Heterozygote of TAP1 Codon637 decreases susceptibility to HPV infection but increases susceptibility to esophageal cancer among the Kazakh populations

A total of 316 EC specimens of Kazakh in formalin-fixed paraffin-embedded archival tissues were collected from the People’s Hospital of Xinjiang Uyghur Autonomous Region, the First University Hospital, Shihezi University School of Medicine and several hospitals in the Yili Kazakh Autonomous Prefecture. The 316 cases were diagnosed between January 1990 and March 2014, and they were all diagnosed as ESCC. The pathological grade of tumors was classified at the time of diagnosis. Patients had received neither chemotherapy nor radiotherapy before endoscopies and surgery. All samples were surgically resected and fixed in 10 % buffered-formalin, routinely processed, and paraffin-embedded. The specimens of Kazakh patients were all obtained from the high-incidence areas in Xinjiang. From the patients’ medical records, we gathered data on clinical pathological variables such as tumor site, invasion depth, and distant metastasis. All cases of pathological diagnosis for the tumor-node- metastasis (TNM) stages were evaluated according to Cancer Stage Manual 7th Edition 2009 issued in 2009 by the American Joint Committee on Cancer (AJCC/UICC). Informed consent of each patient was obtained, and study protocol was approved by the Institutional Review Board at Shihezi University School of Medicine. Biopsy samples of normal esophageal squamous epithelium were available from 66 control patients matched for ethnicity, who were from Kazakh-gathering place in Xinyuan, Yili and participated in the project of Early Diagnosis and Treatment of EC in Xinjiang Province. Each control had undergone upper gastrointestinal endoscopy and the esophageal tissue samples were confirmed as histologically normal. At the same time, the control subjects’ corresponding pathological and clinical data were gained.

The patients in this study were comprised of 187 men and 129 women with an average age of 52.89 ± 8.923 years (ranging from 23 to 79 years). In addition, a total of 36 men and 30 women control subjects were matched with an average age of 50.67 ± 11.542 years (ranging from 19 to 64 years). The difference between cases and controls is of no significance in gender (P = 0.488) and age (t = 1.741, P = 0.083) distribution. The cases included 106 (33.5 %) well-differentiated patients (group G1), 162 (51.3 %) moderately differentiated patients (G2), and 48 (15.2 %) poorly differentiated patients (G3). When evaluated according to Cancer Stage Manual 7th Edition 2009, the 316 ESCC cases, 48 (15.2 %) were classified as stage I, 183 (58.0 %) as stage II, 75 (23.7 %) as stage III, and 10 (3.1 %) as stage IV. Of the 316 ESCC cases, 30 (9.5 %) were classified as T1, 158 (50.0 %) as T2, 123 (38.9 %) as T3, and 5 (1.6 %) as T4.

The 316 Kazakh patients with EC mentioned above, which had been tested for HPV infection, was then divided into two groups (204 cases infected with HPV and 112 cases that weren’t), from both of which we selected 75 cases respectively and at random, so a total of 150 paraffin-embedded tumor specimens were used for genotyping TAP1 gene. The 283 controls were selected randomly from a pool of cancer-free subjects recruited from Kazakh ethnic population in Xinyuan, Yili, who had visited the hospital for a conventional cancer screening program. Blood samples were collected and DNA was extracted for the genotyping of TAP1 gene. Informed consent was obtained from all participants in this study.

The patients in this study were comprised of 94 men and 56 women with an average age of 52.29 ± 9.571 years (ranging from 23 to 75 years). In addition, a total of 154 men and 129 women control subjects were matched with an average age of 50.25 ± 11.991 years (ranging from 21 to 72 years). The difference in gender distribution between cases and controls is of no significance (P = 0.098), however, age distribution differs significantly between cases and controls (t = 1.801, P = 0.072).

DNA was extracted from the paraffin sections and biopsy samples using standard proteinase K digestion and a tissue DNA extraction kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. As an internal control, all purified genomic DNA samples were successfully tested by polymerase chain reaction (PCR) with a human β-actin primer set (forward: 5′-CAGACACCATG GTGCACCTGAC-3′ and reverse: 5′-CCAATAGGCAGAGAGAGTCAGTG-3′), indicating that the quality and quantity of DNA were suitable for detecting the presence of HPV. The HPV infection was first determined by PCR using non-degenerate primer set, GP 5+/6+, Forward primer: TTGGATCCTTTGTACTGTGGTAGATACTAC and Reverse primer: TTGGATCCGAAAAATAAACTGTAAATCATATTC, which produce a 150 bp ragment of L1 gene in a wide range of HPV types. For HPV 16 DNA detection, E7 was amplified with forward primer GATGAAATAGATGGTCC AGC and reverse primer GCTTTGTACGCACAACCGAGC. For each PCR reaction, 5 μL extracted concentrated DNA was used in a final reaction volume of 25 μL. The reaction was initially carried out at 95 °C for 10 min, followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 42 °C for 90 s, and extension at 72 °C for 30 s, with a final extension at 72 °C for 5 min. The amplicons were then denatured and subjected to hybridization. Assays of the samples were run in triplicate, with positive and negative controls (CaSki cell DNA generously provided by Professor Yang Ke, Beijing Institute for Cancer Prevention Laboratory and distilled water) (Fig. 1). β- actin was used as a DNA control. To confirm the accuracy of the HPV genotyping by PCR, 10 % DNA sequence of the positive products was then identified by NCBI Blast (Fig. 2). A 100 % match was identified between the results of DNA sequence displayed in the Genbank and HPV genotype detected.

DNA was extracted from the paraffin sections and blood samples using standard proteinase K digestion and a tissue DNA extraction kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The two previously documented polymorphisms in TAP1 coding regions are previously documented. The primers used in PCR to detect for Codon 333 were as follows: forward primer GCAGGTAACATC ATGTCTCG and Reverse primer: GACAGATTGTGGGGAGAAGC, and for Codon 637 were as follows: forward primer CAGTAGTCTTGCCTTTATCC and Reverse primer: ATGACTGCCTCACCTGT AAC. The PCR was carried out in 25 ml reaction mixture containing genomic 1 ml DNA, 2.5 ml 10 × PCR buffer (100 mM Tris, pH 7.8, 100 mM NaCl, 10 mM EDTA and 0.5 % SDS), 1.8 ml of 25 mM MgCl₂, 0.5 ml of 10 mM dNTP each, 10 pmol primer and 1.5 U of Taq polymerase (Promega, Madison, WI, USA). The reaction was initially carried out at 94 °C for 2 min, followed by 35 rounds of thermal cycling were in the conditions: denaturation at 94 °C for 40 s, annealing at 57.5 °C for 40s, extension at 72 °C for 40 s and the final extension was carried out at 72 °C for 10 min. The terminator ready sequencin was performed in a total volume of 20 ml containing 8 ml of PCR product, 2.5 ml 10 × PCR buffer, the enzymes used were 7 U of Bcl1 and Acc1 for genotyping Codon 333 and Codon 637 respectively. Cycling conditions were as follows: initial denaturing 96 °C for 2 min, followed by 30 cycles at 94 °C for 10 s, 50 °C for 5 s and 60 °C for 4 min. Restriction enzyme digestion with Bcl1 and Acc1 (Promega, Madison, WI, USA) of the PCR product was carried out overnight and analyzed on a 3 % agarose gel. DNA products were visualized by ethidium bromide staining (Fig. 3). The −333A and −637A showed two fragments (homozygous for the allele −333A and −637A), while its homologue −333G and −637G was undigested and resulted in a single band (homozygous for allele −333G and −637G). The presence of all three fragments defined heterozygotic individuals. To confirm the accuracy of TAP1 I333V and D637G genotyping by PCR, 10 % DNA sequence of the PCR products was then identified by NCBI Blast (Fig. 4). A 100 % match was identified between the results of DNA sequence displayed in the Genbank and HPV genotype detected.