Background
Lung cancer is the most common cause of cancer-related death worldwide, with non-small cell lung cancer (NSCLC) accounting for approximately 80% of all lung cancers[
1,
2]. Despite progresses in systemic treatment, only a small proportion of patients diagnosed with metastatic disease survive over 5 years. Most patients relapse within 1 year of starting first-line treatment mainly due to intrinsic or acquired resistance to chemotherapy[
3]. Pemetrexed (Alimta, Eli Lilly and Company), a multi-target folate antagonist, has recently become the cornerstone of treatment for non-squamous carcinoma of the lung[
4]. The selective sensitivity of non-squamous NSCLC to pemetrexed cytotoxicity is thought to be related to the levels of expression of thymidylate synthase (TS), an essential enzyme for the
de novo synthesis of thymidylate and subsequently DNA synthesis, and one of the main intracellular molecular targets of pemetrexed; indeed, elevated TS expression has been proposed as a biomarker of resistance to pemetrexed-based chemotherapy[
5‐
13].
Recently, it has been proposed that patients with NSCLC might benefit from combined treatment with epigenetic drugs[
14,
15]. In this context, histone deacetylase inhibitors (HDACi) represent a promising class of antitumor agents, developed to reverse the silencing of critical regulatory pathways[
16,
17]. Indeed, the cellular response to treatment with HDACi shows pleiotropic effects involving cell cycle arrest, induction of apoptosis/autophagy and differentiation, modulation of microtubule function, DNA repair, and angiogenesis[
18‐
20]. Based on their ability to activate the apoptotic and autophagic pathways, HDACi may have interest in combination with conventional chemotherapeutic agents to enhance tumor cell chemosensitivity[
14,
18,
21,
22]. HDACi have been demonstrated to regulate the expression of several genes and proteins including TS. Transcriptional regulation of TS may be attributed to Rb-E2F1 pathway modulation by p21
waf1⁄cip1 up-regulation via its promoter histone acetylation by HDACi[
23]. Thus, the effects of drugs that critically rely on TS inhibition to exert their cytotoxic action, such as 5-Fluorouracil (5FU), raltitrexed, and pemetrexed[
23,
24] can be potentially increased by HDACi[
25,
26].
Both apoptosis, a genetically programmed cell death pathway regulated by the complex interaction between anti- and pro-apoptotic proteins, and autophagy, a complex cellular process with a multifaceted role in cell death, have been implicated in the response to antineoplastic treatments[
27‐
29]. Under conditions of limited stress, such as starvation, autophagy promotes cell survival by degrading and recycling long-lived proteins and cellular components[
30,
31]; however, when the cell is exposed to prolonged or excessive conditions of stress, autophagy has been shown to result in cell death by self-digestion[
32].
In this study we evaluated the antitumor efficacy and the molecular mechanisms of action of ITF2357, a pan-HDACi[
33‐
36], in combination with pemetrexed, using
in vitro and
in vivo models of NSCLC and patient derived lung cancer stem-like cells (LCSC). ITF2357 potentiated pemetrexed cytotoxic activity in a sequence-dependent manner: indeed, the combination of pemetrexed followed by ITF2357 showed a highly synergistic interaction
in vitro in both NSCLC and LCSC cells. The observed decrease in cell viability was due to activation of both apoptosis and autophagy, which were interconnected in the synergistic loss of cell viability induced by sequential pemetrexed/ITF2357.
Methods
Cell cultures, plasmids, and transfection
Human NSCLC established cell lines (H1299, H460, A549, H1650, Calu-1) were cultured in 10% inactivated foetal bovine serum (HyClone, Termoscientific, South Logan, UT) in RPMI medium (Invitrogen, Carlsbad, CA). H1299 short hairpin (sh) Beclin1, shControl, EGFP-LC3B and ptf-LC3 stable clones were generated as previously described[
37] and cultured in the presence of geneticin (800 μg/ml, Sigma-Aldrich, St. Louis, MO).
Patient-derived LCSC18, LCSC36, LCSC136 and LCSC143 cell lines were isolated as described[
38] and cultured in serum-free medium containing 50
μ g/ml insulin (Sigma-Aldrich), 100
μ g/ml apo-transferrin (Sigma-Aldrich), 10
μ g/ml putrescine (Sigma-Aldrich), 0.03
μ M sodium selenite (Sigma-Aldrich), 2
μ M progesterone (Sigma-Aldrich), 0.6% glucose (Sigma-Aldrich), 5mM HEPES (Euroclone, Pero, Italy), 0.1% sodium bicarbonate (Euroclone), 0.4% BSA (PAA Healthcare, Milan, Italy), glutamine (Euroclone), and antibiotics (Euroclone), dissolved in DMEM–F12 medium (Invitrogen) and supplemented with 20
n g/ml EGF (Peprotech, Princeton, NJ) and 10
n g/ml bFGF (Peprotech). Flasks non-treated for tissue culture were used to reduce cell adherence and support growth as undifferentiated tumor spheres.
Pooled small interfering RNA (siRNA) oligonucleotides against TS and ATG7 were purchased from Dharmacon RNA Technologies (siGENOME SMART pool, Lafayette, Colorado). For siRNA transfection, cells were seeded and after 24 h transfected with 100 nM pooled oligonucleotides mixture by using Lipofectamine2000 (Invitrogen) following manufacturer’s protocol. 24 h after transfection, media were removed and cells were treated with Pemetrexed (Alimta, formerly LY231514, Eli Lilly and Company) and ITF2357 (Givinostat, Italfarmaco) alone or in combination. Gene silencing efficacy by siRNA was assessed by Western blot or qRT-PCR analyses.
Reagents preparation and treatments
Cells were treated with ITF2357 and pemetrexed, either alone or in combination, as follows: (a) ITF2357; (b) pemetrexed; (c) ITF2357 and pemetrexed, simultaneously; (d) ITF2357 followed by pemetrexed; (e) pemetrexed followed by ITF2357. Both detached and adherent cells were collected, and differentially processed according to analyses performed.
3-Methyladenine (3MA, 1mM) (Enzo Life Science, Plymouth Meeting, PA, USA), and the pan-caspase inhibitor zVAD-fmk (zVAD, 50μM, Sigma-Aldrich) were dissolved in DMSO. Chloroquine diphosphate (CQ, 25μM, Sigma-Aldrich) was dissolved in water.
Assessment of cell viability
The inhibitory effect of different drugs was assessed following manufacturer’s protocol on i) NSCLC cell growth by measuring 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide inner salt (MTT, Sigma-Aldrich) dye absorbance of cells, and ii) LCSC cell growth by quantitation of the ATP present in metabolically active cells using CellTiter-Glo® Luminescent (Promega, Southampton, UK). Data were analyzed by the Chou-Talaly method (CalcuSyn software, Biosoft, Cambridge) to determine the combination index (CI), a well-established index of the interaction between two drugs. CI values of <1, =1, and >1 indicate synergistic, additive, and antagonistic effects, respectively.
Flow cytometric analysis
Flow cytometric analysis (BD Accuri™ C6, BD biosciences) was performed to evaluate cell cycle distribution by propidium iodide (PI) staining, apoptosis by AnnexinV-FITC/PI staining, and to detect acidic vesicular organelles (AVOs) by acridine orange staining, as previously described[
39,
40]. Active Caspase-3 Apoptosis Kit (BD biosciences) was used to detect the heterodimer of 17 and 12 kDa subunits, which is derived from the pro-enzyme.
Analysis of autophagy
Cells grown on glass coverslips were fixed in 2% formaldehyde for 10 minutes at room temperature. Detection of autophagosomal structures was performed by fluorescence microscopy observing LC3B
puncta in EGFP-LC3B expressing cells[
41]. Autophagic flux was analyzed by fluorescence microscopy monitoring the distribution and alteration of mRFP-GFP-LC3B fluorescent signals[
41]. Typically, at least 200 cells were counted, and cells with more than 10
puncta were considered autophagy positive. Images were scanned under a × 63 oil immersion objective and, to avoid bleed-through effects, each fluorescent signal was scanned independently by using a Leica DMIRE2 microscope equipped with a Leica DFC 350FX camera, elaborated by a Leica FW4000 deconvolution software (Leica, Solms, Germany) and processed using Adobe PhotoShop software to adjust image brightness and contrast.
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was extracted from in vitro cultured cells using a Qiagen RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions. Reverse transcription was performed using RevertAid Reverse Transcriptase (Thermo Scientific). qRT-PCR was performed using a Gene-Amp 5700 sequence detection system (Applied Biosystems, Foster City, CA, USA). The mRNA levels were normalized using glyceraldehyde 3-phosphate dehydrogenase (GAPDH), a housekeeping gene that was used as the internal control, because its expression has been demonstrated to remain stable during the protocol. The following primers were used: TS Forward: GCGCTACAGCCTGAGAGATG, TS Reverse: TGCCCCAAAATGCCTCCACT, GAPDH Forward: TCCCTGAGCTGAACGGGAAG, GAPDH Reverse: GGAGGAGTGGGTGTCGCTGT.
qRT-PCR was also performed by using tumor thick sections (10 mm) for RNA extraction. The sections were serial to other 4 mm-thick sections, from the same formalin-fixed paraffin embedded tumor block, used for H&E staining, to select appropriate neoplastic areas and for TS immunohistochemistry. The 10 μm-thick sections were dried overnight at 56°C, de-paraffinated and stained with Nuclear Fast Red solution (Sigma-Aldrich), then rehydrated through graded alcohols and dissected using a scalpel. RNA isolation and retrotranscription were performed as previously reported[
42]. An ABI PRISM 7900HT Sequence Detection System (Life Technologies, Applied Biosystems Division, Carlsbad, CA, USA) in 384-wells plate was used. All qPCR mixtures contained 1μl of cDNA template (approximately 40 ng of retrotranscribed total RNA) diluted in 9 μl of distilled-sterile water, 1200 nM of each primer, 200 nM of internal probe and TaqMan Gene Expression Master Mix (Life Technologies) to a final volume of 20 μl. The sequences of primers and probes used for qPCR analyses were previously published[
42].
Cycling conditions were 50°C for 2 minutes, 95°C for 10 minutes followed by 46 cycles at 95°C for 15 seconds and 60°C for 1 minute. Baseline and threshold for cycle threshold calculation were set manually with ABI Prism SDS 2.4 Software. A mixture containing Human Total RNA (Stratagene, La Jolla, CA) was used as control calibrator on each plate. β-actin was used as internal reference gene. The fold change in gene expression levels, expressed in unitless values, was evaluated using the 2
–ΔΔCt method[
43].
Western blot analysis
Total protein extracts were fractionated by SDS-PAGE, transferred to a nitrocellulose filter and subjected to immunoblot assay. Immunodetection was performed using antibodies directed to: H3 acetylated histone (Millipore, Billerica, MA), TS (ab58287, Abcam), p62/SQTSM1 (Santa Cruz Biotechnology, Santa Cruz, CA), HSP72/73 (Calbiochem, San Diego, CA), LC3B and acetyl-α-tubulin (K40, Sigma-Aldrich), ATG7 (Millipore), caspases 3 and PARP (Santa Cruz). Anti-mouse or anti-rabbit immunoglobulin G (IgG)-horseradish peroxidase conjugated antibodies (Cell Signaling, Amersham Biosciences, Freiburg, Germany) were used as secondary antibodies at 1:10000 dilution. Antibody binding was visualized by enhanced chemiluminescence method (Amersham Biosciences) according to manufacturer’s specification and recorded on autoradiographic film (Amersham Biosciences). Developed films were acquired using GS-700 Imaging Densitometer (Biorad Laboratories, Hercules, CA) and processed with Adobe PhotoShop software. Densitometric evaluation was performed using Molecular Analyst Software (Biorad) and normalized with relative controls depending on the analysis.
In vivo experiments
To evaluate the effect of different treatments on in vivo tumor growth, 5 × 106 cells were injected intramuscularly into 6-8 week-old female immunodeficient athymic mice (10 for each group). Weekly intraperitoneal treatment with pemetrexed (1000 mg/Kg), and oral administration with ITF2357 (100 mg/Kg) every 24 h for 4 days started when tumors were palpable (about 7 days after cell injection), and stopped when the animals were sacrificed. Animals were observed daily and tumor volume (mm3) calculated as length × width2 × π/6. Mice survival was calculated by euthanizing the animals when the tumors reached 2.5 g. The experiments were repeated twice. All procedures involving animals and their care were authorized and certified by the decree n. 67/97A of the Italian Minister of Health and protocol 2560/97 of the Rome Health Service Unit (ASL – RMB).
Statistics
Experiments were replicated three times, unless otherwise indicated, and the data were expressed as mean ± standard deviation (SD) or mean ± standard error (SEM). Differences between groups were analyzed with a two-sided paired or unpaired t test and were considered to be statistically significant for p < 0.05.
Discussion
The present study sought to understand whether the modulation of TS expression induced by ITF2357-mediated HDAC inhibition might affect the response of NSCLC and LCSC-derived cell lines to pemetrexed. We found that the sequence of drug administration is critical in determining a synergistic interaction between pemetrexed and ITF2357 in both models. In particular, simultaneous treatment with the two drugs resulted in antagonistic effects, and ITF2357 followed by pemetrexed showed a synergistic effect only in some cell lines. On the contrary, a sequence-dependent, highly synergistic potentiation of pemetrexed activity was observed when ITF2357 was administered after pemetrexed exposure. Notably, such synergistic effect was evident in models of both adenocarcinoma and squamous cell carcinoma of the lung, a histologic subtype that is currently considered to be clinically resistant to pemetrexed[
4], including patient-derived LCSC.
TS, one of the intracellular targets of pemetrexed, has been shown to be downmodulated by HDACi[
23], through the Rb-E2F1-p21 axis, and hence may have a close association with pemetrexed efficacy. Compounds that modulate TS expression can potentially influence the activity of TS inhibitors and enhance the cytotoxicity of several drugs[
49,
50]. We found that both TS mRNA and protein expression were downregulated by ITF2357 when administered alone or in combination with pemetrexed. Although these findings are consistent with our mechanistic hypothesis, the fact that TS downregulation by siRNA further enhanced apoptosis induction observed with single and combined pemetrexed treatment raises the possibility that other sites of pemetrexed action, such as aminoimidazolecarboxamide ribonucleotide formyltransferase, or glycinamide ribonucleotide transformylase, may also play a role in the observed cytotoxic interaction between pemetrexed and ITF2357.
Our study shows that the mechanism of cell death induced by the combined treatment involves both autophagy and apoptosis, and provides an interesting link between these two pathways and loss of cell viability. In particular, combined treatment induced a canonical molecular autophagic pathway dependent on Beclin1 and ATG7, involved in the nucleation and conjugation machinery, respectively. This process proceeds unimpeded, with the ultimate fusion between autophagosomes and lysosomes, resulting in degradation of the cargo of the autophagosomes by lysosomal hydrolases[
30,
32]. Accumulating evidence reveals that autophagy and apoptosis can cooperate, antagonize or assist each other, thus differentially influencing cell fate[
45‐
47,
51]. Using both pharmacologic and genetic approaches, we showed that these two mechanisms might act in concert to induce cell death upon sequential pemetrexed/ITF2357 treatment. In particular, when autophagy was repressed by Beclin1 or ATG7 knockdown, a decreased rate of apoptosis was detected in cells exposed to the drug combination. These results indicate that, in this specific context, autophagy positively controls apoptosis induction. Notably, genetic and pharmacological inhibition of late stages of autophagy, using a siRNA against LAMP2 or Chloroquine respectively, only marginally affected the effects of sequential ITF2357/pemetrexed on cell viability (data not shown). Conversely, the pan-caspase inhibitor zVAD did reduce apoptosis induction, but had little if any effect on autophagic markers and cell viability. In this context, it is important to note that the experimental data from viability measurements are not a function of sole caspases activation. On the other hand in many assays generally used for viability measurements the percentage cell viability could be significantly overestimated or underrated when the cells are committed to an autophagic pathway.
Overall, these results indicate that in NSCLC models sequential pemetrexed/ITF2357 causes a toxic form of autophagy, with consequent activation of the apoptotic program, which can lead to caspase-dependent apoptosis. From a mechanistic standpoint, we can speculate that the increased formation of acidic lysosomes, as the final end product of the autophagic flux, may lead to the release of active cathepsins or calpain proteases into the cytosol, where proapoptotic proteins such as BID can then be cleaved/activated[
52]. It is also possible that Beclin1 and ATG5, which are required for the formation of autophagosomes, enhance susceptibility to apoptotic stimuli upon cleavage by proteases. Truncated proteins might translocate to mitochondria, and sensitize cells to apoptosis, possibly through the release of pro-apoptotic factors[
53,
54]. A pro-apoptotic function for ATG12, the conjugation partner of ATG5, has been recently identified, being ATG12 required for caspase activation in response to a variety of apoptotic stresses[
55]. The molecular mechanisms underlying the apoptotic function of the non-conjugated forms of ATG5 and ATG12 might be similar, as both proteins were shown to interact with anti-apoptotic members of the BCL2 family[
54,
55]. Autophagy can also contribute to the induction of apoptosis activated by intrinsic stress signals through recruitment of caspase-8 to autophagosomes and consequent activation[
56]. Finally, although protein degradation by autophagy is considered to be largely non-selective, an interesting concept for the direct regulation of apoptosis by autophagy is the selective targeting of apoptotic proteins for autophagic degradation. In this way, autophagy could shift the balance between anti- and pro-apoptotic factors, leading to initiation or inhibition of apoptosis[
47,
55,
57].
In vivo experiments in nude mice provide a proof of the principle that a sequential schedule of pemetrexed followed by ITF2357 may indeed be developed for clinical testing, as the combination was able to substantially inhibit tumor growth and increase mice survival, with no increased toxicity. Such a sequential, intermittent, schedule of administration would have the advantage of maximizing the synergistic anti-tumor interactions between the two drugs, as indicated by
in vitro modeling of different administration schedules, while simultaneously avoiding toxicities related to continuous HDACi administration[
58].
Conclusion
Our data indicate that combined treatment with pemetrexed followed by the HDACi ITF2357 has strikingly synergistic anti-tumor activity in NSCLC models. In particular, sequential administration of pemetrexed followed by ITF2357 was crucial in inducing growth-inhibitory synergism between the two drugs in all NSCLC models tested, at least in part due to ITF2357 ability to downregulate TS expression. Interestingly, while inhibition of initiation and autophagosome elongation blocked both AVOs formation and apoptosis induction, a pan-caspase inhibitor had no effect on AVOs accumulation induced by drug combination. These mechanistic studies highlighted a hierarchical activation of an autophagy program, which in turn results in the activation of caspase-dependent apoptosis, both of which contribute to loss of cell viability. Sequential pemetrexed followed by ITF2357 was also feasible and effective in xenograft models of NSCLC, supporting the possibility to develop such rational, mechanism-based combination schedule for the treatment of advanced NSCLC in the clinical setting.
Acknowledgements
We are grateful to Dr. Adele Petricca for secretarial assistance, Dr. Simone Bonacelli for revising the English language, and BD Biosciences for support. Teresa De Luca and Chiara Gabellini are recipients of fellowships from the Italian Foundation for Cancer Research and from Fondazione Veronesi, respectively. This work was supported by Italian Association for Cancer Research (DT,11502 and DDB, 14100), Italian Association for Cancer Research, Special Program Molecular Clinical Oncology (MM, 9979), Italian Ministry of Health (MM) and Fondazione Veronesi (DDB).
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
DT performed the experiments and analyzed the data; DT, DDB and MM conceived the idea and designed the experiments; MD, CG, TDL, MDM, SB, VM performed the experiments; AE and RDM provided LCSC models; RDM and MM critically discussed the data and revised the manuscript; DT and DDB wrote the manuscript. All authors read and approved the manuscript.