Identification of a novel mechanism of action of fingolimod (FTY720) on human effector T cell function through TCF-1 upregulation

Peripheral venous blood was collected after obtaining informed consent from healthy individuals and multiple sclerosis patients. All patients were seen at the Partners Multiple Sclerosis Center at Brigham and Women’s Hospital. We included untreated RR multiple sclerosis patients and patients treated with FTY720 before and after 3 months of treatment. Patients were classified based upon their clinical characteristics as defined by 2010 Revisions to the McDonald Criteria [25] with the help of trained neurologists. Untreated multiple sclerosis patients had received no treatment with glatiramer acetate or interferons in the past 3 months, no treatment with other disease-modifying therapy in the past 6 months, and no steroids in the past month. Detailed characteristics of these patients are shown in Additional file 1: Table S1. Blood samples were collected under the Comprehensive Longitudinal Investigation of Multiple Sclerosis at Brigham and Women’s Hospital (CLIMB). This study was conducted in accordance with the WMA Declaration of Helsinki regarding ethical principles for medical research involving human subjects. The Partners Human Research Committee/Instutional Review Board approved the use of human material (IRB protocols 1999P010435/BWH and 2012P000394).

Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Hypaque density gradient centrifugation (Pharmacia LKB Biotechnology, Piscataway, NJ). Naïve T cells from PBMCs were isolated using a Miltenyi Biotec (Alburn, CA) negative selection kit. Purified naïve CD4+ T cells were activated with plate-bound anti-CD3 (5 μg/ml, BD Bioscience, San Jose CA), soluble anti-human CD28 (1 μg/ml, BD Bioscience), and IL-2 (20 ng/ml, R&D Systems) with or without FTY720 (100 ng/ml, Novartis). After 6 days, cell-free culture supernatants were collected for cytokine analysis by Luminex assay (Miltenyi Biotec), and cells were harvested for RNA extraction and intracellular staining. Naïve T cells were stimulated with PMA (Sigma), ionomycin (Sigma), and Golgistop for 4 h. Cells were stained for anti-human CD4 APC (BD Bioscience) and violet fluorescent reactive dye VVD (Life Technologies), and then cells were fixed and permeabilized with BD fixation and permeabilization buffer and stained for IFN-γ FITC and GZMB FITC (BD Bioscience). For surface staining, the following antibodies were used: anti-human CD4 pacific blue, anti-human CCR7 PE, and anti-human CD45RA APC, IgG2a PE isotype control, IgG2b, and k APC isotype control (all from BD Bioscience). All antibodies were titrated for flow cytometry, which was performed on a BD LSR II (BD Bioscience) and analyzed using Flowjo software.

The expression of TCF-1 was knocked down in primary naïve CD4+ T cells by lentivirus vector carrying short hairpin RNA (shRNA) against TCF-1 (mission shRNA bacterial glycerol stock TRCN0000281336, Sigma-Aldrich) or a non-targeting sequence (a gift from Dr. Thomas Pertel at BWH and Dr. David Root at Broad Institute) as a control. Primary naïve CD4+ T cells were cultured in a 24-well plate in the presence of anti-CD3, anti-CD28, and IL2 and incubated with lentivirus. After 3 days, the lentivirus was washed away, and puromycin was added (1.5 μg/ml) to select transduced T cells for 3 days. Live cells were sorted using intracellular fluorescence-activated cell sorting, and the expression of TCF-1 was measured using qPCR.

The binding of TCF-1, H3-Lys9, and H3-Lys27 on IFNG and GZMB were analyzed using chromatin immunoprecipitation (ChIP) assay as described previously [26, 27]. The antibodies used for ChIP assay were anti-TCF-1 (Cell Signaling), anti-trimethyl-histone H3-Lys9 (Millipore), and anti-trimethyl-histone H3-Lys27 antibodies (Millipore) or Rabbit IgG (Millipore). Input DNA and DNA recovered after immunoprecipitation were analyzed by real-time qPCR using primer pairs for IFNG and GZMB (IFNG: forward 5′-GAAGAGTCAACATTTTACCAGGGC and reverse 5′-GTGACAGATAGGCAGGGATGATAG; GMZB: forward 5′-GAACCTGGTGCAATTACCAGAAT and reverse 5′CTTTTCACAGGGATAAACTGCTGG) with SyBR green Fast Master mix (Applied Biosystems). Values for TCF-1 binding with IFNG promoter and GZMB enhancer regions were normalized to IgG.

HEK293T cells were maintained in DMEM medium (Gibco) supplemented with 10 % fetal bovine serum (Gibco), 4 mM L-glutamine (Lonza), 1 mM sodium pyruvate (Lonza), 1 % non-essential amino acid (Lonza), and 10 mM HEPES (Lonza) at 37 °C/5 % CO₂. Forty-eight hours prior to transfection, cells were seeded at 10,000 cells per well in a 96-well tissue culture plate (Perkin Elmer). Cells were transfected with the indicated amounts of each expression vector using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions. Renilla luciferase vector (12.5 ng) was used for normalization of transfection efficiency. Forty-eight hours after transfection, cells were assayed using the Dual-Luciferase Reporter Assay System kit (Promega) as per the manufacturer’s instructions. Firefly luciferase values were normalized to Renilla luciferase levels. The results were expressed as relative luciferase activity in relative light units (RLU). Transfections were carried out in triplicate in three independent experiments, and results are expressed as mean ± standard error.

The −3.6-kb human IFNG-luc in a pGL3 vector background was a gift from Howard Young (Addgene plasmid #17599) [28], pcDNA3-HA-TCF1 was a gift from Kai Ge (Addgene plasmid #40620) [29], plasmid encoding Tbet was a gift from Dr. Christine Campbell [30], 1436 pcDNA3 Flag HA was a gift from William Sellers (Addgene plasmid #10792), and pGL3 basic and pGL3 promoter vector were purchased from Promega. A 1.04-kb fragment of the human GZMB enhancer region was inserted as three repeats between KpnI and NheI sites into the pGL3 promoter vector to generate the GZMB-luc plasmid (GenScript).

Naïve T cells were isolated from PBMCs, activated in the presence or absence of FTY720, and collected after 15, 30, 60, or 120 min. Cells were lysed with RIPA assay buffer (Thermo Scientific) supplemented with protease and phosphatase inhibitors (Thermo Scientific). Total protein concentration was determined by BCA assay (Thermo Scientific). Samples were prepared with 20 μg of protein, loading buffer (Life Technologies), and reducing agent (Life Technologies) and then heated for 10 min at 70 °C before use. Samples were run on a 10 % bis-tris gel (NOVO, Life Technologies), transferred to PVDF membrane, and detected by immunoblot. The following antibodies were used: p-AKT (Cell Signaling Technology), p-GSK3β (Cell Signaling Technology), pan-AKT (Cell Signaling Technology), pan-GSK3β (Cell Signaling Technology), beta actin (Cell Signaling Technology), and anti-rabbit IgG HRP (Cell Signaling Technology). The membrane was blocked with 5 % bovine serum albumin followed by primary and secondary antibody incubations as per the manufacturers’ instructions. Immunoblots were developed using ECL Prime (GE Healthcare).

FTY720 decreases relapses in multiple sclerosis, and its therapeutic effects are attributed to the sequestration of lymphocytes into the lymph nodes [18]. We characterized the frequency of total and naïve CD4+ T cells in multiple sclerosis patients before and 3 months after FTY720 treatment. Consistent with previous observation, [18] FTY720 treatment reduced the percentage and absolute number of circulating total CD4+ (Additional file 2: Figure S1 A and C) and naïve CD4+ T cells (Additional file 2: Figure S1 B and D), 3 months after treatment relative to baseline measurements. FTY720-treated patients continue to generate an immune response against foreign antigens indicating that the T cells still have the ability to egress from lymph nodes and potentially impact the CNS [31]. To further define the impact of FTY720 on immune cell function, we assessed the effect of FTY720 treatment on CD4+ T cell effector function.

Purified naïve T cells from healthy individuals were activated in the presence or absence of FTY720 at concentration of 100 ng/ml. Although the physiological concentration of FTY720 in blood is in a range of 5 to 10 ng/ml [18, 32], the concentration of the lymph nodes is 10 times higher [33]. Since we wanted to recapitulate the physiological effect of FTY720 on T cell activation within the lymph nodes, we chose to use the concentration of 100 ng/ml. We measured the effect of FTY720 on T cell-associated immune gene expression using nanostring-based immune arrays. We found that FTY720-treated T (T-FTY720) cells had a distinct immune gene signature, with 33 upregulated genes and 24 downregulated genes relative to untreated T (T-CTL) cells (Fig. 1a). We selected TCF7 based upon its relevance shown by several studies highlighting its role on T cell differentiation in mice and in EAE induction. In addition, recent observations in GWAS studies have correlated TCF7 with MS pathogenesis. These studies, however, did not address the functional role of TCF7 in MS patients, thus, we focused our attention on TCF7. We found that T-FTY720 cells showed greater TCF7 expression than T-CTL cells (Fig. 1b). These results were further confirmed by qPCR, which also showed increase in the expression of TCF7 in T-FTY720 compared to T-CTL (Fig. 1c). To determine whether this increase in TCF7 expression was specifically brought about by FTY720, we activated T cells in the presence of other approved drugs for multiple sclerosis treatment, namely interferon beta and natalizumab. We found increased expression of TCF7 only in T-FTY720 cells but not T cells treated with interferon beta (T-IFN beta) or natalizumab (T-Ty) (Additional file 3: Figure S2), suggesting that expression of TCF7 is specifically enhanced upon FTY720 treatment.

To investigate whether FTY720 modulates effector function of CD4+ T cells, we measured cytokine expression in naïve CD4+ T cells treated with or without FTY720. We observed that, compared to T-CTL cells, T-FTY720 cells showed lower messenger RNA (mRNA) expression of IFNG and GZMB as measured by nanostring array (Fig. 2a) and qPCR (Fig. 2b) and lower protein expression of IFN-γ and GZMB as measured by Luminex-based assay (Fig. 2c) and intracellular fluorescence-activated cell sorting analysis (Fig. 2d).

In addition to IFN-γ and GZMB expressions, we measured the expression of pro-inflammatory cytokines IL-17, granulocyte macrophage colony-stimulating factor (GMCSF), and tumor necrosis factor alpha (TNF-α) in supernatant collected from T-FTY720 and T-CTL cells using Luminex-based assay. We found decreased expression of IL-17, GMCSF, and TNF-α in T-FTY720 cells compared to T-CTL cells (Additional file 4: Figure S3 A). To determine whether this decreased cytokine production was related to excessive cell death, we measured the percentage of dead cells in T cell cultures in the presence or absence of FTY720. We found no difference in the percentage of dead T cells between groups (Additional file 4: Figure S3 B), suggesting that the effect of FTY720 is not mediated by increased cell death.

TCF-1 regulates T cell development and differentiation in mice [19‐21, 34‐36]. However, the role of TCF-1 in the regulation of CD4+ T cell function in humans remains unclear. Therefore, we analyzed the transcriptional regulation of IFNG and GZMB in CD4+ T cells by TCF-1 upon FTY720 treatment. We performed an in silico analysis and found that TCF-1 has binding sites in the IFNG promoter (−321 to −85 bp) and GZMB enhancer (+1606 to +1841 bp) regions (Fig. 3a). Using chromatin immunoprecipitation (ChIP) assay, we found increased binding of TCF-1 on both IFNG promoter and GZMB enhancer regions in FTY720-treated cells (Fig. 3b).

Regulation of IFN-γ and GZMB expression by TCF-1 was investigated by knockdown of TCF7 expression using lentivirus particles carrying shRNA against TCF7 or negative control. We found that shRNA-mediated knockdown of TCF7 (Fig. 3c) resulted in an increased IFNG and GZMB expression in T cells suggesting that TCF-1 might directly affect IFNG and GZMB expression (Fig. 3d).

Next, we performed a dual-luciferase reporter assay in HEK293T cells to determine whether TCF-1 directly represses IFN-γ and GZMB expression by binding to their promoter and enhancer regions, respectively. We used a plasmid encoding firefly luciferase downstream of the IFNG promoter region (IFNG-luc) that included the putative TCF-1 binding site determined by the ChIP assay as well as a binding site for Tbet, a transcription factor that reportedly activates IFN-γ expression [30, 37, 38]. We found increased relative firefly luciferase levels in cells co-transfected with IFNG-luc and Tbet expression plasmid compared with cells transfected with an empty vector. However, cells co-transfected with TCF-1 expression plasmid and IFNG-luc did not induce luciferase reporter activity; however, when both Tbet and TCF-1 expression plasmids were co-transfected with IFNG-luc, Tbet-induced firefly luciferase activity was reduced in a TCF-1 dose-dependent manner (Fig. 3e), suggesting that TCF-1 represses transcription at the IFNG promoter. We used a reporter plasmid containing the 1.04-kb GZMB enhancer sequence identified from our ChIP assay at a site upstream of the SV40 promoter that regulates firefly luciferase (GZMB-luc). We observed that firefly luciferase activity decreased significantly when HEK293T cells were co-transfected with GZMB-luc and increasing amounts of the TCF-1 expression plasmid (Fig. 3f). Firefly luciferase activity was unchanged in cells co-transfected with GZMB-luc reporter plasmid and an empty vector suggesting that repression of luciferase activity was TCF-1 dependent.

Using in silico analysis, we observed that TCF-1 also has putative binding sites in TNF-α, IL-17, and CSF2 promoters (Additional file 4: Figure S3 C). However, we did not observe the binding of TCF-1 to CSF2 and TNF-α promoters in ChIP assay (data not shown). We did not observe IL-17 production in more than 50 % of healthy individuals. Together, these results suggest that TCF-1 binds to IFN-γ promoter and GZMB enhancer regions and regulates their expression in FTY720-activated T cells, and the effect of FTY720 on TNF-α and GMCSF expression does not depend on TCF-1.

Increased expression of TCF-1 upon FTY720 treatment suggests that perhaps FTY720 affects events downstream of S1P and Wnt signaling pathways. Phosphorylation of Akt, which is a fundamental step of the sphingosine pathway [39], induces phosphorylation of other proteins and enzymes such as GSK3β [34, 40]. Akt inhibits GSK3 kinase activity via phosphorylation of serine 9 (Ser9) in GSK3β, resulting in its inactivation [41, 42]. GSK3β also plays an important role in signaling downstream of the Wnt pathway. Inactivation of GSK3β allows unphosphorylated β-catenin to accumulate, translocate into the nucleus, and activate gene transcription by replacing co-repressor molecules bound to TCF-1 [43, 44]. On the other hand, decreased levels of phosphorylated/inactive GS3Kβ result in phosphorylation of β-catenin and its subsequent proteasomal degradation [43]. We performed western blot analysis to assess the phosphorylation status of Akt at Ser473 and of GSK3β at Ser9 in FTY720-treated and FTY720-untreated T cells at different time points. We found decreased phosphorylation of Akt at Ser473 (Fig. 4a) and GS3Kβ at Ser9 (Fig. 4b) in T-FTY720 cells compared with T-CTL cells at all time points. This reduced phosphorylated GS3Kβ associated with lower levels of β-catenin in T-FTY720 cells than in T-CTL cells (Fig. 4c). These results indicate that FTY720 inhibits β-catenin accumulation by reducing Akt-mediated inactivation/phosphorylation of GSK3β.

In the absence of β-catenin, target genes are silenced by TCF-1-mediated recruitment of TLE/Groucho proteins [45]. qPCR analysis showed no differences in the expression of TLE1, TLE2, and TLE4 but a modest increase in TLE3 expression in T-FTY720 cells compared with T-CTL cells (Additional file 5: Figure S4). The recruitment of TLE/Groucho proteins by TCF-1 results in transcriptional suppression of target genes by inducing epigenetic modifications [46, 47]. To gain further insight into the molecular mechanism by which FTY720-induced TCF-1 regulates IFN-γ and GZMB expression, we measured methylation status of histones H3K9 and H3K27 on the IFNG promoter and GZMB enhancer regions after FTY720 treatment using ChIP assay. We observed increased levels of tri-methylation at H3K9 and H3K27 in the IFNG promoter (Fig. 4d) and GZMB enhancer (Fig. 4e) regions in T-FTY720 cells compared with T-CTL cells. These results suggest that FTY720-induced TCF-1 regulates IFN-γ and GZMB expression by directly binding and inducing repressive chromatin modifications such as tri-methylation of Lys9 and Lys27 of histone H3.

To determine the relevance of TCF-1 in multiple sclerosis pathogenesis, we first assessed its expression in CD4+ T cells from multiple sclerosis patients. We found that TCF7 expression was decreased in T cells from untreated RRMS patients (T-RRMS) compared with T cells from healthy controls (T-CTL) in both ex vivo isolated (Fig. 5a) and in vitro-activated (b) T cells. To assess whether FTY720 upregulates TCF7 expression in T cells from RRMS patients, we activated T-RRMS cells in the presence or absence of FTY720 and found higher TCF7 expression in FTY720-treated T-RRMS cells (Fig. 5c).

In order to determine whether the expression of TCF7 is related to multiple sclerosis disease activity, we computed correlations between TCF7 expression in T cells and clinical parameters such as Expanded Disability Status Scale (EDSS) score, disease duration, and number of relapses 2 years before the date of blood draw. We found a significant negative correlation (r ² = −0.45, p < 0.05) of TCF7 expression with EDSS score (Fig. 5d). We did not find any correlations between TCF7 expression and disease duration or number of relapses (data not shown). These results suggest that TCF7 is involved in multiple sclerosis pathogenesis.