Introduction
Both clinical research and animal experiments have demonstrated that endothelial repair/regeneration depends on the availability of circulating endothelial progenitor cells (EPCs), and EPCs function is disrupted by cardiovascular diseases, such as hypertension, hypercholesterolemia and coronary artery disease (CAD), as well as by other diseases such as diabetes mellitus [
1‐
3]. Absence of sufficient circulating EPCs may in turn affect the progression of cardiovascular diseases [
4]. Clinical trials conducted in CAD patients demonstrated that the level of circulating EPCs may be a surrogate biologic marker for vascular function and cumulative cardiovascular risk [
4]. Furthermore, the level of circulating EPCs may predict the occurrence of cardiovascular events and death from cardiovascular causes which may help identify patients at increased cardiovascular risk [
4‐
6].
Increased level of circulating asymmetric dimethylarginine (ADMA), an endogenous nitric oxide synthase (NOS) inhibitor, has been implicated in endothelial dysfunction in atherosclerosis [
7]. Two isoforms of dimethylarginine dimethylaminohydrolase (DDAH) are responsible for the metabolization of ADMA. DDAH2 predominates in tissues that express endothelial NOS and the impairment of DDAH2 activity and/or expression rather than DDAH1 appears to be responsible for the elevation of plasma ADMA in endothelial cells of atherosclerosis [
8]. Consequently, DDAH2 is recognized as a protective factor of endothelial function and a potential therapeutic target for cardiovascular diseases such as atherosclerosis, diabetes mellitus and aging [
9].
Elevated homocysteine (Hcy) has been regarded as an independent risk factor for atherothrombotic vascular diseases [
10]. Hcy reduces the number and function of EPCs which may be due to accelerated senescence of EPCs [
11]. Our previous study has shown that hypermethylation of DDAH2 gene contributes to hcy-induced apoptosis of endothelial cells, which could be inhibited by epigallocatechin-3-gallate [
12,
13]. In this study we aimed to explore the possible involvement of aberrant methylation of DDAH2 promoter in the modulation of EPCs in CAD patients and determine whether the effects of Hcy on EPCs cells are mediated by the induction of DDAH2 promoter methylation.
Materials and methods
Study population
Twenty-five CAD positive patients (at least one coronary artery stenosis >50%) and 15 negative patients (angiographically normal) were randomly recruited from the Third Xiangya Hospital of Central South University. The characteristics of the patients were shown in Table
1. This study was approved by Ethics Committee of the Third Xiangya Hospital of Central South University, and written informed consent was obtained from all subjects.
Table 1
General characteristics of the patients and controls
Gender | | | 0.7360 |
Male (%) | 10 (67.70) | 18 (72.00) | |
Female (%) | 5 (32.30) | 7 (28.00) | |
Age (years) | 64.73 ± 3.00 | 67.36 ± 2.00 | 0.3469 |
BMI, kg/m2 | 23.10 ± 0.43 | 22.53 ± 0.37 | 0.3289 |
SBP, mm Hg | 160.70 ± 4.00 | 161.00 ± 4.00 | 0.9438 |
DBP, mm Hg | 91.40 ± 3.00 | 92.80 ± 3.00 | 0.8707 |
Creatinine, μmol/L | 84.41 ± 6.17 | 109.6 ± 22.25 | 0.3943 |
Homocysteine, μmol/L | 10.9400 ± .73 | 16.3400 ± 1.47 | 0.004 |
fasting blood-glucose (mmol/L) | 7.06 ± 0.78 | 6.03 ± 0.40 | 0.1131 |
Triglyceride, ìmol/L | 2.45 ± 0.48 | 1.97 ± 0.24 | 0.3320 |
Total cholesterol, ìmol/L | 4.49 ± 0.24 | 4.53 ± 0.20 | 0.8967 |
LDL-C, mmol/L | 2.65 ± 0.31 | 2.80 ± 0.43 | 0.8966 |
Positive history of diabetes (%) | 5(40) | 4(16) | 0.2550 |
Positive history of smoking (%) | 3(20) | 9(36) | 0.4770 |
Positive history of drinking (%) | 3(20) | 11(44) | 0.1770 |
Cell culture
Peripheral blood mononuclear cells (PBMCs) were isolated from the blood of both CAD patients and volunteers by density gradient centrifugation with Histopaque 1077 (Sigma-Aldrich, St Louis, Missouri, USA). PBMCs were resuspended in six-well plates coated with human fibronectin (Chemicon, Temecula, CA, USA), and cultured in endothelial basal medium-2 (EBM-2) (Clonetics, Walkersville, MD, USA) supplemented with endothelial growth medium-2 (EGM-2). The medium was changed every 3 days of culture.
Flow cytometry
EPCs were cultured for 14days, then incubated with 6 μg/mL 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine-labeled acetylated low-density lipoprotein (acLDL-DiI) at 37°C for 2 h, and then with 10 μg/mL FITC-labeled Ulex europaeus agglutinin-1 (UEA-1) for 1 h. To detect the markers, flow cytometry was performed following routine procedures with the following primary antibodies: PE-conjugated mouse anti-CD133 antibody (1:400 dilution), PE-conjugated mouse anti-CD34 antibody (1:400 dilution), Alexa Fluor® 488-conjugated mouse anti-CD45 (1:400 dilution), and Alexa Fluor® 647 mouse monoclonal anti-VEGFR-2 antibodies (1:400 dilution). All these antibodies were from Biolegend (San Diego, CA, USA). Normal mouse, goat and rabbit IgGs were substituted for primary antibodies as negative or isotype control. After final washes in PBS, all the samples were analyzed by fluorescence-activated cell sorting (FACS) FACScalibur system (Becton Dickinson, San Diego, CA) (gating strategy for FACS was shown in Additional file
1: Figure S1), and observed in an inverted fluorescent microscope (Nikon, Japan).
Detection of adhesion ability of EPCs
EPCs were cultured for 14 days and collected by digestion with 0.25% trypsin and centrifugation. Then the cells were resuspended in EGM-2 medium at the density of 1 × 105/ml. 200 μl cell suspension was seeded in 24-well plates coated with HFN and incubated at 37°C for 2 h. Next the non-adherent cells were washed away and the adherent cells were incubated with Hoechest33342 staining solution at 37°C for 20 min, followed by washing with PBS twice. Finally, the stained nuclei were observed and counted under an inverted fluorescence microscope.
Real-time quantitative PCR
Total RNA was isolated from EPCs using the RNeasy mini kit (Qiagen, Valencia, CA, USA). Real-time quantitative RT-PCR was performed using a Rotor-Gene 3000 (Corbett Research, Mortlake, NSW, Australia) and mRNA levels were quantified using the One Step PrimeScript RT-PCR Kit (TaKaRa, Dalian, China). The primers were as follows: DDAH2 forward 5′-GGTGCTGGGAGGTAAACTGA-3′and reverse 5′-CTAGATCTCTAGGTCATCAGGCCG-3′; GAPDH forward 5′-AACAGCCTCAAGATCATCAG-3′ and reverse 5′-GGATGATGTCTGGAGAGCC-3′.
Detection of DNA methylation
Genomic DNA was extracted from cells with TIANamp Genomic DNA kit and the purity of the extracted DNA was judged based on A260/A280 ratio. Genomic DNA was subjected to sodium bisulfite modification by using EpiTect bisulfite kit, and nested PCR was carried out with GoTaq hot star polymerase system (Promega, WI, USA). The primers were as follows: outer pairs GTAGGGAATTTTGGAGTATTTGTTT and CTAAAAAATTAAACATCCTCTCTCC, product size: 1,013 bp, CpGs in product: 65; inner pairs GGTGGGTTAGTGATTTTGAGTTTAG and CTCCCCATACTCTCTATCTAATACAAAC, product size: 587 bp, CpGs in product: 43. PCR products were purified by gel electrophoresis, and subcloned into pGEM®-TEasy Vector System (Promega, WI, USA) for sequencing by Beijing Genomics Institute (Beijing, China).
Statistical analysis
Data were expressed as mean ± standard deviation (). Multiple samples were compared by using one-way ANOVA, pairwise comparison was performed by LSD method. Spearman correlation coefficient was calculated by bivariate correlation analysis. All analyses were performed with SPSS 13.0 software. P < 0.05 was considered significant.
Discussion
In the present study, we demonstrated that the adhesion function of EPCs was significantly impaired in CAD patients, accompanied by downregulated expression of DDAH2. Meanwhile, DDAH2 promoter was hypermethylated and this was negatively correlated with the adhesion function of EPCs from CAD patients. Furthermore, we isolated EPCs from healthy volunteers and treated them with Hcy. The results showed that Hcy decreased adhesion ability of EPCs, accompanied by downregulated expression of DDAH and aberrant hypermethylation of DDAH2 promoter. All these effects of Hcy were inhibited by 5-Aza, an inhibitor of DNMT. Taken together, these data suggest that aberrant hypermethylation of DDAH2 promoter may play a role in impairing the function of EPCs and contribute to CAD.
To date, no consensus has been achieved on the definition of EPCs. The CD34 + CD133 + KDR + cells are widely accepted as circulating EPCs. Flow cytometric analysis of three markers of EPCs (CD34+, CD133+ and KDR+) has been used for EPCs enumeration [
16]. Therefore, in this study we chose the combination of these three markers to detect EPC populations.
One recent study showed that plaque regression was augmented by adoptive transfer of EPCs in the atherosclerosis-prone mouse model [
17]. However, the bioavailability of EPCs is affected by endogenous and exogenous risk factors of atherosclerosis [
18]. Exposure to ambient fine particulate matter air pollution increased the risk for cardiovascular diseases by preventing EPCs mobilization to peripheral blood [
19]. Hypercholesterolemia also indirectly reduced both the availability and functionality of EPCs, thus limiting EPCs-mediated vascular repair [
20]. In addition, functional impairment of EPCs results in severely reduced angiogenic capacity in vivo in metabolic syndrome [
21]. Consistent with these reports, in the present study we provided clinical evidence that the adhesion ability of EPCs was significantly lower in CAD patients compared with non-CAD volunteers.
In CAD patients, it has been confirmed that ADMA is an endogenous inhibitor of the differentiation and function of EPCs [
9]. DDAH2 is an endogenous catabolic enzyme of ADMA, and is expressed at relatively high level in all fetal tissues [
22]. Furthermore, recent studies revealed the association between DDAH2 gene polymorphisms and CAD, type 2 diabetes and hypertension [
23,
24]. In our present study, we found that DDAH2 mRNA expression was downregulated in EPCs isolated from CAD patients compared with non-CAD group, suggesting that the downregulation of DDAH2 expression may contribute to impaired function of EPCs. However, the mechanism responsible for downregulated expression of DDAH2 is unclear.
DNA methylation is an important cellular mechanism that modulates gene expression associated with aging, inflammation and atherosclerotic processes. Alterations in DNA methylation profiles, including both hyper- and hypo-methylation, were present in aortas and PBMCs without detectable atherosclerotic lesion in 4-week-old mutant mice [
25]. Hypermethylation of DDAH2 contributes to Hcy induced apoptosis of endothelial cells, which can be inhibited by epigallocatechin-3-gallate [
12,
13]. Therefore, modulating DNA methylation status of DDAH2 promoter may be a potential strategy for the treatment of endothelial dysfunction. In this study we demonstrated that DDAH2 promoter was hypermethylated in CAD patients, which may contribute to the downregulation of DDAH2 expression. Furthermore, the methylation level of DDAH2 was negatively correlated with adhesion ability of EPCs.
It has been demonstrated that Hcy level is a significant predictor of mortality, independent of traditional risk factors [
26,
27]. Hcy level was higher in CAD patients than in non-CAD and was inversely correlated with EPCs’ migratory capacity and ability to adhere to fibronectin [
28]. In vitro, Hcy reduced the number of EPCs via the induction of apoptosis accompanied by decreased functional activity, which could be reversed by atrovastatin [
29]. In this study, we found that plasma level of Hcy was higher in CAD patients than in controls, which was consistent with previous reports [
30,
31]. It will be interesting to elucidate the underlying mechanisms responsible for possible relationship between Hcy level and EPCs. Based on the results from CAD patients, we speculated that the effects of Hcy on EPCs may be mediated by the induction of methylation in DDAH2 promoter. We isolated EPCs from healthy volunteers and treated them with different concentrations of Hcy. We found that Hcy decreased the mRNA expression of DDAH2 in a dose dependent manner in EPCs, which can be inhibited by 5-Aza, the inhibitor of DNMT. Meanwhile, Hcy impaired the adhesion ability of EPCs and induced aberrant hypermethylation in DDAH2 promoter of EPCs. The effects of Hcy were attenuated by 5-Aza. Unfortunately, several limitations of this study should be pointed out. First, all these observations are based on cell culture system and may not reflect human condition. Therefore, further in vivo studies are needed to confirm our in vitro results. Second, our analysis of EPCs function focused only on the adhesion ability. Additional experiments to evaluate the effects of aberrant DDAH2 methylation on the migration and tube formation of EPCs will help better understand the significance of DDAH2 promoter hypermethylation.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interest
The authors declare that they have no competing interest.
Authors’ contributions
Conceived and designed the experiments: SJ. Performed the experiments: PN, YC, TG, JG. Analyzed the data: BZ. Wrote the paper: SJ. All authors read and approved the final manuscript.