Introduction
The tumour suppressive and tumour promoting effects of proteins secreted by keratinocytes on melanoma development have been previously reported. These include the increased expression and paracrine secretion of maspin by keratinocytes during senescence that inhibits endothelial cell angiogenesis (Nickoloff et al.
2004) and the keratinocyte secretion of matrix metalloproteinase-9 in facilitating melanoma invasion in a reconstructed skin model (Van Kilsdonk et al.
2010). Genetically engineered mouse (GEM) models are also used to determine loss of function (knockout, knockdown or dominant-negative) or gain of function (knock-in, transgenic) (Cheon and Orsulic
2011). There is also scope to cross GEM mice with other tumour suppressor knockout mice and determine tumour development if a single gene knockout is insufficient to develop tumours alone, or with carcinogen challenge (Dankort et al.
2009; Sotillo et al.
2001). One mouse model system that established CDK4 as a melanoma oncogene used a knock-in of CDK4, which alone was not sufficient to induce tumorigenesis, but required carcinogen challenge before the phenotype was revealed (Sotillo et al.
2001). Mice that harbour a conditional melanocyte-specific expression of oncoprotein BRAFV600E develop melanocytic hyperplasia that is benign due to the induction of senescence (Dankort et al.
2009; Dhomen et al.
2009). Combination of BRAFV600E with PTEN tumour suppressor gene silencing resulted in the development of melanomas with 100% penetrance.
The tripartite motif-containing (TRIM) proteins family is functionally diverse and involved in cellular processes including cell cycle regulation, proliferation, differentiation, ubiquitination, apoptosis, tumour suppress functions and oncogenesis(Sardiello et al.
2008). One of TRIM protein, TRIM16, has been demonstrated to acts as a tumour suppressor protein in neuroblastoma via effects on cytoplasmic vimentin and nuclear E2F1 (Marshall et al.
2010). TRIM16 binds vimentin in the cytoplasm and causes a reduction in vimentin protein expression. Conversely, gene silencing of TRIM16 which is mediated by siRNA results in an increase in vimentin protein expression. Further, the downregulation of vimentin is required for the ability of TRIM16 to inhibit neuroblastoma cell migration (Marshall et al.
2010). Additional work has demonstrated that TRIM16 inhibits neuroblastoma cell proliferation through cell cycle regulation and localization to the nucleus (Bell et al.
2013). High nuclear staining of TRIM16 has been observed in differentiating ganglia cells which is absent in the tumour initiating cells. TRIM16 protein translocates to the nucleus in the G1 cell cycle phase after being upregulated. Cell cycle progression is attenuated through changes in cyclin D1 and p27. These data implicate TRIM16 as a regulator of G1/S progression and cellular differentiation (Bell et al.
2013). TRIM16 translocates to the nucleus upon treatment with all-trans retinoic acid and binds to and downregulates E2F1 protein, reducing E2F1 protein half-life (Marshall et al.
2010). TRIM16 has further been shown to induce apoptosis in neuroblastoma cells (BE-(2)-C) and breast cancer cells (MCF-7) in a caspase-2-dependent manner (Kim et al.
2013). In addition, TRIM16 has been shown to restore retinoid sensitivity to retinoid-resistant breast and lung cancer cells via epigenetic mechanism of histone acetylation and restoration of RARβ2 transcription (Raif et al.
2009).
Previously, we have also shown that the putative tumour suppressor, TRIM16, is upregulated during keratinocyte differentiation, and TRIM16 protein expression is lost during the progression of normal skin through SCC development (Cheung et al.
2012). Furthermore, TRIM16 is lost during the progression of melanoma and correlates with human melanoma metastasis (Sutton et al.
2014). TRIM16 protein has been shown to be actively secreted by keratinocytes in response to UV light in a caspase-1-dependent manner (Munding et al.
2006a; Feldmeyer et al.
2007). TRIM16 binds to components of the inflammasome complex and pro-IL1β, which is associated with innate immune response in keratinocytes. These reports suggest that TRIM16 has functional roles in skin physiology and pathology, and, in immune responses. TRIM16 is known to be secreted by keratinocytes; however, the effect of the loss of keratinocyte TRIM16 on skin cancer development is currently unknown. Here, we investigated the effect of reduced TRIM16 expression in keratinocytes on carcinogen-induced malignancy of the skin.
Materials and methods
Design of the TRIM16 knockout construct
TRIM16 knockout mice were generated at Ozgene Australia, utilizing a construct designed to ablate the full-length TRIM16 coding sequence flanked by lox P sites. We crossed TRIM16 wild-type/flox knockout (KO) mice with skin-specific Cre mice, which express Cre under the control of the human keratin 14 promoter, to allow excision of full-length TRIM16 and Neo selection cassette in tissues expressing keratin-14. The heterozygous and homozygous of skin specific TRIM16 KO mice are viable and fertile.
Preparation of TRIM16 floxed mice
For modelling of the function of TRIM16 in melanomagenesis, we chose a LoxP–Cre knockout system that involves knocking in a LoxP–Cre construct with flanking homology to the TRIM16 gene resulting in a ‘floxed’ mouse and gene deletion by crossing with a Cre expression system under the control of a promoter for the tissue of interest. The skin-specific knockout mouse model was produced from crossing our floxed mice with a Cre delete mouse under the control of Keratin 14. Keratin 14 is expressed in mitotically active basal layer cells and its expression is downregulated as cells differentiate (Alam et al.
2011a). Knocking out TRIM16 in keratin 14 expressing cells ensures a specific knockout of TRIM16 in the epithelial cells (Alam et al.
2011b; Hafner et al.
2004) while the remaining mouse tissues express TRIM16. Knocked-out tissues include the skin, tongue and cornea epithelial cells (Alam et al.
2011a).
Genotyping PCR design to determine TRIM16 knockout
Genotyping of the floxed mice required the recognition of the Neo sequence that is present in the knocked-in flox construct. Amplification of the Neo cassette confirms at least one copy of the flox construct, while amplification of Exon 6 of the wild-type TRIM16 (spanning an intronic sequence), confirms the presence of wild-type TRIM16. Combination of these two primer pairs in a multiplex assay allows the determination of the three genotypes where wild-type mice will only amplify the Exon 6 PCR, homozygous floxed mice will only amplify the neo cassette and heterozygous floxed mice will amplify for both Exon 6 and the Neo cassette. For the skin-specific TRIM16 knockout mice, a KRT14Cre delete strain is used to excise the flox construct and remove the TRIM16 gene. As this Cre delete strain is under the control of a KRT14 promoter, only the keratinocytes expressing Keratin 14 will be knocked out for the TRIM16 gene. To determine if the deletion of the TRIM16 gene is efficient, a knockout (KO) PCR is used, which is designed to amplify spanning the region where the TRIM16 was before excision. Confirmation of the presence of the TRIM16 gene is determined by amplification of the first exon (Exon 1). Thus, combination of the KO PCR and Exon 1 PCR distinguishes between the presence of all three genotypes. Genotyping of mice was performed using DNA extracted by Chelex (Sigma-Aldrich, NSW, Australia) from tail tips using the following primer pairs (Table
1).
Table 1
Primer sequences for genotyping TRIM16 knockout mice
Neo | Forward | AGAGGCTATTCGGCTATGACTGG |
Reverse | GGACAGGTCGGTCTTGACAAAAAG |
Exon 6 | Forward | TGCCTTGTGGGGGTCACTTGGA |
Reverse | GGTGTTCCCAGGGCGTGGTG |
KO PCR | Forward | GAGCCTCGTCCTGTCTGAGTAAC |
Reverse | AAACCAAGAAGTGCCAGAAATA |
Exon 1 | Forward | GAGCCTCGTCCTGTCTGAGTAAC |
Reverse | TCTTCTTTTTCTGCTGGGATAG |
β2 microglobulin | Forward | TCTCACTGACCGGCCTGTAT |
Reverse | GGAACTGTGTTACGTAGCAG |
Development of skin lesions using a two-stage skin carcinogenesis model
TRIM16 wild-type, heterozygous and homozygous skin-specific littermate mice between 7 and 9 weeks of age were shaved on the right dorsal flank prior to initiation. Mice were initiated with a single topical dose of 7,12-dimethylbenz(a)anthracene (DMBA) at 97.5 nmol in 0.2 mL of acetone. 2 weeks following initiation, mice were treated with either 0.2 mL 6.8 nmol of 12-O-tetradecanoylphorbol-13-acetate (TPA) or acetone control twice weekly for a period of 21 weeks. Mice were scored for skin lesion development weekly throughout the study.
Culture of primary keratinocytes
Primary keratinocytes were cultured from the tails of 7-week-old mice. Mice were euthanized with CO2, and then the tail was removed and placed in 80% ethanol. Tail skin was removed with sterile dissecting tools and cut into 1 cm sections and washed in epidermal keratinocyte culture media (CnT) (CellnTec, Bern, Switzerland). Sections were cultured overnight in CnT media with 5 mg/mL dispase and penicillin/streptomycin antibiotic. After rubbing tissue to release a single cell suspension, the tissue was centrifuged and the resulting pellet was cultured in CnT media with antibiotics in collagen IV (BD Biosciences, NSW, Australia) coated dishes. Western blotting for TRIM16 protein was performed from cultured keratinocytes using a TRIM16-specific antibody. Gene expression of TRIM16 was performed by RT-PCR using TRIM16 primers forward 5′-GGCTCTCTGGTTTGACTTGG-3′, reverse 5′-GGTTTCTTCGGTGGAAAACAA- 3′ and β2 M primers forward 5′-TCTCACTGACCGGCCTGTAT-3′, reverse 5′-GGAACTGTGTTACGTAGCAG-3′ in PCR multiplex.
Immunofluorescence
Five-micrometre-thick tissue sections of lymph nodes were cut from the paraffin blocks and placed on silane-coated slides. Slides were dewaxed in two exchanges of xylene and rehydrated using an ethanol gradient. Non-specific antigens were neutralized with 10% FCS for 1 h at room temperature. Slides were probed with Melan-A antibody (Santa Cruz) at 1:200 dilution. The secondary antibody (1/500) Alexa fluor 488 anti-mouse or Alexa fluor 594 anti-mouse (Abcam) was applied in 10%FCS/PBS for 1 h. Mounting media with DAPI (Life technologies, NSW, Australia) were applied and the coverslip was secured before viewing on the Olympus Fluoview FV1000 fluorescent microscope.
Statistical analysis
Statistical analysis for all data was performed using GraphPad Prism version 6.0 (GraphPad software, La Jolla, CA, USA). ANOVA statistical analysis was applied to papilloma and lesion development between genotypes over a time course. The Student’s t test was applied to all other statistical analysis.
Discussion
In the human epidermis, 1 melanocyte interacts with approximately 36 keratinocytes to supply UV protective melanin (Seiberg
2001; Kippenberger et al.
1998). Furthermore, melanocytes are intricately regulated by keratinocytes and stromal factors in the skin (Santiago-Walker et al.
2009). These can be regulated by paracrine growth factors and cell–cell adhesion molecules (Haass et al.
2005). Melanocytes escape keratinocyte-regulated growth control by downregulating adhesion molecules such as E-cadherin (Haass et al.
2005), increasing melanoma-to-melanoma and melanoma-to-fibroblast cell adhesion molecule, N-cadherin and loss of cell anchorage due to changes in expression of integrin protein family members (Haass et al.
2005; Jamal and Schneider
2002). Our data demonstrated that loss of TRIM16 in a keratinocyte-specific knockout mouse model resulted in the development of larger melanocytic lesions in homozygous TRIM16 deleted mice after skin carcinogen challenge. The development of larger melanocytic lesions may indicate an increase in either radial migration of cells and/or increased melanocytic cell proliferation in TRIM16 keratinocyte knockout mice. Our result may also be due to a paracrine loss of TRIM16 signalling to melanocytes from the adjacent keratinocytes, since both TRIM16 and its target gene, IFNβ1, are known to be secreted into the extracellular environment (Munding et al.
2006b; Fujisawa et al.
1997; Kariko et al.
2004). Our own study showed that TRIM16 gene silencing reduced cell proliferation in melanocytes and melanoma cells (Sutton et al.
2014); it is possible that tumours may develop at a reduced rate in vivo, but tumours that do arise may have a more aggressive disposition due to an increase in EMT phenotype, given the increase in EMT markers, that may occur with TRIM16 silencing. This requires more study, in particular, the assessment of TRIM16 gene silencing in SCC and the evaluation of EMT markers. In addition, evaluation of EMT markers in SCC tumours comparing wild-type, heterozygous and homozygous TRIM16 mice may provide insight into the molecular pathology of tumour development in vivo.
Flower (Fwe) deficient mice have a reduced susceptibility to skin papilloma formation (Petrova et al.
2012). Like TRIM16 knockout mice, Fwe mice have no dicernable phenotype but display a significantly lower number of papilloma after DMBA/TPA carcinogen treatment compared to wild-type and heterozygous mice (Petrova et al.
2012). In the skin-specific TRIM16 heterozygous knockout mice, it is observed that a reduced latency and increased number of papilloma develop in TRIM16 heterozygous mice. However, loss of both copies of TRIM16 results in fewer papilloma. This suggests that loss of a single copy of TRIM16 increases tumour development and reduces latency, but loss of both copies abrogates this result. It is possible that a gene compensation effect is occurring by which loss of TRIM16 results in an increased expression of other genes (possibly members of the TRIM family) to compensate the loss of TRIM16. It would be interesting to test this hypothesis by performing a PCR or microarray of tissues from TRIM16 homozygous mice and determining the expression levels of TRIM family members compared to the heterozygous mice. Candidate TRIM compensation genes could be validated in vitro by knockdown of TRIM16 in SCC cells and overexpression of the candidate compensation gene to determine if TRIM16 effects on cell proliferation are ablated with gene compensation. Alternatively, the ablation of SCC development in TRIM16 homozygous knockout mice may indicate TRIM16 functions in vivo as an oncogene. An example of this is TRIM27, which exhibits complex function in cancer being characterized as both a tumour suppressor and oncogene (Hatakeyama
2011). TRIM27 regulates RARα through PML, and colocalizes with the PML-RARα fusion in acute promyelocytic leukaemia (APL). TRIM27 also translocates with the RET tyrosine kinase giving higher catalytic activity than RET alone in lymphoma, and resulting in increased cell proliferation and tumorigenesis (Hatakeyama
2011). To contrast the seemingly oncogenic activity of TRIM27, the protein has also been shown to induce apoptosis through a mechanism dependant on JUN N-terminal kinase (Dho and Kwon
2003). This profile of TRIM27 function in cancer suggests that the activity of TRIM proteins can be pleiotropic and, hence, TRIM16 may suppress cell proliferation and migration in melanoma, but has the potential to increase tumorigenesis in SCC. Further investigation is required to determine if TRIM16 is a tumour suppressor protein in melanoma and this requires developing a melanocyte-specific TRIM16 knockout mouse model that ascertains the function of TRIM16 in contributing to melanomagenesis.
In conclusion, this study suggests that keratinocytes influence melanoma development and provides the first insight into how keratinocyte TRIM16 expression impacts melanoma development. It also provides an intriguing possibility that keratinocyte TRIM16 expression may suppress melanoma cell metastasis. More detailed studies are required to determine the nature of the mechanism between TRIM16 expression and melanocytes including how exogenous TRIM16 secretion influences melanocyte cell proliferation and migration. Previously, we have shown the expression of TRIM16 to modulate IFNβ1 expression and reduce cell proliferation and migration in a manner dependent on IFNβ1 expression (Sutton et al.
2014). Exogenous treatment with both IFNα2 and IFNβ1 exerted antitumour and anti-metastatic effects, particularly to lymph nodes, in human melanoma xenografts (Roh et al.
2013). We hypothesize that keratinocyte loss of TRIM16 can increase melanoma cell migration and metastasis due to reduced paracrine expression of IFNβ1. The interplay between TRIM16 expression and innate immune response has been suggested by the observation that TRIM16 can directly bind to interleukin-1β and other components of the inflammasome (Munding et al.
2006a). Thus, reactivation of TRIM16 expression in keratinocytes may prevent metastasis from localized melanoma.
Acknowledgements
This work was supported by Program Grants from the National Health and Medical Research Council (NHMRC), Australia (APP1016699), Cancer Institute NSW (10/TPG/1-13), Cancer Council NSW (PG-11-06). The Children’s Cancer Institute, Australia is affiliated with UNSW Sydney and Sydney Children’s Hospital, Australia.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.