High levels of fatty acid-binding protein 5 excessively enhances fatty acid synthesis and proliferation of granulosa cells in polycystic ovary syndrome
verfasst von:
Jingyu Liu, Jie Li, Xin Wu, Mei Zhang, Guijun Yan, Haixiang Sun, Dong Li
Polycystic ovary syndrome (PCOS) is one of the most complex endocrine disorders in women of reproductive age. Abnormal proliferation of granulosa cells (GCs) is an important cause of PCOS. This study aimed to explore the role of fatty acid-binding protein 5 (FABP5) in granulosa cell (GC) proliferation in polycystic ovary syndrome (PCOS) patients.
Methods
The FABP5 gene, which is related to lipid metabolism, was identified through data analysis of the gene expression profiles of GSE138518 from the Gene Expression Omnibus (GEO) database. The expression levels of FABP5 were measured by quantitative real-time PCR (qRT‒PCR) and western blotting. Cell proliferation was evaluated with a cell counting kit-8 (CCK-8) assay. Western blotting was used to assess the expression of the proliferation marker PCNA, and immunofluorescence microscopy was used to detect Ki67 expression. Moreover, lipid droplet formation was detected with Nile red staining, and qRT‒PCR was used to analyze fatty acid storage-related gene expression.
Results
We found that FABP5 was upregulated in ovarian GCs obtained from PCOS patients and PCOS mice. FABP5 knockdown suppressed lipid droplet formation and proliferation in a human granulosa-like tumor cell line (KGN), whereas FABP5 overexpression significantly enhanced lipid droplet formation and KGN cell proliferation. Moreover, we determined that FABP5 knockdown inhibited PI3K-AKT signaling by suppressing AKT phosphorylation and that FABP5 overexpression activated PI3K-AKT signaling by facilitating AKT phosphorylation. Finally, we used the PI3K-AKT signaling pathway inhibitor LY294002 and found that the facilitation of KGN cell proliferation and lipid droplet formation induced by FABP5 overexpression was inhibited. In contrast, the PI3K-AKT signaling pathway agonist SC79 significantly rescued the suppression of KGN cell proliferation and lipid droplet formation caused by FABP5 knockdown.
Conclusions
FABP5 promotes active fatty acid synthesis and excessive proliferation of GCs by activating PI3K-AKT signaling, suggesting that abnormally high expression of FABP5 in GCs may be a novel biomarker or a research target for PCOS treatment.
Jingyu Liu and Jie Li contributed equally to this work.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
PCOS
Polycystic ovary syndrome
GC
Granulosa cell
FABP5
Fatty acid-binding protein 5
GEO
Gene Expression Omnibus
qRT‒PCR
Quantitative real-time PCR
CCK8
Cell counting kit-8
KGN
Human granulosa-like tumor cell line
lncRNAs
Long noncoding RNAs
miRNAs
MicroRNAs
FC
Fold change
GO
Gene Ontology
KEGG
Kyoto Encyclopedia of Genes and Genomes
IVF
In vitro fertilization
PFA
Paraformaldehyde
BSA
Bovine serum albumin
PBS
Phosphate buffered saline
DEGs
Differentially expressed genes
SEGs
Specifically expressed genes
BP
Biological process
MF
Molecular function
CC
Cellular component
Introduction
Polycystic ovary syndrome (PCOS) has a prevalence of 5–10% and has become one of the most complex endocrine disorders in women of reproductive age, seriously affecting women’s reproductive health and quality of life [1]. The clinical features of PCOS include hyperandrogenism, insulin resistance, polycystic ovarian morphology, and ovulatory dysfunction [2]. To date, the pathogenesis of PCOS has not been elucidated.
Granulosa cells (GCs) are an important somatic component of the ovary that surrounds oocytes and interacts with them to provide nutritional and mechanical support. Additionally, these cells maintain follicular development and the ovarian microenvironment through the process of follicle maturation [3]. The normal proliferation and functional transformation of GCs play key roles in the transition of primordial follicles to mature follicles [4]. Studies have shown that certain molecules highly expressed in PCOS GCs effectively promote the proliferation of GCs [5, 6]. Moreover, ovarian GCs in patients with PCOS exhibit abnormal and excessive proliferation, which is associated with abnormal follicular development and ovulation in polycystic ovaries [7, 8]. As a result, inhibiting GC proliferation may be a potential treatment for PCOS [9]. PI3K-AKT signaling is a fundamental pathway that regulates GC proliferation and apoptosis during follicular development [10‐12]. p-AKT promotes cell survival, growth, and proliferation by phosphorylating the downstream target FOXO1 to inhibit transcription [13], and recent studies have shown that PI3K-AKT signaling is abnormal in PCOS GCs [14, 15]. Overall, abnormal and excessive proliferation of GCs may be involved in the pathogenesis of PCOS, and studying the underlying mechanism may provide new insights for the development of novel therapeutic targets for PCOS.
Anzeige
As an endocrine disorder regulated by hormones, PCOS exhibits certain metabolic abnormalities, such as impaired metabolism of steroid hormones and insulin [16‐18]. Diverse pathways that are associated with PCOS-related metabolic abnormalities, including pathways related to fatty acid synthesis and metabolism, have been identified. Compared with healthy control individuals, PCOS patients exhibit significant lipid metabolism disorders [19‐21]. FABP5, an intracellular carrier of long-chain fatty acids and related active lipids, such as endocannabinoids, regulates the metabolism and activity of its ligands and selectively transfers specific fatty acids from the cytoplasm to the nucleus, where it activates nuclear receptors [22, 23]. Although the relevant literature shows that FABP5 can effectively promote fatty acid synthesis and metabolism and thus regulate cell proliferation, the regulatory effect of FABP5 on the proliferation of GCs in PCOS patients has not been reported.
In this study, we investigated whether FABP5 plays an important role in regulating GC proliferation and fatty acid synthesis and metabolism by activating PI3K-AKT signaling. Our results emphasize that a high level of FABP5 in the GCs of PCOS patients leads to excessive proliferation and fatty acid accumulation in these cells, which may be an underlying mechanism of excessive GC proliferation in PCOS patients and could lead to an effective strategy for the clinical diagnosis and treatment of PCOS.
Data processing of SEGs (specifically expressed genes) and DEGs
The long noncoding RNAs (lncRNAs) and microRNAs (miRNAs) in the original data were removed. P values < 0.05 and a |log2-fold change (FC)|≥ 1 was set as the cutoff criteria for obtaining candidate significantly expressed genes; those significantly expressed genes whose expression value was 0 in the PCOS group or control group were considered SEGs, and the remaining significantly expressed genes were considered SEGs. A follow-up analysis was subsequently conducted on the DEGs and SEGs.
Anzeige
Gene Ontology and KEGG pathway analyses of DEGs
The DEG ensemble IDs were translated into official gene symbols using DAVID (https://david.ncifcrf.gov/home.jsp). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were also conducted using the online analysis software Shanghai Biotechnology Corporation (http://enrich.shbio.com). A corrected P value < 0.05 indicated significant gene enrichment.
Patients and sample collection
Informed consent was obtained from all participants prior to undergoing in vitro fertilization (IVF) or embryo transfer procedures due to sperm quality issues or tubal obstructions, and use of human GCs were approved by the ethics committee of Nanjing Drum Tower Hospital on 5 December 2013 (2013–081-01). Human ovarian GC samples were obtained at the Reproductive Center of the Drum Tower Hospital Affiliated with Nanjing University Medical School from May 2018 to May 2019. The diagnostic criteria for PCOS were based on the 2003 Rotterdam criteria [2]. Those who ovulated normally, including those with infertility due to tubal or male factors, were also recruited as a control group. The GCs were isolated from normal donors (n = 12, range, 24–30 years old) or from PCOS donors (n = 12, range, 22–29 years old); these procedures were approved by the institutional review board of the Drum Tower Hospital of Nanjing University on 5 December 2013 (2013–081-01). The collected human GCs were properly stored for use in subsequent experiments.
Mice
All mouse experiments involved in this study were approved by the Institutional Animal Care and Use Committee of Nanjing Drum Tower Hospital (SYXK 2019–0059). GCs were isolated from 3-week-old ICR female mice purchased from Nanjing Medical University (Nanjing, China). All mice were maintained in the Animal Laboratory Center of Nanjing Drum Tower Hospital (Nanjing, China) with a 12/12 h light/dark cycle (lights off at 1900 h) and food and water available ad libitum.
KGN cell culture and treatment
KGN cells from our laboratory were used in cell culture experiments. The KGN cell line was grown in DMEM/F12 medium (Corning, New York, USA) supplemented with 8% (v/v) bovine calf serum (Sigma, Shanghai, China), 100 U/ml penicillin and 100 mg/ml streptomycin (HyClone, South Logan, UT, USA) at 37 °C with 5% CO2. Forty-eight hours after transfection with the myc-FABP5 plasmid or FABP5 siRNA, KGN cells were treated with 10 μM LY294002 (Selleck, Texas, USA) or SC79 (Selleck, Texas, USA) for another 48 h; these cells were referred to as myc-FABP5 + LY294002 or siFABP5 + SC79 cells, respectively.
Vector construction, small interfering RNA (siRNA) synthesis, and transfection
The FABP5 CDS was amplified by using the following primers: FABP5-Forward: 5’-ACTTGAATTCAATGGCCACAGTTCAGCAGCTG-3’ and FABP5-Reverse: 5’- ATAGTTCTAGAGAACTGAGCTTGGTCATTCTC-3’. The amplicons were subcloned and inserted into the pCS2-myc plasmid by using the restriction enzymes EcoR I and Xba I. The PCR procedure was as follows: 95 °C for 3 min; 5 cycles of 95 °C for 15 s and 58 °C for 30 s; 5 cycles of 95 °C for 15 s and 56 °C for 30 s; 5 cycles of 95 °C for 15 s and 54 °C for 30 s; 25 cycles of 95 °C for 15 s and 52 °C for 30 s; and 52 °C for 5 min; and a hold at 16 °C. The selected monoclonal bacteria were sequenced (Bioengineering Co., Ltd., Shanghai, China) and confirmed to be correct for plasmid extraction.
FABP5 siRNA and negative control (NC) siRNA were synthesized by Guangzhou RiboBio Co., Ltd. The FABP5 siRNA sequences used were as follows: siFABP5-Forward: 5’- UGGGAAGGAAAGCACAAUAUU-3’ and siFABP5-Reverse: 5’-UAUUGUGCUUUCCUUCCCAUU-3’.
Prior to transfection, KGN cells (1 × 105 cells/well) were plated in a 6-well plate with complete medium and incubated overnight. FABP5 siRNA and the pCS2-myc-FABP5 plasmid were transfected into KGN cells with Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific, Shanghai, China). The groups transfected with the negative control siRNA, FABP5 siRNA, empty vector control or pCS2-myc-FABP5 plasmid were referred to as the siNC, siFABP5, Ev-ctrl and myc-FABP5 groups, respectively. The transfection procedure was performed according to the manufacturer's instructions. After 48 h, the transfected KGN cells were used in subsequent experiments.
qRT–PCR verification
Total RNA was extracted from cells after treatment with TRIzol (Ambion/Thermo Fisher Scientific, Shanghai, China) according to the manufacturer’s instructions. The concentration and purity of all the RNA were tested after extraction, and the A260/A280 values were greater than 2.0. Reverse transcription was performed to generate cDNA using 5X All-In-One RT MasterMix (with AccuRT Ge5X All-In-One RT MasterMix and AccuRT Genomic DNA Removal Kit) (Applied Biological Materials, Vancouver, Canada) for qRT–PCR to detect FABP5, ACSL1, GPAM, LPIN1 and DGAT2 mRNA expression in human GCs and KGN or Fabp5 mRNA in mouse ovarian tissues, which was performed according to the instructions provided with ChamQ SYBR qRT–PCR Master Mix (without ROX) (Vazyme, Nanjing, China) using the fluorescence reagent SYBR and a qTOWER3G touch instrument (Analytik Jena, Jena, Germany). The data were analyzed by using the 2−ΔΔCt relative quantitative method with human or mouse 18S rRNA as an internal control in Microsoft Excel software. The primers used are listed in Table 1.
Table 1
qRT-PCR primers sequences
Gene
Forward Primers (5′-3′)
Reverse Primer (5′-3')
Homo sapiens FABP5
AGGAGTGGGAATAGCTTTGCG
GCTGAACCAATGCACCATCT
Homo sapiens ACSL1
AAGACAGATGGGAGGAGACCC
GCACGTACTGTCGGAAGTCA
Homo sapiens GPAM
GAAGCTGGAGCTGCTAGGG
CCACACTCACCCCATTCCTC
Homo sapiens LPIN1
CCAGCCTGCTGAGAACTAGA
GTGGAAAGGGGAGCATTGGA
Homo sapiens DGAT2
GCTGGGGTCTAGGCTGTTTC
TAGGCGGCTATGAGGGTCTT
Homo sapiens 18S rRNA
CGGCTACCACATCCAAGGAA
CTGGAATTACCGCGGCT
Mus musculus Fabp5
ACCGAGAGCACAGTGAAGAC
ACCGAGAGCACAGTGAAGAC
Mus musculus 18 s rRNA
ATGGCCGTTCTTAGTTGGTG
CGGACATCTAAGGGCATCAC
Data were analyzed by using the 2−ΔΔCt relative quantitative method with human or mouse 18 s rRNA as an internal control and A two-tailed unpaired t-test was used for statistical analysis
Anzeige
Cell proliferation assay
Transfected KGN cells (1 × 104 cells/well) were plated in a 96-well plate for 24, 48 or 72 h. A total of 10 µl of Cell Counting Kit-8 (CCK-8) reagent (Dojindo, Kyushu, Japan) was then added to each well, and the cells were incubated at 37 °C for 1 h. The optical density (OD) at 450 nm was subsequently measured.
Lipid droplet staining
KGN cells were grown on 24-well plates, washed three times with PBS and fixed with 10% paraformaldehyde (PFA) at room temperature for 30 min. The fixed KGN cells were washed three times with PBS, incubated with Nile Red (1 mg/ml) (Macklin, Shanghai, China) for 10 min at room temperature and subsequently stained with DAPI for 5 min at room temperature. Images were obtained overnight in the dark with a fluorescence microscope (LEICA DM3000 LED, Wetzlar, Germany).
Western blot analysis
KGN cells or mice ovarian tissues were washed twice with cold PBS and then lysed directly with cell lysis solution to extract the cell lysates. The protein concentrations were determined by using a BCA Protein Assay Kit (Thermo Fisher Scientific, Shanghai, China). Equal amounts of total protein (40 μg/lane) from the cell lysates were separated on a 12% (w/v) SDS‒polyacrylamide gel and transferred onto polyvinylidene fluoride membranes (Millipore). Immunoblotting was performed with primary antibodies against FABP5 (1:500; Proteintech, Chicago, USA), PCNA (1:500; Santa Cruz, Dallas, Texas, USA), AKT (1:500; Cell Signaling Technology, Boston, USA), phospho-Akt (Ser473) (1:500; Cell Signaling Technology, Boston, USA), and GAPDH (1:10,000; Bioworld, Minnesota, USA), followed by incubation with goat anti-rabbit or goat anti-mouse HRP-conjugated secondary antibodies. The protein bands were visualized using an enhanced chemiluminescence (ECL) detection method.
Immunohistochemistry
Paraffin-embedded ovarian tissues from PCOS and normal mice were obtained based on Li’s work [25]. Tissue sections were dewaxed and treated with freshly prepared PBS containing 0.3% hydrogen peroxide for 10 min to block endogenous peroxidase activity. Antigen retrieval was conducted by autoclaving the samples at 121 °C for 15 min in the presence of EDTA (pH = 9.0), followed by incubation in blocking solution to block endogenous biotin for 30 min. The sections were washed with TBS and then stained overnight with the primary antibody FABP5 (1:500; Proteintech, Chicago, USA) at 4 °C. Subsequently, the sections were rinsed with PBS and incubated with an HRP-conjugated goat anti-rabbit secondary antibody (rabbit ABC detection kit, ZSBio, Beijing, China) at 37 °C for 30 min. Next, the sections were stained with 3,3’-diaminobenzidine (DAB) and counterstained with hematoxylin. Control sections were prepared concurrently with the experimental sections and treated with nonspecific rabbit IgG. Nonspecific staining was not detected in the controls.
Anzeige
Immunofluorescence staining
KGN cells or human primary ovarian GCs were grown in 24-well plates that were prepositioned with plate inserts and fixed with 4% (w/v) PFA for 30 min at room temperature. Then, the cells were permeabilized with 0.5% (v/v) Triton X-100/PBS for 15 min, followed by blocking with 3% (g/v) BSA/PBS. Subsequently, the KGN cells were incubated overnight with the primary antibody Ki67 (1:2000; Abcam, Shanghai, China) or FABP5 (1:500; Proteintech, Chicago, USA) at 4 °C. The next day, the KGN cells were incubated with a goat anti-rabbit secondary antibody (Alexa Fluor 594) (1:1000; Abcam, Shanghai, China) at room temperature for 60 min, after which the nuclei were stained with DAPI. Finally, the KGN cells were visualized overnight in the dark with a fluorescence microscope (LEICA DM3000 LED, Wetzlar, Germany).
Statistical analysis
All the data are presented as the means ± SEMs. Statistical significance was evaluated with a two-tailed unpaired t test. A 2-tailed P < 0.05 was considered to indicate statistical significance. All the statistical analyses were implemented using GraphPad Prism 9 statistical software.
Results
Identification of significantly differentially expressed genes (DEGs)
To determine the important regulatory genes in GCs of PCOS patients, we downloaded the gene expression profiles of GSE138518 from the GEO database in a journal article published by Mao [24].
After removing the related interfering noncoding RNAs and genes that were not significantly expressed, we obtained all DEGs and SEGs with P values < 0.05 and |log2-FC|≥ 1 for a subsequent cluster analysis, and the results showed that differences occurred between the two samples, thus confirming that the dataset met the conditions for differential expression analysis (Fig. 1A, B). Subsequently, GO function and KEGG pathway analyses were performed, and we found that the DEGs and SEGs were enriched in 26 biological process (BP) terms, 3 cellular component (CC) terms and 1 molecular function (MF) term (Fig. 1C, Supplementary Table 1). KEGG pathway analysis of the DEGs and SEGs revealed that they were enriched mainly in histidine metabolism, propanoate metabolism, the TCA cycle, and the proteasome (Fig. 1D, Supplementary Table 2).
×
Anzeige
Patients with PCOS often exhibit abnormalities in lipid metabolism. Therefore, we focused particularly on GO functional terms and pathways related to lipid metabolism (fatty acid binding, fatty acid degradation, and fatty acid metabolism) (Fig. 1C, D). According to the analysis of the database, 6 hub DEGs (ACADM, ALDH7A1, FABP5, STX3, ACAT1, and HACD4) were highly expressed in PCOS GCs, and 2 hub DEGs (PTGDS and OXER1) were highly expressed in normal GCs (Fig. 1E).
High levels of FABP5 are present in the GCs of patients and mice with PCOS
FABP5 was chosen for investigation because its expression in PCOS GCs was 2.3-fold greater than that in normal GCs. As an important intracellular carrier of fatty acid metabolism, FABP5 is likely involved in the occurrence of PCOS. To clarify this hypothesis, we collected GCs from PCOS patients and normal patients to detect FABP5 expression and found that FABP5 mRNA and protein were expressed at high levels in the GCs of PCOS patients compared with those of normal patients (Fig. 2A, B) (A: Normal vs. PCOS = 1.044 ± 0.308 vs. 1.567 ± 0.341, P < 0.01). Furthermore, FABP5 expression in the ovarian tissues of PCOS mice was significantly greater than that in the ovarian tissues of normal mice (Fig. 2C, D, E, F) (C: Normal vs. PCOS = 1.104 ± 0.500 vs. 2.351 ± 0.376, P < 0.01; E: Normal vs. PCOS = 0.530 ± 0.148 vs. 1.007 ± 0.062, P < 0.05). Importantly, high expression of FABP5 was more obvious in GCs and oocytes at all follicle levels in PCOS mouse ovaries (Fig. 2F).
×
FABP5 facilitates lipid accumulation in KGN cells
To investigate the function of FABP5 in GCs, we performed exogenous overexpression and found that the FABP5 mRNA and protein levels were significantly greater than those in the EV-ctrl group (Fig. 3A, B, C) (A: myc-FABP5 (0 μg vs. 0.25 μg = 1.000 ± 0.000 vs. 1.239 ± 0.090, P < 0.05); myc-FABP5 (0 μg vs. 0.5 μg = 1.000 ± 0.000 vs. 2.183 ± 0.292, P < 0.01); myc-FABP5 (0 μg vs. 1 μg = 1.000 ± 0.000 vs. 3.720 ± 0.318, P < 0.001); C: myc-FABP5 (0 μg vs. 0.25 μg = 0.529 ± 0.045 vs. 0.817 ± 0.128, P < 0.05); myc-FABP5 (0 μg vs. 0.5 μg = 0.529 ± 0.045 vs. 1.213 ± 0.189, P < 0.01); myc-FABP5 (0 μg vs. 1 μg = 0.529 ± 0.045 vs.1.378 ± 0.121, P < 0.001)). As described above, FABP5 is an important intracellular carrier of fatty acid metabolism and is involved in intracellular lipid droplet accumulation [26]. Therefore, we investigated the effect of FABP5 on lipid accumulation and confirmed that FABP5 overexpression significantly increased the number of lipid droplets in KGN cells (Fig. 3D, E) (E: EV-ctrl vs. myc-FABP5 = 65.10 ± 6.153 vs. 80.23 ± 5.361, P < 0.01). In addition, some genes (e.g., ACSL1, GPAM, LPIN1, and DGAT2) related to processes such as lipid storage, β-oxidation, and lipid decomposition, which are involved in the regulation of free fatty acid storage in the form of cellular lipid droplets, were examined. As expected, FABP5 overexpression elevated their expression compared to those in the EV-ctrl group levels (Fig. 3F) (ACSL2 (EV-ctrl vs. myc-FABP5 = 1.000 ± 0.000 vs. 1.362 ± 0.168, P < 0.05); GPAM (EV-ctrl vs. myc-FABP5 = 1.000 ± 0.000 vs. 1.754 ± 0.132, P < 0.01); LPIN1 (EV-ctrl vs. myc-FABP5 = 1.000 ± 0.000 vs. 1.662 ± 0.295, P < 0.05); DGAT2 (EV-ctrl vs. myc-FABP5 = 1.000 ± 0.000 vs. 2.193 ± 0.336, P < 0.01)). To further confirm the function of FABP5, we performed endogenous silencing of FABP5 and the results showed that endogenous FABP5 silencing significantly decreased the numbers of lipid droplets (Fig. 4A, B. C, D, E) (A: siFABP5 (0 nM vs. 25 nM = 1.000 ± 0.000 vs. 0.850 ± 0.099, P < 0.05); siFABP5 (0 nM vs. 50 nM = 1.000 ± 0.000 vs. 0.453 ± 0.082, P < 0.001); siFABP5 (0 nM vs. 100 nM = 1.000 ± 0.000 vs. 0.480 ± 0.082, P < 0.001); C: siFABP5 (0 nM vs. 25 nM = 0.398 ± 0.082 vs. 0.168 ± 0.026, P < 0.05); siFABP5 (0 nM vs. 50 nM = 0.398 ± 0.082 vs. 0.106 ± 0.058, P < 0.05); siFABP5 (0 nM vs. 100 nM = 0.398 ± 0.082 vs. 0.075 ± 0.025, P < 0.01); E: siNC vs. siFABP5 = 69.964 ± 5.160 vs. 57.784 ± 6.181, P < 0.01) and significantly decreased the expression of ACSL1, GPAM, LPIN1, and DGAT2 in KGN cells (Fig. 4 F) (ACSL2 (siNC vs. siFABP5 = 1.000 ± 0.000 vs. 0.389 ± 0.108, P < 0.01); GPAM (siNC vs. siFABP5 = 1.000 ± 0.000 vs. 0.486 ± 0.113, P < 0.01); LPIN1 (siNC vs. siFABP5 = 1.000 ± 0.000 vs. 0.389 ± 0.120, P < 0.01); DGAT2 (siNC vs. siFABP5 = 1.000 ± 0.000 vs. 0.439 ± 0.104, P < 0.01)). These results suggest that FABP5 plays an important role in lipid accumulation in GCs in patients with PCOS.
×
×
FABP5 promotes KGN cell proliferation
Studies have shown that there is a possibility of excessive proliferation of GCs in PCOS patients [5, 6]. We observed a significant increase in the expression of the proliferation-related marker PCNA and in the number of Ki67-positive cells after FABP5 overexpression (Fig. 5A, C, D) (D: EV-ctrl vs. myc-FABP5 = 34.024 ± 5.860 vs. 47.662 ± 7.508, P < 0.05). Furthermore, the results of cell counting kit-8 (CCK8) analysis also showed that FABP5 overexpression increased the OD450 absorbance values of KGN cells (Fig. 5B) (B: 0 h (EV-ctrl vs. myc-FABP5 = 0.417 ± 0.023 vs. 0.439 ± 0.026, P > 0.05); 24 h (EV-ctrl vs. myc-FABP5 = 0.535 ± 0.016 vs. 0.766 ± 0.345, P < 0.01); 48 h (EV-ctrl vs. myc-FABP5 = 0.785 ± 0.035 vs. 1.201 ± 0.025, P < 0.001); and 72 h (EV-ctrl vs. myc-FABP5 = 1.306 ± 0.056 vs. 1.823 ± 0.041, P < 0.001)). However, FABP5 knockdown significantly decreased PCNA expression, the number of Ki67-positive KGN cells and the OD450 absorbance of KGN cells (Fig. 5E, F, G, H) (F: 0 h (siNC vs. siFABP5 = 0.403 ± 0.017 vs. 0.427 ± 0.030, P > 0.05); 24 h (siNC vs. siFABP5 = 0.619 ± 0.020 vs. 0.475 ± 0.020, P < 0.01); 48 h (siNC vs. siFABP5 = 0.846 ± 0.038 vs. 0.602 ± 0.061, P < 0.01); 72 h (siNC vs. siFABP5 = 1.279 ± 0.064 vs. 1.055 ± 0.064, P < 0.05); and H: siNC vs. siFABP5 = 39.526 ± 2.880 vs. 30.884 ± 4.187, P < 0.01). These results suggested that FABP5 plays an important role in facilitating GC proliferation.
×
FABP5 accelerates fatty acid synthesis and proliferation in KGN cells by activating PI3K-AKT signaling
Studies have shown that FABP5 can promote cell proliferation through the PI3K-AKT signaling pathway [27] and that PI3K-AKT signaling is beneficial for fatty acid synthase-mediated glycolysis. In our study, we found that FABP5 overexpression significantly promoted AKT phosphorylation. In contrast, FABP5 knockdown significantly inhibited AKT phosphorylation. (Fig. 6A). Moreover, FABP5 overexpression promoted the numbers of Ki67-positive KGN cells and the OD450 absorbance values of KGN cells, which is inhibited by LY2940002 (Fig. 6B, D, E) (B: 0 h (EV-ctrl vs. myc-FABP5 = 0.445 ± 0.042 vs. 0.460 ± 0.028, P > 0.05; myc-FABP5 vs. myc-FABP5 + LY294002 = 0.460 ± 0.028 vs. 0.454 ± 0.024, P > 0.05); 24 h (EV-ctrl vs. myc-FABP5 = 0.572 ± 0.070 vs. 0.822 ± 0.033, P < 0.01; myc-FABP5 vs. myc-FABP5 + LY294002 = 0.572 ± 0.070 vs. 0.642 ± 0.058, P < 0.01); 48 h (EV-ctrl vs. myc-FABP5 = 0.778 ± 0.026 vs. 1.144 ± 0.125, P < 0.01; myc-FABP5 vs. myc-FABP5 + LY294002 = 1.144 ± 0.125 vs. 0.852 ± 0.061, P < 0.05); 72 h (EV-ctrl vs. myc-FABP5 = 1.229 ± 0.039 vs. 1.612 ± 0.094, P < 0.01; myc-FABP5 vs. myc-FABP5 + LY294002 = 1.612 ± 0.094 vs. 1.308 ± 0.015, P < 0.01); E: EV-ctrl vs. myc-FABP5 = 36.344 ± 3.117 vs. 45.054 ± 2.823, P < 0.01; myc-FABP5 vs. myc-FABP5 + LY294002 = 45.054 ± 2.823 vs. 35.416 ± 3.971, P < 0.01). In contrast, after the inhibition of KGN cell proliferation induced by FABP5 knockdown, the stimulation of SC79 rescued the numbers of Ki67-positive KGN cells and the OD450 absorbance values of KGN cells (Fig. 6C, F, G)(C: 0 h (siNC vs. siFABP5 = 0.432 ± 0.012 vs. 0.427 ± 0.037, P > 0.05; siFABP5 vs. siFABP5 + SC79 = 0.427 ± 0.037 vs. 0.433 ± 0.009, P > 0.05); 24 h (siNC vs. siFABP5 = 0.554 ± 0.005 vs. 0.428 ± 0.011, P < 0.05; siFABP5 vs. siFABP5 + SC79 = 0.428 ± 0.011 vs. 0.551 ± 0.018, P < 0.01); 48 h (siNC vs. siFABP5 = 0.844 ± 0.030 vs. 0.656 ± 0.031, P < 0.01; siFABP5 vs. siFABP5 + SC79 = 0.656 ± 0.031 vs. 0.933 ± 0.037, P < 0.05); 72 h (siNC vs. siFABP5 = 1.317 ± 0.032 vs. 0.881 ± 0.053, P < 0.001; siFABP5 vs. siFABP5 + SC79 = 0.881 ± 0.053 vs. 1.143 ± 0.026, P < 0.001); G: (siNC vs. siFABP5 = 39.474 ± 4.759 vs. 27.874 ± 3.697, P < 0.01; siFABP5 vs. siFABP5 + SC79 = 27.874 ± 3.697 vs. 33.202 ± 3.496, P < 0.05).
×
Additionally, the numbers of lipid droplets and expressions of ACSL1, GPAM, LPIN1 and DGAT2 were also significantly decreased by LY294002 stimulation (Fig. 7A, B, E) (B: EV-ctrl vs. myc-FABP5 = 58.768 ± 6.112 vs. 74.874 ± 6.968, P < 0.01; myc-FABP5 vs. myc-FABP5 + LY294002 = 74.874 ± 6.968 vs. 51.888 ± 7.151, P < 0.001; E: ACSL1 (EV-ctrl vs. myc-FABP5 = 1.000 ± 0.000 vs. 1.487 ± 0.139, P < 0.01; myc-FABP5 vs. myc-FABP5 + LY294002 = 1.487 ± 0.139 vs. 1.132 ± 0.108, P < 0.05); GAPM (EV-ctrl vs. myc-FABP5 = 1.000 ± 0.000 vs. 1.742 ± 0.152, P < 0.01; myc-FABP5 vs. myc-FABP5 + LY294002 = 1.742 ± 0.152 vs. 1.312 ± 0.144, P < 0.05); LPIN1 (EV-ctrl vs. myc-FABP5 = 1.000 ± 0.000 vs. 1.775 ± 0.182, P < 0.01; myc-FABP5 vs. myc-FABP5 + LY294002 = 1.775 ± 0.182 vs. 1.274 ± 0.110, P < 0.05); GDAT2 (EV-ctrl vs. myc-FABP5 = 1.000 ± 0.000 vs. 2.264 ± 0.304, P < 0.01; myc-FABP5 vs. myc-FABP5 + LY294002 = 2.264 ± 0.304 vs. 1.610 ± 0.145, P < 0.05)) and increased by SC79 stimulation (Fig. 7C, D, G) (D: siNC vs. siFABP5 = 69.460 ± 5.944 vs. 55.756 ± 6.252, P < 0.01; siFABP5 vs. siFABP5 + sc79 = 55.756 ± 6.252 vs. 65.726 ± 5.503, P < 0.05; G: ACSL1 (siNC vs. siFABP5 = 1.000 ± 0.000 vs. 0.504 ± 0.105, P < 0.01; siFABP5 vs. siFABP5 + SC79 = 0.504 ± 0.105 vs. 0.841 ± 0.116, P < 0.05); GAPM (siNC vs. siFABP5 = 1.000 ± 0.000 vs. 0.436 ± 0.054, P < 0.001; siFABP5 vs. siFABP5 + SC79 = 0.436 ± 0.054 vs. 0.797 ± 0.064, P < 0.01); LPIN1 (siNC vs. siFABP5 = 1.000 ± 0.000 vs. 0.617 ± 0.126, P < 0.01; siFABP5 vs. siFABP5 + SC79 = 0.617 ± 0.126 vs. 0.862 ± 0.052, P < 0.05); GDAT2 (siNC vs. siFABP5 = 1.000 ± 0.000 vs. 0.559 ± 0.093, P < 0.01; siFABP5 vs. siFABP5 + SC79 = 0.559 ± 0.093 vs. 0.855 ± 0.099, P < 0.05)). These results demonstrated that FABP5 may induce GC proliferation and lipid droplet formation in GCs by activating PI3K-AKT signaling.
×
Discussion
Although the current clinical management and treatment strategies for PCOS include healthy lifestyles and drug interventions, such as metformin, the alpha-glycosidase inhibitor acarbose, and short-term contraceptives, they mainly mitigate metabolism and endocrine dysfunction only in patients with PCOS [28‐31]. Moreover, these nonsurgical treatments have limited effectiveness and require considerable time, and the molecular mechanisms underlying metabolism and endocrine disorders in PCOS patients have not been elucidated.
The primary aim of this study was to explore whether abnormal expression of FABP5 in the GCs of PCOS patients is related to the excessive proliferation and impaired fatty acid synthesis of GCs in PCOS patients and to the underlying mechanism involved. Our results demonstrated that FABP5 was upregulated in the GCs of PCOS patients and in those of PCOS mice. In vitro, FABP5 overexpression promoted the proliferation and fatty acid synthesis of KGN cells. In addition, PI3K-AKT signaling was promoted by FABP5 overexpression in KGN cells, whereas the PI3K-AKT inhibitor LY2940002 significantly suppressed the proliferation- and fatty acid synthesis-promoting effects induced by FABP5 overexpression. In contrast, FABP5 knockdown inhibited PI3K-AKT signaling, and the PI3K-AKT agonist SC79 significantly rescued the inhibition of KGN cell proliferation and lipid droplet formation caused by FABP5 knockdown.
PCOS patients with hyperandrogenaemia exhibit significantly abnormal lipid metabolism [32‐34]. As a small and highly conserved cytoplasmic carrier that regulates lipid metabolism, increased FABP5 expression was observed in PCOS GCs. In addition, we used KGN cells, a steroidogenic human granulosa-like tumor cell line that maintains physiological characteristics similar to those of human immature GCs [35, 36], to verify the function of FABP5 in vitro and found that FABP5 effectively promoted the generation of fatty acids in KGN cells. Studies have shown that FABP5 contributes to fatty acid synthesis [26, 37‐39]. A previous study showed that serum adipocyte-FABP levels were associated with metabolic abnormalities in PCOS patients [40], while another study indicated that adipocyte-FABP levels were likely associated with obesity in women with PCOS rather than with hyperandrogenaemia [41]. These studies undoubtedly support the positive effect of FABP5 on lipid formation in KGN cells.
At present, the pathogenesis of PCOS has not been described in detail. Numerous studies have shown that hypoproliferation and severe apoptosis of ovarian GCs are obvious phenotypes in PCOS patients [19, 42]. However, there are also some studies with a different view; they believe that PCOS patients have excessive proliferation of GCs [5‐8]. Therefore, further studies are needed to elucidate the underlying mechanisms involved. Although studies have shown that FABP5 also contributes to proliferation [26, 27, 43] in various other cell types, investigations of FABP5 in the context of PCOS are relatively limited. In our study, we observed that FABP5 could significantly promote KGN cell proliferation, suggesting that FABP5 might lead to the pathogenesis of PCOS through excessive proliferation of GCs. This is the first study to confirm that FABP5 is involved in promoting fatty acid synthesis and cell proliferation, which suggests that an excess of FABP5 in GCs may result in excessive fatty acid accumulation and proliferation of GCs, possibly leading to PCOS.
FABP5 has been reported to be involved in regulating cell proliferation and lipid metabolism by activating the PI3K-AKT signaling pathway [27, 44]. PI3K-AKT signaling is the fundamental signaling pathway that regulates the proliferation and apoptosis of GCs during follicular development, and changes in PI3K-AKT signaling may be a key factor in the pathogenesis of PCOS [45]. Consistent with the above conclusion, overexpression or knockdown of FABP5 effectively increased or decreased AKT phosphorylation, respectively, which resulted in abnormal proliferation of GCs. In addition, as with GC proliferation, we also found that fatty acid synthesis in KGN cells is affected by AKT phosphorylation. Despite these findings, studies indicating the regulation of fatty acid synthesis by PI3K-AKT signaling in PCOS are limited. Several reports have shown that PI3K-AKT signaling is involved in regulating glucose metabolism in PCOS patients [45, 46]. In summary, our work is the first to demonstrate that FABP5 may excessively promote GC proliferation and fatty acid synthesis through excessive activation of PI3K-AKT signaling.
This is an innovative study that revealed that a high level of FABP5 causes excessive proliferation and impaired fatty acid synthesis in GCs and may be an underlying mechanism of PCOS. However, there are several potential limitations in our study. For example, many PCOS patients are needed to further validate the expression of FABP5. In addition, investigating FABP5-interacting molecules is conducive to exploring the pathogenesis of PCOS. However, whether FABP5 can lead to the progression of PCOS through the activation of PI3K-AKT signaling, which affects the proliferation of granular cells, needs further verification. A deeper understanding of these molecules could lead to the development of targeted drugs that can be used in effective clinical treatment to alleviate or treat the onset of PCOS, and this goal will be part of our future research.
Acknowledgements
This work was supported by the National Natural Science Foundation of China and the Natural Science Foundation of Jiangsu Province. We also thank Mao et al. for selflessly sharing and uploading the data to the public database.
Declarations
Ethics approval and consent to participate
This study was approved by the Ethics Committee of the Drum Tower Hospital of Nanjing University.
Consent for publication
Written informed consent was obtained from all participants.
Competing interests
The authors declare no competing interests.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
High levels of fatty acid-binding protein 5 excessively enhances fatty acid synthesis and proliferation of granulosa cells in polycystic ovary syndrome
verfasst von
Jingyu Liu Jie Li Xin Wu Mei Zhang Guijun Yan Haixiang Sun Dong Li
Frauen mit unbehandelter oder neu auftretender Hypertonie haben ein deutlich erhöhtes Risiko für Uterusmyome. Eine Therapie mit Antihypertensiva geht hingegen mit einer verringerten Inzidenz der gutartigen Tumoren einher.
Trastuzumab deruxtecan scheint auch jenseits von Lungenkrebs gut gegen solide Tumoren mit HER2-Mutationen zu wirken. Dafür sprechen die Daten einer offenen Pan-Tumor-Studie.
Frauen mit lokalem oder metastasiertem Brustkrebs, die Statine einnehmen, haben eine niedrigere krebsspezifische Mortalität als Patientinnen, die dies nicht tun, legen neue Daten aus den USA nahe.
Welche Antibiotika darf man bei unkomplizierter Zystitis verwenden und wovon sollte man die Finger lassen? Welche pflanzlichen Präparate können helfen? Was taugt der zugelassene Impfstoff? Antworten vom Koordinator der frisch überarbeiteten S3-Leitlinie, Prof. Florian Wagenlehner.
Update Gynäkologie
Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert – ganz bequem per eMail.