Parainfluenza virus is an important pathogen threatening the health of animals and human, which brings human many kinds of disease, especially lower respiratory tract infection involving infants and young children. In order to control the virus, it is necessary to fully understand the molecular basis resulting in the genetic diversity of the virus. Homologous recombination is one of mechanisms for the rapid change of genetic diversity. However, as a negative-strand virus, it is unknown whether the recombination can naturally take place in human PIV. In this study, we isolated and identified a mosaic serotype 3 human PIV (HPIV3) from in China, and also provided several putative PIV mosaics from previous reports to reveal that the recombination can naturally occur in the virus. In addition, two swine PIV3 isolates transferred from cattle to pigs were found to have mosaic genomes. These results suggest that homologous recombination can promote the genetic diversity and potentially bring some novel biologic characteristics of HPIV.
The online version of this article (doi:10.1186/1743-422X-8-58) contains supplementary material, which is available to authorized users.
Hui-Ting Yang, Qing Jiang contributed equally to this work.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
YHT, and JQ carried out sequence collection, alignment and recombination analysis and drafted the manuscript. ZX and BMQ provided LZ22 viral sequence information. SHL participated in sequence collection. WXJ, LY, ZH participated in revision of manuscript. HHB participated in its design and coordination. And HCQ designed the study and wrote the manuscript. All authors read and approved the final manuscript.
Introduction
Human parainfluenza virus (HPIV) is known to induce acute respiratory infections (ARI) including lower respiratory tract infection, which is a leading cause of morbidity and mortality in infants and young children [1, 2]. Until now, four serotypes of parainfluenza virus (PIV) infecting human being have been found. Especially, human PIV (HPIV) 1, 2 and 3 are the second leading causative agents of pediatric hospitalizations due to respiratory disease following respiratory syncytial virus (RSV) [3]. It is important to know the mechanism resulting in genetic and antigenic diversity of HPIV for controlling the pathogen.
As one member of the Respirovirus ge nus of the family Paramyxoviridae, HPIV is an enveloped non-segmented negative single-stranded RNA virus [4]. RNA viruses usually exhibit genetic variation, which can be attributed to their high rate of mutation during their replication process and the large population size [5]. In addition, homologous recombination has been recognized increasingly as a potentially important means of generating and shaping genetic diversity in positive strand RNA virus [6]. In several other members of the Paramyxoviridae family, Newcastle disease virus (NDV) [7‐11] and human respiratory syncytial virus [12], natural recombinants have been detected. Moreover, attenuated vaccines were found to be able to influence the evolution process of NDV through exchanging their genetic material with circulating virus [7, 9, 11]. For HPIV, it is unknown whether there is natural recombinant virus circulating in the field.
Anzeige
In this study, we isolated and identified a natural type 3 HPIV mosaic isolate LZ22/FJ455842 (with a mosaic N gene) to show that homologous recombination can occur in HPIV3. Additionally, three HPIV1 isolates (HT88/U01082, HT89a/U01083 and HT89c/U01085) were found to be deposited in previous report. Interestingly, we also found that there were the two Swine PIV3 recombinants with mosaic L protein were thought to be associated with an cross-species infection in previous report [13, 14]. Collectively, these recombination events suggested that homologous recombination played a role in HPIV genetic diversity and rapid evolution.
Results and Discussion
The sequence of LZ22 complete genome has been deposited in GenBank (Access Number, FJ455842). And the PIV3 complete genome sequence alignment dataset was analyzed employing RDP3 software package for scanning the recombinant sequence. And the isolate LZ22 was found to have greatly strong recombination signal: RDP, p-value < 10-21; GENECOVY, p-value < 10-21, Bootscan, p-value < 10-20, MaxChi p-value < 10-3; Chimaera p-value < 10-7; Siscan, p-value < 10-8, 3Seq, p-value < 10-13. And a breakpoint was located at position 485. Two strains GP and ZHYMgz01 were suggested as representatives of its putative parent lineages.
And then, Simplot software package was used to determine the recombination event [15]. Employing the Findsites subprogram of SimPlot, one potential breakpoint was located at parsimonious regions with the maximization of χ2, from positions 485 to 615 (χ2 = 122.3, P < 0.0001 of Fisher's exact test). A similarity plot (Figure 1A) which was constructed by using all sites, revealed that the sequence of LZ22 showed greater affinity with one putative parent lineage of GP in the region from position 1 to 485 than the other putative parent ZHYMgz01 (100% versus 94%). However, sequence from positions 486 to 15536, ZHYMgz01 shared greater similarity with LZ22 than GP (98% versus 95%). P value (Fisher's Exact Test) and χ2 value of the breakpoint were shown on the vertical line in Figure 1. The identical evidence also appeared in BootScanning result (Figure 1B). The region from GP lineage spanned the amino terminal 1/3 of the N protein approximately.
×
At last, The phylogenic trees were also constructed using Mega 4 to determine the recombination events [16]. From positions 1 to 485, LZ22 and GP were clustered into the same sublineage with 98% bootstrap value, while ZHYMgz01 was grouped into distinct sublineage (Figure 2A). But, in the other portion, the arrangement of the phylogenetic tree reflecting the relationship of the three isolates was in contrast with the previous one (Figure 2B). The topology of the two phylogenetic trees around the breakpoint showed a significant statistic discrepancy when the mosaic was included in analyzed data (Shimodaira-Hasegawa test, P < 0.001), constituting a powerful evidence for recombination.
×
Anzeige
The minor putative parent of LZ22 was isolated from Japan, suggesting the existence of a global reservoir of HPIV with local subreservoirs supporting extensive levels of virus circulation, which permitted co-infection and resulted in the recombination event at last. The potential breakpoint 485 presents in gene N coding nucleoprotein spanning the region from positions 56 to 1737 of genomic sequence [17]. In the previous study, viable artificial chimeric HPIV3 recombinants were constructed, which contained the nucleoprotein open reading frame (ORF) from either BPIV3 Kansas or shipping fever (SF) strain in place of the HPIV3 N ORF. The artificial recombinant (PIV3) in which the nucleocapsid N protein had been replaced by that of bovine PIV3 was found to be attenuated in primates [18]. Here, we isolated a HPIV3 with a natural mosaic in NP ORF. Interestingly, before the breakpoint, the similarity of peptide sequences was up to 98.5% (129/131) although the similarity of gene sequences was only 94% between the two putative parent lineages. It is unknown whether the recombination in N gene is also associated with their adaptation in host cell via a changed virulence.
In addition, since there has been no report to show homologous recombination can take place between PIVs before this study; we analyzed 55 isolates (Table 1) from GenBank in order to determine to what degree genetic diversity of the virus is affected by the homologous recombination. Five additional mosaic PIV sequences were detected through the analysis of sequences from isolates characterized in previous reports:, HT88 (U01082) [19], HT89a [19] (U01083), HT89c (U01085) [19], 81-19252_Texas-81 (EU439429) [13, 14] and 92-7783_ISU-92 (EU439428) [13, 14] (Table 2). Two HN gene mosaics, HT88 and HT89a shared the same recombination event (Table 2), suggesting they descended from the same mosaic ancestor. Please also refer additional files 1, 2, 3, and 4 for the detail recombination information of each mosaic strain. These results suggested that homologous recombination did play a potential role in the evolution of the virus.
*Z-score and p values were calculated with the highest P = 0.01 by using SiScan program in RDP [28]
**HN genes of HT88, HT89a and HT89c were only analyzed. The positions of breakpoints indicated the relative sites in HN gene.
Interestingly, two mosaic viruses 81-19252_Texas-81 (U439429) and 92-7783_ISU-92 (EU439428) were reported to be involved in a cross infection between swine and bovine [13, 14]. Both of the isolates had a mosaic L gene. The transcription and replication functions of the parainfluenza virus are associated with the large RNA polymerase protein. Additionally, polyadenylation, and RNA editing activities have to do with L protein [20]. The two putative mosaics were isolated from pigs in the United States [13, 14] while both of their putative parent lineages (Shipping fever and 910N lineages) belonged to BPIV3. Viruses are largely species-specific with respect to their host and usually do not cross species boundaries [5]. Recombination processes will allow some viruses to acquire many of the key adaptive mutations in a single step, and thus make a major leap in fitness, which might result in a change of host tropism [21]. It might be necessary to further study whether the recombination event is relative to the BPIV3 cross-species infection.
In conclusion, this study provides the potential evidence that there is mosaic PIV in the field. Our observations show that homologous recombination is a molecular mechanism of PIV genetic diversity and evolution. Therefore, this study might be important for knowing the genetic basis resulting in the rapid change of PIV biologic characteristics.
Material and methods
Virus and sequencing
The virus LZ22 was isolated from lower respiratory tract of a patient infant with pneumonia in Lanzhou, Gansu Province of China in 2003. The virus was identified using previously described protocols [22]. After isolated, LZ22 was also purified 3 times by the plaque forming method in Vero cells. Before sequencing, LZ22 was passaged 13 times and amplified in Vero cells for RT-PCR. Viral RNA was extracted from Vero cell virus cultures using RNAeasy mini kit (Qiagen, Netherlands) following the manufacturer's instructions. Reverse transcription was performed using SuperScriptΠ one-step RT-PCR platinum Taq HiFi kit (Invitrogen, USA). 3' and 5' RACE were performed using 5'-full RACE CORE kit and 3'-RACE kit (Takala Dalian) to analyze the 3' and 5' UTR sequences. The primers of PCR and 3' and 5' RACE used in this study were listed in Table 3. The full genome of LZ22 was amplified and sequenced referring to previous report [22]. All PCR products were cloned into pGEM-T-vector (Promega USA) and sequenced by Takara Biotechnology (Dalian, China).
Table 3
Primers for sequencing of genome of HPIV-3 LZ22 strain
Fragment
(Positions)
Primer
(5'-3')
Sequence
NP
NPS
ACCAAACAAGAGAAGAGACTTGTTTGG
(1-1843)
NPA
TTCCTCTTCCCAAGAATCCATGATTTG
PP
PPS
GGACGAAATAGACGATCTGTTCAATGC
(1616-3485)
PPA
CTGTTCATTGACTTTGAGTGGTAATGG
M
MS
TCACTAGTTGCAGTCATCAACAACAGC
(3452-5183)
MA
CCCTTTGGGACTATTGACCAATACACC
F
FS
TGCAATTTTCCAACCTTCTTTACCTGG
4724-7104)
FA
AAGAAGCCTTGTATTCACTCCTGACTG
HN
HNS
AAATCGAGTGGATCAAAATGATAAGCC
(6644-8744)
HNA
TGTGTAATTGTGCTATTCTACCTTTAACG
L1
L1S
TGTTCAAAACAGAGATTCCAAAAAGCTGC
(8489-10684)
L1A
TCCAAATAGAGCCGTTGATTCATATCTCC
L2
L2S
CTGGAGATATGAATCAACGGCTCTATTTG
(10654-12958)
L2A
AATTGCATGTATAATGTCAGTATCATCCC
L3
L3S
TATTGGGATGATACTGACATTATACATGC
(12926-15461)
L3A
ACCAAACAAGAGAAGAACTCTGCTTGGTA
3'RACE (617)
S
TTGAACATAGAGCACAGACTGG
A*
TACCGTCGTTCCACTAGTGATTT
(399)
Sn
GCTGATACGGATTCAGATTCATTCAAATTATC
An*
CGCGGATCCTCCACTAGTGATTTCACTATAGG
5'RACE
S*
CATGGCTACATGCTGACAGCCTA
(15088)
A
AATAGCTCCTAAACATGATGGATACCC
Sn
CGCGGATCCACAGCCTACTGATGATCAGTCGATG
(15423)
An
TGACATCTGCATTACTTCCATTTGTTGTTAGG
*Primers were supplied by manufacturer
Recombination analysis
Compete genome and HN gene of PIV were retrieved from GenBank and aligned with CLUSTALW [23]. PIV3 compete genome and HPIV1 HN genes sequences analyzed in the study were listed in Table 1. Phylogenetic Neighbor-Joining (NJ) trees were set up by MEGA4 [16]. The nucleotide substitution models were optimized for Maximum-Likelihood (ML) trees employing jmodeltest (version 0.1.1) [24]. ML trees were constructed employing Phyml software with nucleotide substitution model of general time reversible model (GTR) and gamma distributed 4 (G4) [25], and displayed as graphics by using MEGA4 to determine the topology of each tree. Identification methods of homologous recombination were described as previous report [26, 27]. Briefly, the sequence alignment files were sought for potential mosaic isolates using RDP software package [24, 28]. The gene sequence similarity of mosaics and their putative parents were compared and displayed as graphics with Simplot software [15]. At last, incongruent phylogenetic relations of different gene regions delimited by crossover point were determined by phylogenetic trees.
Acknowledgements
We would like to thank Prof. Elankumaran S for the detailed information of the two mosaic isolates 81-19252_Texas-81 (EU439429) and 92-7783_ISU-92 (EU439428); and the anonymous reviewers for helpful comments. This work was supported by a Project of Shandong Province Higher Educational Science and Technology Program (J09LCD209-12) and a Shangdong Province Young and Middle-Aged Scientists Research Awards Fund (BS2009NY011) to H.C.Q. State Scientist in Industrial Technology System of Dairy Cattle (H.H.B), Taishan Scholar and Distinguished Experts from overseas (H.H.B), A Major Application of Technological Innovations of Agriculture of Shandong Province (H.H.B).
Open Access
This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License (
https://creativecommons.org/licenses/by/2.0
), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
YHT, and JQ carried out sequence collection, alignment and recombination analysis and drafted the manuscript. ZX and BMQ provided LZ22 viral sequence information. SHL participated in sequence collection. WXJ, LY, ZH participated in revision of manuscript. HHB participated in its design and coordination. And HCQ designed the study and wrote the manuscript. All authors read and approved the final manuscript.
Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.
Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.
Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.
Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.
Update Innere Medizin
Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.