Background
Multiple sclerosis (MS), a chronic autoimmune demyelinating disease of the central nervous system (CNS), is one of the most common acquired neurological diseases in young adults. The hallmarks of MS include neuroinflammation, caused by the migration of leukocyte infiltrates into the CNS, and loss of myelin and axonal damage [
1]. Disease progression is considered the result of two related processes, namely myelin destruction (demyelination) with failure to remyelinate [
2] and progressive axonal damage with little capacity for recovery [
3]. Remyelination is an endogenously regulated process orchestrated by the generation of new mature oligodendrocytes. These cells provide new myelin sheathes to demyelinated axons, promoting the recovery of axonal integrity and functional deficits [
4,
5]. Exacerbated innate and adaptative immune responses contribute to the physiopathology of the disease, and the majority of current therapies for MS are directed towards modulation of the immune response [
6]. However, novel therapies aimed to axonal remyelination are urgently needed.
Hypoxia preconditioning induced by mild oxygen depletion is beneficial in a wide number of neurological disorders including MS [
7,
8]. The cellular adaptation to severe or mild hypoxia is very fast and involves the activation of the hypoxia-inducible factor (HIF), an ubiquitous transcription factor that accumulates in response to hypoxia and regulates a plethora of genes involved in many biological processes including erythropoiesis, angiogenesis, vascular tone, and immunity [
9,
10].
HIF-1α activation may play a role in the inflammatory and the remitting phases of MS (reviewed by [
11]). For instance, HIF-1α may exert anti-inflammatory activity by inducing the release of TGFβ [
12,
13], a potent anti-inflammatory cytokine, and by upregulating the FoxP3 gene implicated in the differentiation of Tregs [
14]. In addition, there is evidence suggesting that activation of the HIF pathway may be also linked to neuroprotection and perhaps remyelination [
15]. Thus, the erythropoietin (EPO) gene is HIF-dependent, and EPO is neuroprotective in different animal models of MS [
16,
17]. In addition, methylprednisolone, a widely used glucocorticoid for treating MS, protects oligodendrocytes from excitotoxicity through a HIF-1α-dependent pathway [
18]. Indeed, HIF-1α stabilization protects oligodendrocytes against TNF-α-mediated cell death [
15].
On the other hand, HIF-1α activates several proangiogenic genes including vascular endothelial growth factor (VEGF-A) and fibroblast growth factor-2, which are mainly produced by vascular endothelial cells. The vascular endothelial cells produce trophic factors to maintain brain homeostasis within the context of the neurovascular unit [
19,
20]. Accordingly, signaling network acting between cerebral endothelium and neuronal precursor cells is responsible for sustaining neurogenesis and angiogenesis even in the adult brain [
19‐
24]. In the case of white matter, it has been proposed that a corresponding “oligovascular niche” may also exist, wherein cerebral endothelial cells promote the proliferation and migration of oligodendrocyte precursor cells (OPCs) [
25,
26]. OPC might recognize their path to migrate along the vasculature, and it has been shown recently that OPC-endothelial interaction occurs by Wnt-Cxcr4 signaling, at least in the developing CNS and in postnatal spinal cord [
27].
VCE-004.8 is an aminoquinone derivative of cannabidiol endowed with dual PPARγ and CB
2 activity [
28]. Both endpoints are druggable targets for MS, and we show here that VCE-004.8 also targets the HIF pathway, expanding the rationale for its development as a novel MS drug.
Methods
Cell lines and reagents
Murine RAW264.7 (ATCC® TIB-71™) and BV-2 cell lines were maintained at 37 °C in a humidified atmosphere containing 5% CO2 in DMEM supplemented with 10% fetal calf serum (FCS), 2 mM l-glutamine, and 1% (v/v) penicillin/streptomycin. Human brain microvascular endothelial cells (HBMEC) were maintained in endothelial cell medium (ScienCell, San Diego, CA, USA) supplemented with 5% FBS, 1% ECGS, and 1% penicillin/streptomycin. Human dermal microvascular endothelial cells (HMEC-1) (ATCC® CRL-3243™) were maintained in MCDB131 medium (Life Technologies, Carlsbad, CA, USA) supplemented with 10 ng/ml epidermal growth factor (EGF), 1 μg/ml hydrocortisone, 10 mM glutamine, and 10% FBS. The transformed human microglial cells (HMC3) (ATCC® CRL-3304™) were maintained in Eagle’s minimum essential medium supplemented with 10% FBS and 1% penicillin/streptomycin. Human oligodendrocyte cell line MO3.13 was obtained from Tebu-Bio (Barcelona, Spain) and was cultured in complete medium containing DMEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S) at 37 °C, 5% CO2. Cells were allowed to differentiate for 3 days further by replacing the complete medium with serum-free DMEM supplemented with 100 nM PMA and 1% P/S. Differentiated cells are positive for markers such as myelin basic protein (MBP) and myelin oligodendrocyte glycoprotein (MOG), which are phenotypic markers of mature, myelinating oligodendrocytes. The mouse NIH3T3-EPO-luc cells have been stably transfected with the plasmid Epo-Luc plasmid. The EPO-hypoxia response element (HRE)-luciferase reporter plasmid contains three copies of the HRE consensus sequence from the promoter of the erythropoietin gene in the pGL3 vector: recombinant mouse IL-17 (R&D Systems, Minneapolis, MN, USA), rmIL-4 (Immunotools GmbH, Friesoythe, Germany) and rhVEGF-A (Immunotools GmbH), and GW9662 (Cayman Chem, Ann Arbor, MI, USA) and SR144528 (Cayman Chem). All other reagents were from Sigma Co (St Louis, MO, USA).
M1 and M2 macrophage polarization assays
To study M1 differentiation induced by IL-17, serum-starved RAW264.7 macrophages were pre-incubated with VCE-004.8 for 18 h and exposed for an additional 24 h to recombinant mouse IL-17 (50 ng/ml) [
29]. To study the M2 polarization, serum-starved macrophages were treated with VCE-004.8 or rmIL4 (40 ng/ml) [
30] for 24 h. The cells were collected in PBS, and total RNA was extracted using the High Pure RNA Isolation Kit (Roche Diagnostics, Indianapolis, IN, USA).
Transient transfection and luciferase assays
For Arg-1 gene promoter analysis, RAW264.7 cells were seeded in 24-well plates, and after 24 h, they were transiently transfected with the plasmid pGL3-mArg1 (Addgene, Cambridge, MA, USA) using Roti-Fect (Carl Roth, Karlsruhe, Germany) following the manufacturer’s specifications. To correct for transfection efficacy, 100 ng Renilla luciferase (pRL-CMV) was co-transfected. After stimulation, the luciferase activities were quantified using Dual-Luciferase Assay (Promega Co., Madison, WI, USA). For EPO-Luc transactivation experiments, NIH-3T3-EPO-luc cells were stimulated as indicated and the luciferase activity measured in the cell lysates after 6 h stimulation.
Western blots
Cells were washed with PBS and proteins extracted in 50 μl of lysis buffer (50 mM Tris–HCl (pH 7.5), 150 mM NaCl, 10% glycerol, and 1% NP-40) supplemented with 10 mM NaF, 1 mM Na3VO4, 10 μg/ml leupeptine, 1 μg/ml pepstatin and aprotinin, and 1 μl/ml PMSF saturated. Thirty micrograms of proteins was boiled at 95 °C in Laemmli buffer and electrophoresed in 10% SDS/PAGE gels. Separated proteins were transferred to PVDF membranes (20 V for 30 min) and blocked in TBS solution containing 0.1% Tween 20 and 5% non-fat dry milk for 1 h at room temperature. Immunodetection of specific proteins was carried out by incubation with primary antibody against HIF-1α (1:1000; BD Biosciences, #610959 San Jose, CA, USA), HIF-2α (1:1000; Novus Biologicals, Littleton, USA), PHD1 (1:1000; Abcam, Cambridge, UK), PHD2 (1:1000; Abcam), PHD3 (1:1000; Abcam), OH-HIF-1α (1:1000; Cell Signaling, Danvers, MA, USA), PPARγ (1:1000), β-actin (1:10.000; Sigma), and arginase 1 (N20) (1:500; Santa Cruz, Dallas, TX, USA) overnight at 4 °C. After washing membranes, horseradish peroxidase-conjugated secondary antibody was added and detected by chemiluminescence system (GE Healthcare Europe GmbH).
HIF-1α hydroxylation assay
MO3.13 cells were transfected with HA-PHD1 (Addgene), HA-PHD2 (Addgene), or HA-PHD3 (Addgene) as indicated. After 24 h of transfection, cells were stimulated with VCE-004.8, CBD, or DMOG at the concentrations indicated for 24 h. After that, PHDs were immunoprecipitated as described [
31]. Recombinant human GST-HIF-1α protein (Abcam) and immunoprecipitated PHDs were incubated in the reaction buffer 50 mM Tris–HCl (pH 7.5), 1 mM DTT, 50 μM FeSO
4, 5 mM ascorbate, and 200 μM oxoglutarate for 1 h at 30 °C, respectively. The prolyl hydroxylation reaction was stopped by adding Laemmli sample buffer and analyzed by immunoblot assays.
Quantitative reverse transcriptase PCR
Total RNA (1 μg) was retrotranscribed using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) and the cDNA analyzed by real-time PCR using the iQTM SYBR Green Supermix (Bio-Rad) and a CFX96 Real-time PCR Detection System (Bio-Rad). GAPDH or HPRT genes were used to standardize mRNA expression in each sample. Gene expression was quantified using the 2−ΔΔCt method, and the percentage of relative expression against controls (untreated cells or mice) was represented. The primers used in this study are described in Table
1.
Table 1
Primers used in real-time PCR analysis
TNF-α | CTACTCCCAGGTTCTCTTCAA | GCAGAGAGGAGGTTGACTTTC |
IL-6 | GTATGAACAACGATGATGCACTTG | ATGGTACTCCAGAAGACCAGAGGA3 |
CCL2 | GGGCCTGCTGTTCACAGTT | CCAGCCTACTCATTGGGAT |
CCL4 | AGAAACAGCAGGAAGTGGGA | AACACCATGAAGCTCTGCGT |
Arg-1 | CTCCAAGCCAAAGTCCTTAGAG | AGGAGCTGTCATTAGGGACATC |
Mrc1 | CATGAGGCTTCTCCTGCTTCTG | TTGCCGTCTGAACTGAGATGG |
IL-10 | GGTTGCCAAGCCTTATCGGA | ACCTGCTCCACTGCCTTGCT |
VEGF-A | CGAAGTGGTGAAGTTCATGGATG | TTCTGTATCAGTCTTTCCTGGTG |
EPO | CTCCGAACAATCACTGCT | GGTCATCTGTCCCCTGTCCT |
GAPDH | TGGCAAAGTGGAGATTGTTGCC | AAGATGGTGATGGGCTTCCCG |
HPRT | ATGGGAGGCCATCACATTGT | ATGTAATCCAGCAGGTCAGCA |
PCR arrays
One microgram of RNA was transcribed to cDNA using the RT2 First-Strand Synthesis Kit (Qiagen, Hilden, Germany) and analyzed using the RT2 SYBR green qPCR master mix (Qiagen) and the Human Hypoxia Signaling Pathway Plus PCR array (Qiagen) in the case of HBMEC cell line studies. The expression profile of key genes involved in multiple sclerosis was studied using the Mouse Multiple Sclerosis RT2 Profiler PCR Array (Qiagen). Each array consists of 84 genes involved in hypoxia- or multiple sclerosis-related signaling, as well as 12 sequences to control for loading and cDNA quality. The fold change in gene expression was calculated using the 2−ΔΔCt method and five housekeeping genes for normalization following the manufacturer’s instructions. Each array was performed in triplicate.
Determination of vascular endothelial growth factor (VEGF)
HMEC-1 and MO3.13 cells were treated with VCE-004.8 for 24 h. The culture supernatants were then collected and analyzed for VEGF by ELISA. The levels of VEGF were quantified with a Quantikine ELISA Human VEGF kit (R&D Systems, according to the manufacturer’s instructions.
Angiogenesis assay
The angiogenesis assay with HUVEC cells was performed using the PrimeKit cryo (Essen Biosciences, Ann Arbor, MI, USA). Briefly, HUVEC CytoLight Green cells were co-cultured with Human Dermal Fibroblasts (NHDF) in 96-well plates and treated with VCE-004.8 or VEGFA for 7 days, and the tube formation process was monitored using integrated IncuCyte algorithms. The Matrigel assay was used to assess the formation of capillary-like structures in HBMEC. The cells were seeded over a uniform layer of Matrigel (Thermo Fisher Scientific, Waltham, MA, USA) in a 96-well plate in the presence of VEGFA (10 ng/ml) or VCE-004.8 (1 μM). After 5 h of treatment, tube formation was analyzed using a × 4 objective and a BD Pathway 855 Bioimager. ImageJ v1.45 software (
http://rsbweb.nih.gov/ij/) was used to quantify the number of branches points of tubes.
In vitro cell migration assays
The modulation of cell migration was analyzed by wound-healing assays. Briefly, MO3.13 cells were seeded in a 96-well Essen ImageLock plate (Essen BioScience) and were grown to confluence. After 24 h, the scratches were made using the 96-pin WoundMaker, followed by incubation of the cultures with rhVEGF (10 ng/ml) or conditioned media from HBMECs cells treated during 24 h with VCE-004.8 in the presence of 10 ng/ml of mitomycin C to block cell proliferation. Wound images were taken every 60 min for 18 h and the data analyzed by the integrated metric Relative Wound Density part of the live content cell imaging system IncuCyte HD (Essen BioScience).
PGE2 release measurement in primary microglia cells
Rat microglial cells were purified from forebrains and cultured as previously described [
32]. Cells were seeded on poly-
d-lysine-coated plaques at a density of 50,000 cells/cm
2 and maintained for 3 days in DMEM containing 5% horse serum. Then, the cells were incubated for 18 h with 0.5 μg/ml LPS, in the presence of different concentrations of VCE-004.8, and supernatants were collected. Supernatants were spun down at 2000 rpm for 10 min, 4 °C. PGE2 in microglia was analyzed and quantified by using the prostaglandin E2 EIA Kit (Cayman chemicals) following provider recommendations.
Animals
All experiments were performed in strict accordance with EU and governmental regulations. The Ethics Committee on Animal Experimentation of the Instituto Cajal, Consejo Superior de Investigaciones Científicas (CSIC), approved all procedures described in this study. Handling of animals was performed in compliance with the guidelines of animal care set by the European Union guidelines 86/609/EEC, and the Ethics Committee on Animal Experimentation at the Cajal Institute (CSIC, Madrid) approved all the procedures described in this study (protocol number 96 2013/03 CEEA-IC). Measures to improve welfare assistance and clinical status as well as endpoint criteria were established to minimize suffering and ensure animal welfare. Briefly, wet food pellets are placed on the bed cage when the animals begin to develop clinical signs to facilitate access to food and hydration. Female C57BL/6 and SJL/J mice were purchased from Harlan (Barcelona, Spain) and housed in the animal facilities of the Cajal Institute under the following controlled conditions: 12-h light/dark cycle, temperature 20 °C (± 2 °C), and 40–50% relative humidity with free access to standard food and water.
Determination of erythropoietin (EPO) induction in vivo in normal mice
Eight-week-old C57BL/6 male mice (Envigo, Barcelona, Spain) were dosed intraperitoneally (i.p.) with VCE-004.8 (10 mg/kg) for 3 weeks. Blood samples were taken under general anesthesia, and heparin plasma was collected. Samples were centrifuged for 20 min at 2000×g within 30 min of collection, and circulating levels of plasma EPO were quantified with a mouse EPO ELISA kit (R&D Systems) according to the manufacturer’s instructions. EPO values represent the mean ± SEM.
Induction and assessment of EAE
EAE was induced in C57BL/6 female mice at 6–8 weeks of age by subcutaneous immunization with MOG35–55 (300 μg; peptide synthesis section, CBM, CSIC, Madrid, Spain) and 200 μg of Mycobacterium tuberculosis (H37Ra Difco, Franklin Lakes, NJ, USA) in a 1∶1 mix with incomplete Freund’s adjuvant (CFA, Sigma, #F5506). On the same day and 2 days later, mice were injected intraperitoneally (i.p.) with 200 ng of pertussis toxin (Sigma) in 0.1 ml PBS. Control animals (CFA) were inoculated with the same emulsion without MOG, and they did not receive pertussis toxin. Treatment started at day 8 post-immunization when animals showed the first symptoms of the disease and consisted in daily i.p. of VCE-004.8 (10 mg/kg) or vehicle alone (4% DMSO + 6.4% Tween 80 + phosphate-buffered saline) for the following 21 days (curative protocol). The mice were examined daily for clinical signs of EAE, and disease scores were measured as follows: 0, no disease; 1, limb tail; 2, limb tail and hind limb weakness; 3, hind limb paralysis; 4, hind limb and front limb paralysis; and 5, moribund and death. All animals were sacrificed at 28 days for further analysis.
Theiler’s virus inoculation and clinical evaluation
TMEV-induced demyelinating disease (TMEV-IDD) was performed in SJL/J mice. Theiler’s virus (strain DA), given by Dr. Moses Rodriguez (Mayo Clinic, Rochester, NY, USA), was inoculated intracranially in the right cerebral hemisphere, with 2 × 106 plaque forming units (pfu) in 30 μl of DMEM medium enriched with 5% fetal calf serum (FCS). Sham mice were inoculated with vehicle only (DMEM + 5% FCS). Sixty days after TMEV infection, mice were treated daily for 14 consecutive days with VCE-004.8 (10 mg/kg i.p.) or appropriate vehicle (4% DMSO + 6.4% Tween 80 + phosphate-buffered saline) (curative protocol). General health conditions and motor function of animals were periodically evaluated, from day 60, when animals showed their locomotor activity impaired, until day 75 post-infection. The screening for locomotor activity (LMA) was performed using an activity monitor system coupled to a Digiscan Analyser (Omnitech Electronics, Columbus, OH, USA). The data for the following variables of LMA for a session of 10 min were collected: horizontal activity, as the total number of beam interruptions of horizontal area sensors, and vertical activity, as the total number of beam interruptions in the vertical sensor.
Tissue processing
Mice were anesthetized by i.p. administration of pentobarbital (50 mg/kg), and they were transcardially perfused with saline 0.9%. The spinal cord was obtained by extrusion with saline. Cervical spinal cord was immediately frozen and kept at − 80 °C for RT-PCR analysis; the remaining spinal cord was fixed in 4% paraformaldehyde in 0.1 M PBS, washed in 0.1 M PBS, cryoprotected with a 15% and then a 30% solution of sucrose in 0.1 M PBS, and frozen at − 80 °C. Free-floating thoracic spinal cord sections (15/30 μm thick: Leica Microsystems CM1900 cryostat, Barcelona, Spain) were then processed for immunohistochemistry.
Immunohistochemistry
For immunofluorescence analysis, free-floating thoracic spinal cord sections were washed with 0.1 M PBS. Endogenous peroxidase activity was inhibited with 50% methanol and 1.66% hydrogen peroxide. The sections were blocked with 0.1% Triton X-100 and 5% animal serum and then incubated overnight at 4 °C in blocking buffer with the primary antibody. For IHC in 30-μm sections, microglia cells were stained with a rabbit anti-mouse Iba-1 antibody (1∶1000; Wako Chemical Pure Industry, Osaka, Japan) and a primary rat anti-mouse CD4 antibody (1∶1000; BD Pharmingen; San Diego, CA, USA) was used to detect CD4+ T cells (sections of 30 μm thick). In 15-μm sections, axons were stained with a neurofilament H antibody (1∶1000; Millipore; Temecula, CA, USA). After incubation with the primary antibody, the sections were rinsed with PBS three times for 10 min and then incubated for 1 h with the secondary antibody: biotinylated goat anti-rabbit (Iba-1), fluorescent goat anti-rabbit (neurofilament H), and biotinylated rabbit anti-rat (CD4). Myelin integrity was analyzed using the Hito CryoMyelinStain™ Kit (Gold phosphate complex Myelin Staining Kit) following manufacturer’s recommendation (Hitobiotech Corp., Kingsport, TN, USA).
Inflammatory infiltrate analysis
Spinal cord slices were stained with hematoxylin-eosin (H&E) to analyze the infiltrates in the parenchyma. Inflammatory infiltrates were evaluated on a scale of 0 to 4, the score reflecting the number of infiltrates in the thoracic spinal cord sections. A score of 4 reflects the largest number of infiltrates with all the intermediate scores (1, 2, and 3) to define the increase in the density of infiltrates in the spinal cord tissue.
Microscopy and image analysis
Six thoracic spinal cord sections per animal from at least six animals per group were taken. Staining was quantified using the ImageJ software (NIH; Bethesda, MD, USA). Sections were analyzed by immunofluorescence on a Leica TCS SP5 confocal microscope and with a Zeiss Axiocam high-resolution digital color camera for IHC.
Data analysis
All the in vitro data are expressed as the mean ± SD. One-way ANOVA followed by the Tukey’s post hoc tests or unpaired two-tailed Student’s t test were used to determine the statistical significance. All the in vivo data are expressed as the mean ± SEM. Unpaired two-tailed Student’s t test for parametric analysis of two samples or Kruskal–Wallis test was used to determine the statistical significance in the case of non-parametric analysis. The level of significance was set at p < 0.05. Statistical analyses were performed using GraphPad Prism version 6.00 (GraphPad, San Diego, CA, USA).
Discussion
Natural products, including phytocannabinoids, have been successfully used for the development of semisynthetic derivatives with improved bioactivities and clinical profile compared to the parent lead structure [
35]. Thus, cannabidiol (CBD) is a poor PPARγ agonist, unable to bind CB
2 and to activate the HIF pathway [
36‐
38], but oxidation of its resorcinol core to a quinoid system increases PPARγ binding, while the introduction of an additional nitrogen substituent, a benzylamino group in VCE-004.8, improves stability and induces CB
2 binding [
28,
36]. We have now discovered that these modifications also induce hypoxia mimetic activity in VCE-004.8 and that the overall bioactivity profile of this compound is endowed with significant potential of development for the management of MS.
The mechanism by which O
2 controls HIF-1α and HIF-2α stabilization has been revealed by the identification of PHDs, which are non-heme iron-containing dioxygenases requiring molecular oxygen and 2-oxoglutarate to hydroxylate HIF-1α and HIF-2α [
10]. Under normoxic conditions, hydroxylated HIF is ubiquitinated by an E3-ubiquitin ligase and prepared for degradation by the 26S proteasome [
39]. The development of PHDs inhibitors for the treatment of a wide number of diseases has recently attracted considerable attention [
10,
40,
41]. We have discovered that the semi-synthetic cannabinoid VCE-004.8 inhibits HIF-1α hydroxylation and the activity of PHD1 and PHD2. VCE-004.8 is endowed with structural features typical of iron chelators, like the hydroxy- and the aminoenone motifs, but, surprisingly, we found that VCE-004.8 does not mimic the activity of the ion chelator DFX in vitro assays of PDH2 activity (data not shown). It has been described that PHDs may also undergo posttranslational modifications affecting their activity. For instance, PHD1 is phosphorylated in serine 130 by cyclin-dependent kinases 2, 4, and 6, and PHD2 is phosphorylated at serine 125 by P70S6K [
42,
43], and VCE-004.8 could modulate these processes, a working hypothesis for currently ongoing activities. On the other hand, the pleiotropic profile of this compound towards some important endpoints of clinical research on MS prompted us to investigate if VCE-004.8 could indeed qualify for further development in this therapeutic area.
Microglial activation has been studied extensively in MS patients and in animal models. In addition, infiltrating proinflammatory macrophages (M1) have also been identified as major effectors of demyelination in MS, with the requirement for lymphocytes being in some cases negligible and macrophages being the sole mediators of demyelination [
44]. Conversely, M2-polarized macrophage/microglia promote neuronal survival, neurite outgrowth, and OPC differentiation [
45‐
48]. We found that VCE-004.8 blunts M1 polarization, an observation in agreement with previous reports showing that PPARγ and CB
2 ligand activators inhibited M1 polarization [
29,
49]. However, VCE-004.8 failed to induce a complete M2 polarization in the presence of IL-4, rather strongly upregulating the expression on Arg-1. This is a surprising finding, since PPARγ ligands affect macrophage M2 differentiation [
49]. A possible explanation is that VCE-004.8, by acting as a partial PPARγ agonist, induces a different gene expression profile compared to full PPARγ agonists like glitazones [
28,
50]. It is also possible that, by activating HIF-1α, VCE-004.8 may block full M2 differentiation, allowing only the expression of Arg-1 through HIF-2α, which is also stabilized in VCE-004.8-treated microglia cells [
34,
51]. Arg-1 and inducible NO synthase (iNOS) are arginine-metabolizing enzymes that compete for the use of
l-arginine and exert opposite functions in different pathological conditions including MS [
52‐
54]. In addition, arginase activity is increased in plasma of MS patients responding to interferon-β1b therapy [
55]. VCE-004-8-induced Arg-1 activity might therefore counteract the proinflammatory effects of iNOS. Interestingly, it has recently been shown the existence of a crosstalk pathway between
l-arginine and the
l-tryptophan pathway that plays an important role in the pathogenesis of MS.
l-tryptophan is metabolized by indoleamine 2–3 dioxygenase 1 (IDO-1), whose activity in dendritic cells is strictly dependent on Arg-1 expression [
56]. Thus, it is possible that Arg-1 upregulated by VCE-004.8 could induce tolerogenic dendritic cells (tDC) in the CNS through IDO-1 activation. tDC are being investigated in clinical trials for the treatment of several autoimmune diseases including MS [
57]. Interestingly, it has been shown that hypoxia upregulates IDO-1 expression in the hippocampus [
58]. Therefore, the potential role of VCE-004.8 on IDO-1 activation and the induction of tDC through
l-tryptophan metabolism warrants further research.
Previous studies have shown that HIF-1α is also implicated in T cell differentiation and function. Indeed, HIF-1α enhances Th17 differentiation by activating the retinoid-related orphan receptor γt that interacts with p300 to induce the transcriptional activity of the IL-17 promoter [
59]. However, another study has shown that pharmacological activation of the HIF pathway promotes the differentiation of Treg cells [
60]. Indeed, CB
2 and PPARγ ligand activators have both been reported to inhibit Th17 differentiation in the EAE model and in peripheral T cells from MS patients, respectively [
61,
62]. Our results showed that IL-17 gene expression is induced in the spinal cord of EAE mice and is inhibited by the treatment with VCE-004.8. In addition, VCE-004.8 could inhibit CD3-induced IL-17 promoter transactivation in T cells (unpublished results), making it possible that CB
2/PPARγ may abrogate the effect of HIF-1α on Th17 cell differentiation.
Therapeutic anti-inflammatory strategies for the treatment of MS involve neutralization of molecules involved in chemotaxis, adhesion, and migration of inflammatory cells to the CNS. The immunomodulatory activity of VCE-004.8 in EAE and TMEV mice was evidenced by the inhibition of several inflammatory chemokines (
Ccl12,
Ccl3,
Ccl5,
Cxcl10,
Cxcl11, and
Cxcl9), chemokines receptors (
Ccr1,
Ccr5, and
Cxcr3), and cytokines (
Infg,
Il1b,
Il6,
Tnf, and
Il17). In addition, VCE-004.8 inhibited the expression of adhesion molecules such as VCAM and ICAM-1. Chemokines and their receptors are essential for monocyte and lymphocyte migration into the CNS and therefore play a key role in the pathogenesis of MS. We have previously shown that WIN 55,212-2, a CB
1/CB
2 agonist, inhibited ICAM-1 and VCAM-1 expression in brain endothelial cells acting partially through the PPARγ pathway [
63]. Therefore, it is likely that the potent anti-inflammatory activity of VCE-004.8 is mediated by the modulation of CB
2 and PPARγ.
VEGF is a prototypical neurovascular signal that regulates vascular and neuronal functions. This factor has multiple direct beneficial effects on various neural cell types including OPCs and oligodendrocytes [
64]. However, VEGF is a double-edged sword in MS and in other diseases like neuromyelitis optica and macular degeneration [
64]. Thus, low levels of VGEF are necessary for endothelial cell survival and integrity of the blood-brain barrier (BBB), but high levels induce BBB dysfunction and are detrimental for CNS vascular homeostasis. Accordingly, blocking the aberrant expression of VEGF in EAE reduces neuroinflammation and demyelination and suppresses angiogenesis [
65]. Dissociation of the neurogenic and neuroprotective activities of VEGF from its effects on vascular permeability might represent a therapeutic avenue for the development of novel therapies for the treatment of different MS subtypes [
11]. It is therefore remarkable that VCE-004.8 induced VEGF secretion by oligodendrocytes and brain vascular endothelial cells without any apparent sign of BBB dysfunction in EAE and TMEV mice. The VEGF effects on BBB disruption could be prevented by EPO, which is also induced by VCE-004.8 [
66,
67]. Moreover, VCE-004.8-mediated PPARγ activation may also contribute to maintain BBB integrity, since PPARγ agonists protect the BBB in models of brain stroke [
68]. Indeed, it has been shown that CBD, the precursor of VCE-004.8, prevents BBB dysfunction through a PPARγ-dependent pathway [
69]. Last, we cannot discard the view that VCE-004.8, as HIF PHDs inhibitor, may also induce the expression of endogenous VEGF-B and the spliced isoform VEGF
165b that are non-angiogenic but retains the neuroprotective activity of VEGF [
70].
Also remarkable is our finding that VCE-004.8 strongly induced the expression of other HIF-dependent genes beneficial for MS, like adrenomedullin (
Adm), in HBMEC.
Adm is important in endothelial cell survival and regulation of BBB permeability, is protective towards white matter, modulates oligodendrocytes function, and exerts an overall protective activity on EAE [
71‐
73]. Angiopoietin-like 4 (
Angptl4) and
N-myc downregulated gene 1(
Nrdg1) were upregulated by 145.6- and 25.2-fold, respectively, in VCE-004.8-treated cells. Angptl4 modulates BBB dysfunction in ischemic stroke and is neuroprotective [
74]. On the other hand, Nrdg1 plays a role on oligodendrocytes survival and the gene is methylated and represses in the normal-appearing white matter of postmortem MS patients [
75].