH (sc-32233), anti-HSV-2 gD (sc-56988) and anti-β-actin (sc-69,879) were purchased from Santa Cruz (Santa Cruz, CA, USA). Anti-c-Jun (#2315), anti-p-c-Jun (#2361) and anti-MEK1/2 (#8727) antibodies were from Cell Signaling Technology (Beverly, MA, USA). Anti-GFP (TA-06) was from ZSGB-Bio (Beijing, China). DRAQ5 was from Thermo Fisher Scientific (Grand Island, NY, USA).
VK2/E6E7, Ect1/E6E7, Endo1/E6E7 and HEC-1-A cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). HEK-293 T, Vero and U937 cells were from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). U937 cells were grown in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1 mM HEPES. HEK-293 T was maintained in Dulbecco’s modified Eagle’s medium (DMEM) with 10% FBS. VK2/E6E7, Ect1/E6E7 and Endo1/E6E7 were established from the normal vaginal mucosal tissue transformed by HPV-16 E6/E7, and would be maintained in keratinocyte-serum free medium with 0.1 ng/ml human recombinant EGF, 0.05 mg/ml bovine pituitary extract, and additional with 0.4 mM calcium chloride. HEC-1-A cells were grown in McCoy’s 5a medium with 10% FBS. Vero-ICP10P, an HSV-2 infection indicator cell line, was generated from Vero cells stably-transfected with HSV-2 ICP10 promoter-driven luciferase reporter plasmid. Cells mentioned in this paper were maintained at 37 °C in a 5% CO2 atmosphere. All base medium and FBS were purchase from Thermo Fisher Scientific.
AP-1-luc reportor plasmids (pAP-1-luc) were from Clontech (Mountain View, CA, USA). pRL-TK Renilla luciferase control vectors were obtained from Promega Bio-technology. pFlag-CMV1-hMD2 (Plasmid #13028) was obtained from Addgene (Cambridge, MA, USA). pcDNA3-ICP0(2)-GFP were kindly gifted from Dr. Claus-Henning Nagel, Heinrich Pette Institute, Leibniz Institute for Experimental Virology. pcDNA3.1-hTLR4 plasmid was constructed via cloning full-length TLR4 coding sequence from U937 cells cDNA library, and then inserting into pcDNA3.1 (Thermo Fisher Scientific). pGL4-TLR4-promoter was constructed by amplifying a 1100-bps TLR4 promoter fragment (− 801/+ 299) and then cloning into pGL4.17 vector (Promega). Truncated TLR4-promoter luciferase reporter plasmids were constructed via subcloning truncated regions of promoter (− 385~ + 299, − 220~ + 299 and − 75~ + 299) into pGL4.17.
HSV-2 (G) strain was kindly gifted from Dr. Erguang Li, Medical School, Nanjing University, China, and was propagated on HEK-293 T cells and titrated on Vero cells as described previously [
19].
Western blot and in-cell Western
Cells were washed once with pre-cold phosphate buffer saline (PBS) and then lysed on ice using RIPA lysis buffer (Santa Cruz). Lysate was centrifuged at 12,000×g, 4 °C for collection of the supernatants for total protein extraction. Membrane-associated and cytoplasm-associated proteins were extracted using membrane/cytoplasmic protein extraction kit (Sangon, Shanghai, China). The protein concentrations were determined using BCA protein assay kit (Thermo Fisher Scientific). After separated via SDS-PAGE, the proteins were transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA). The membranes were blocked with Odyssey blocking buffer and then inoculated in primary antibodies at room temperature (RT) for 1 h. After 5 times wash with PBS-T buffer (PBS supplemented with 0.1% Tween-20), the blots were incubated in IRDye IgG with 1:10,000 dilutions for 1 h. The membranes were visualized under LI-COR Odyssey Infrared Imager (LI-COR), and the band density could be determined via Odyssey software.
In-cell Western was performed in 96-well plate. The cells cultured in a 96-well plate were fixed with 4% paraformaldehyde for 20 min at RT and permeabilized by 5 washes in PBS-0.1% Triton-X 100 with 5 min for each wash. The monolayers were blocked for 90 min in blocking buffer (4% non-fat dry milk) and then incubated with primary antibodies diluted in blocking buffer (1:200) for 2 h at RT. After washing with PBS-T buffer, the cell layers were stained with IRDye IgG (1:1500) for 1 h, rinsed and scanned in Odyssey Infrared Imager. Relative protein expression level was normalized against DRAQ5 staining (nucleus DNA staining).
Luciferase assay
HEC-1-A cells were seeded into 96-well plates at a density of 2.5 × 104 cells per well. When reaching 90% confluency, cells were transiently transfected with 25 ng pAP-1-luc or promoter reporter plasmids and 5 ng pRL-TK per well or co-transfected with 25 ng pAP-1-luc, 5 ng pRL-TK and 70 ng transient expression plasmids using Lipofectamine 2000 reagent (Thermo Fisher Scientific) as manufacturer’s instruction. Cells were then cultured for 24 h and then treated as described. The luminescence was determined by GloMax-96 Microplate Luminometer (Promega). The results are shown as means ± SD of triplicate wells and expressed as relative luminescence units (RLUs).
RNA extraction, PCR and real-time PCR
Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific) as manufacturer’s instructions. Complementary DNA (cDNA) was reverse-transcribed in a 20-μl volume using ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan). PCR amplification was performed using TaKaRa Ex Taq DNA polymerase (TaKaRa, Shiga, Japan), and the thermo cycling protocol was as follows: 95 °C for 5 min, 25 cycles of denaturation at 95 °C for 45 s, annealing at 60 °C for 45 s, and extension at 72 °C for 1 min. Real-time PCR was performed in triplicate on ABI Prism 7300 Sequence Detection System using the SYBR Green PCR Master Mix (TOYOBO) according to the manufacturer’s protocols. Message RNA transcriptions were standardized against housekeeping gene GAPDH. All Primers used in this study were referred from RTPrimerDB (
http://www.rtprimerdb.org/), verified in-house and listed in Table
1.
Table 1
Real-time PCR primers sequences
TLR1
| Sense: CAGTGTCTGGTACACGCATGGT; |
Antisense: TTTCAAAAACCGTGTCTGTTAAGAGA; |
TLR2
| Sense: GCCTCTCCAAGGAAGAATCC; |
Antisense: TCCTGTTGTTGGACAGGTCA; |
TLR3
| Sense: TGGTTGGGCCACCTAGAAGTA; |
Antisense: TCTCCATTCCTGGCCTGTG; |
TLR4
| Sense: AAGCCGAAAGGTGATTGTTG; |
Antisense: CTGAGCAGGGTCTTCTCCAC; |
TLR5
| Sense: TGCCTTGAAGCCTTCAGTTATG; |
Antisense: CCAACCACCACCATGATGAG; |
TLR6
| Sense: GAAGAAGAACAACCCTTTAGGATAGC; |
Antisense: AGGCAAACAAAATGGAAGCTT; |
TLR7
| Sense: TTTACCTGGATGGAAACCAGCTA; |
Antisense: TCAAGGCTGAGAAGCTGTAAGCTA; |
TLR8
| Sense: TTATGTGTTCCAGGAACTCAGAGAA; |
Antisense: TAATACCCAAGTTGATAGTCGATAAGTTTG; |
TLR9
| Sense: GGACCTCTGGTACTGCTTCCA; |
Antisense: AAGCTCGTTGTACACCCAGTCT; |
MD2
| Sense: CCGATGCAAGTATTTCATACACCTACT; |
Antisense: CTCCTTGGAATGTAGAAAATGTGC; |
GAPDH
| Sense: TGCACCACCAACTGCTTAGC; |
Antisense: GGCATGGACTGTGGTCATGAG; |
Small interfering RNAs (siRNAs) transient transfection
Validated siRNAs targeting human TLR4, MyD88, TRIF and negative control were purchased from Santa Cruz. HEC-1-A cells were seeded into 96-well plate at a density of 104 per well, and then cultured for 24 h. When the cell confluency reached to ~ 40%, siRNAs were transfected alone (20 pmol siRNA) or co-transfected with luciferase reporter and internal control plasmids (20 pmol siRNA, 25 ng luciferase reporter plasmids and 5 ng pRL-TK) into target cells via lipofectamine 2000 reagent according to the manufacturer’s manuals. The siRNA knockdown efficiency was determined by reverse transcription PCR (RT-PCR). Cells were then treated as described, and relative luminescence units were determined as described above.
Statistics
Statistical analysis was performed using two-tailed student t-test. Statistical significance: * p < 0.05, ** p < 0.01.
Discussion
Human genital epithelial cells are primary physiologic barrier against pathogenic microorganisms which would cause sexual transmitted diseases. Several studies have indicated that certain pathogens could induce innate immune responses via pattern recognition receptors PPRs in genital epithelium, and these effects would activate anti-viral or anti-bacterial responses. But in some cases, some pathogens would hijack cellular innate immune systems to facilitate their sexual transmission and infection [
10,
11]. Compared with immune cells, genital epithelial cells have a distinct innate immune system, and would trigger a unique immune response to sense and resist infection. TLRs are the most studied and best characterized PPRs, which are identified as fundamental components for the innate immune response to bacterial or viral pathogens in epithelial cells.
Recent evidence showed that herpes simplex virus could trigger cellular PPRs to modulate innate immune defenses. Triantafilou et al. reported that HSV-2 could induce vaginal cells activation via TLR2, TLR9 and DNA sensors DAI and IFI16 [
22]. And TLR2 has also been reported to be vital in HSV sensing, which was triggered by the interaction between HSV virion glycoproteins and TLR2 [
16,
23,
24]. However, fewer studies focused on the other PPRs interaction with HSV-2. Recently, Liu et al. demonstrated that TLR4 could sense HSV-2 infection human cervical epithelial cells to induce NF-κB-driven transcription activity, and HSV-2 would also up-regulate TLR4 expression [
17]. However, the precise mechanism of virus-induced TLR4 expression up-regulation was unclear. In this study, we identified TLRs expression profiles in human genital epithelial cells and their expression regulation by HSV-2 infection comprehensively, and the results exhibited that TLR4 was highly expressed in two genital epithelial cells and would be up-regulated significantly by HSV-2 infection. Further studies illustrated that TLR4 contributes to HSV-2-induced AP-1 activation, and AP-1 might play an important role in TLR4-promoter activation. We concluded that TLR4 might be a significant sensor for response herpes virus infection in human genital epithelium.
It was hypothesized that some transcriptional factors activity was necessary for TLR4 promoter-driven transcription initiation. We have predicted some transcriptional factors binding sites in TLR4 promoter region, and found that an AP-1 binding site (− 566~ − 556) was more important through truncated promoter scanning assay. These data were reasonable to the conclusion that virus-induced AP-1 activation modulated TLR4 expression and feed back to HSV-2 infection sensing. The detailed regulation mechanisms should be further studied.
In general, TLR4 was the major extracellular receptor to sense LPS derived from Gram-negative bacteria to induce downstream critical proinflammatory responses. Much evidence have proved that beside of bacteria components, certain virus or virus-associated proteins could be as potential inducer for TLR4-mediated downstream signal pathway activation. Machida et al. illustrated that hepatitis C virus infection and replication induced TLR4 expression and enhanced TLR4-mediated IFN-β and IL-6 production [
25]. Respiratory syncytial virus was most well-known virus which could initiate innate immune responses via TLR4 [
26‐
28]. Del et al. also reported that host TLR4 interacted with HIV-1 gp120, leading to intracellular pathways and biologic activities that mediate proinflammatory and profibrogenic signals [
29]. In this study, it was demonstrated that HSV-2 could activate intracellular AP-1-driven transcription via TLR4-MyD88/TRIF axis, and this effect might depend on viral IE and E gene expression accumulation. Further studies implicated that HSV-2 ICP0 might be the key factor for AP-1 activation. ICP0 is an important IE regulatory protein of HSV that play vital roles in viral replication, cell growth and apoptosis [
30,
31]. It is believed to be able to activate transcription, not only viral genes but also host ones. Diao et al. reported that HSV-1 ICP0 could strongly activate AP-1 responsive genes specifically via JNK pathway activation [
32], which illuminated us that HSV-2 ICP0 accumulation at early stage of infection causing AP-1 activation might be the reason for TLR4 promoter activation. And further studies primarily proved that AP-1 activation was associated with TLR4 expression regulation. It was concluded that ICP0 accumulation stimulated host AP-1 activation, and then mediated TLR4 promoter activation, which would consistently activate TLR4 sensing HSV-2 infection. Previously, HSV-2 ICP10PK was reported to modulate AP-1, MEK/MAPK and JNK/c-Jun [
33,
34]. Whether HSV-2 ICP10PK expression would influence TLR4 expression will be studied further. Additionally, intracellular TLR4 would be activated by intracellular LPS in intestinal epithelial cells [
35]. It is hypothesized that certain HSV viral proteins would be recognized by intracellular Golgi bodies-localized TLR4, and activate downstream signaling pathways, which will be also studied further.
The accessory protein MD2 has been implicated in LPS-mediated activation of the innate immune system by functioning as a co-receptor with TLR4 for LPS binding at the cell surface [
36]. We have also proved that overexpression of MD2 in genital epithelial cells enhanced HSV-2-mediated AP-1 activation, demonstrating that TLR4-MD2 complex are necessary for sensing HSV-2 infection, similar with that of LPS. However, MD2 expression was stable during the HSV-2 infection (data not shown). The precise mechanisms should be investigated further.
Membrane-anchored TLR4 molecules are necessary as the functional receptor for sensing exogenous stimuli. We examined the TLR4 distribution in genital epithelial cells, and results illustrated that a large amount of TLR4 existed in cytoplasm, not on the surface of membrane, which was opposite to that in monocytes. Thus, these two cell types displayed the distinct innate immune status responding to LPS and other stimuli (data not shown). Although HSV-2 had ability to up-regulated TLR4 expression, we did not understand whether this effect would change TLR4 function or innate immune status in genital epithelial cells. After that, TLR4 expression in cytoplasm and membrane was determined, and the results showed that viral infection up-regulated membrane-associated TLR4 moderately. We hypothesized that HSV-2 replication could induce TLR4 expression and promote TLR4 translocation from cytoplasm to cell membrane, which cause TLR4-mediated cascade signal amplification and downstream AP-1 activation. This effect might change innate immune balance and influence resistance of epithelial cell against other bacterial pathogens.