Introduction
ZIKV (zika virus) belongs to the flaviviridae family, and can transmit from mosquitoes to humans to cause microcephaly and Guillain–Barré syndrome in most severe cases [
1‐
3]. ZIKV genome is a single positive stranded RNA consisting of approximately 11 kb nucleotides, which encodes three structural proteins (C, PrM and E) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5) [
4]. ZIKV infection has become one of the serious global public health threat since its first outbreak in Yap Island in 2007 [
5]. Neither vaccine nor specific antiviral therapy is available up till now. Therefore, it is critical to explore the underlying mechanism on how the host responds to ZIKV infection.
The Interferon regulatory factor (IRF) family comprises nine members, including IRF1, IRF2, IRF3, IRF4, IRF5, IRF6, IRF7, IRF8 and IRF9 [
6]. They participate in a variety of biological processes including antiviral inflammation, proliferation, apoptosis, and maturation of immune cell, and therefore can participate in both immunity and oncogenesis [
7,
8]. Among the nine members, IRF1, IRF2, IRF3 and IRF7 are the master regulator of transcriptional activation of type I interferon genes [
9]. When virus infect host cell, IRF3 and IRF7 were activated with phosphorylation and then induce Type I Interferons expression [
10]. Type I Interferons (mainly IFNα/β) induce the expression of a few hundred interferon-stimulated genes (ISGs) by activating the Jak-STAT signaling pathway to exert its anti-viral effect [
11]. The anti-viral function of many ISGs in multiple flavivirus infections, including ZIKV, DENV, WENV, JEV, has been largely confirmed [
12‐
15]. Type I Interferons signaling pathway play a key role in ZIKV-infected A549 cells and brain.
Because viral infection and upregulate IFN-β can induce IRF1 and IRF2 expression, when Type I Interferons signaling pathway is overactivated, IRF2, which acts as a transcriptional repressor through competing with IRF1 for binding to the IFNβ promoter region or Interferon-sensitive response element (ISRE) of the ISGs promoter subzone, negatively regulates IFNβ signal and interferon stimulated gene factor 3 (ISGF3)-mediated gene induction [
9,
16‐
19]. Type I interferon signaling pathway plays a important role in the process of ZIKV infection of a549 cells and brain [
12,
20]. However, whether IRF2 affects ZIKV replication through regulating ISGs are still unclear.
In addition to negatively regulate type I IFN signaling pathway, IRF2 has also been reported to affect dsDNA virus replication by regulating Family with sequence similarity 111 member A (FAM111A) and replication factor C subunit 3(RFC3) [
21]. As a chromatin-related protein sharing homology with trypsin-like peptidase, FAM111A interacts with proliferating cell nuclear antigen (PCNA) and binds to SV40 large T antigen, acting as a host restriction factor for SV40 [
22,
23]. Replication factor C (RFC) plays an important role in DNA replication, DNA damage repair, and check point control of cell cycle. RFC3 is one of the five subunits of RFC and can load PCNA onto DNA at template primer junctions [
24]. However, whether IRF2 regulates ZIKV replication through FAM111A and RFC3 remains to be determined. In this study, we therefore investigated the role of IRF2 in ZIKV replication and the potential underlying mechanism. We found that IRF2 inhibited ZIKV replication through regulating IRF2-FAM111A-RFC3 axis.
Materials and methods
Cell culture and infection with ZIKV
A549 cells (human non-small-cell lung cancer cell line) were purchased from West China Hospital of Sichuan University. Mutant U5A cells were derived from the parental human fibrosarcoma cells (2fTGH cells) and had IFNARI gene-deficient for a component of the IFNα/β receptor were kindly provided by Dr. Wenyu Lin (Harvard Medical School, USA) [
25,
26]. A549 cells, 2FTGH cells and U5A cells were grown in Dulbecco′s Modified Eagle′s Medium (DMEM), supplemented with 10% fetal bovine serum (FBS), 100 μg/mL penicillin and 100 μg/mL streptomycin sulfate. Cells were cultured in a 5% CO2 humidified incubator at 37 °C. ZIKV (GZ01 strain) was generously provided by professor Chengfeng Qin (Institute of Microbiology and Epidemiology, China) and was propagated in mosquito C6/36 cells as described in previous publication [
27]. For virus infection, cells were infected with ZIKV at a multiplicity of infection (MOI) of 0.5 with serum-free and antibiotic-free medium and incubate for 4 h. Cells were then washed with PBS for 3 times and re-fed with normal medium.
RNA isolation and quantitation by RT-qPCR
Total RNAs were extracted using Trizol reagent (Invitrogen, USA) according to the manufacturer′s instructions. cDNA was synthesized using the First Strand cDNA Synthesis Kit (Bio-rad, USA). Real-time PCR was performed with Fast start Universal SYBR Green Master Mix (Roche, USA). Normalization and quantitation were performed using GAPDH RNA and the ΔΔCt method. The selected mRNA real-time PCR primers were listed in Table
1.
Table 1
Real-time PCR primers
GAPDH | GCCTCCTGCACCACCAACTG | ACGCCTGCTTCACCACCTTC |
IRF2 | ATTTGCCAAGTTGTAGAGG | CTATCAGTCGTTTCGCTTT |
IFIT1 | GCAGCCAAGTTTTACCGAAG | GCCCTATCTGGTGATGCAGT |
FAM111A | CTTCACAAAAAGGGCGCAA | ATCAACTGGCTGGGTGCTTT |
RFC3 | GCCTGCAGAGTGCAACAATA | TCAAGGAGCCTTTGTGGAGT |
ZIKV NS5 | GCAGAGCAACGGATGGGAT | ATGGTGGGAGCAAAACGGA |
ISG15 | CGCAGATCACCCAGAAGATT | GCCCTTGTTATTCCTCACCA |
Protein quantification and western blot assay
The cells were washed 3 times with PBS, and then lysed by adding 100 μL of Radio Immunoprecipitation Assay (RIPA) (Beyotime, China) containing PMSF. Cell lysates were centrifugated and protein concentration was quantified with the Protein Assay Kit (Beyotime, China). Protein samples were separated by SDS–PAGE gels and transferred to the PVDF membranes (Millipore, USA). The membranes were blocked using 5% bovine serum albumin (BSA) and then incubated with the specific primary antibody in 4 °C for 16 hours. The primary antibodies included rabbitanti-IRF2 (Proteintech, China), mouse anti-ZIKV NS1 (GeneTex, USA), rabbitanti-RFC3 (Proteintech, China), rabbitanti-IRF2(Abcam, UK) and mouse anti-GAPDH (GeneTex_, USA). The secondary antibody used was HRP-labeled goat anti-mouse IgG or anti-rabbit (Beyotime, China). The protein bands were detected using the ECL Western Blotting Analysis System (Mllipore, USA) on Image Quant LAS 4000 mini (GE, USA).
RNA interference and plasmid transfection
Specific small interfering RNAs (siRNAs) were purchased from Sangon company (shanghai, China). The sense and antisense sequences of the siRNAs are listed in Table
2. pIRF2 (plasmid IRF2) and pEmpty (empty control) were purchased from vigene biosciences company (Shandong, China). Double-stranded siRNA and plasmid were transfected into cells with RNAiMax (Invitrogen, USA) according to the manufacturer′s instruction.
Table 2
RNA interference sequences
siNC | UUCUCCGAACGUGUCACGUT | ACGUGACACGUUCGGAGAATT |
siIRF2 | GCAAUCCGGUGCCUUACAAT | UUGUAAGGCACCGGAUUGCTT |
siFAM111A | GGUCAAUGUGUAAGGG | UCACCCUUACACAUUGACC |
siRFC3 | AAGUAACUACCACCUUGAA | UAACUUCAAGGUGGUAGUUA |
Statistical analysis
Data from all cell-based assays were expressed as Mean ± standard deviation (SD). Student's t-test was used to assess statistical significance of differences. We used one-way analysis of variance (ANOVA) to more than one variable. The chart was obtained using the GraphPad Prism 5.0 software package (GraphPad Prism Software, La Jolla, CA, USA). P-values less than 0.05 were considered statistically significant.
Discussion
When defending against invading virus infections, host cells need to activate both innate and adaptive immune systems. Type I IFNs and the down-stream Jak/STAT signaling pathway play the utmost role in antiviral innate immunity. However, this anti-viral immunity must be balanced by a complicated network (pathways) in cells. As two antagonism transcription regulators, IRF1 and IRF2 play important roles in type I interferon-induced antiviral effect [
29‐
31]. As previously reported, IRF1 could be induced by many cytokines such as IFNs (-α, -β, -γ), TNF-α, IL-1, IL-6, LIF and virus infection mediated by STAT and NF-κB [
9]. IRF1 could bind to the IFNβ promoter region and ISRE of the ISGs promoter subzone containing IRF-E sequences to stimulate the production of IFNβ and many antiviral ISGs while IRF2 competed with IRF1 to function as a transcriptional repressor to negatively regulate the host innate antiviral immunity [
9,
17‐
19]. The expression of IRF2 including IRF1 binding site at promoter region is inducible by transient or stable IRF1 expression [
32‐
34]. IRF2 was up-regulated in ZIKV infection of human iris pigment epithelial cells [
35]. In another study, IRF2 expression was induced during acute and latent infection [
36]. Our present study also confirmed that ZIKV infection could upregulate the expression level of IRF2.
After we confirmed that IRF2 was induced in ZIKV-infected cells, we moved on to dissect the role of IRF2 in ZIKV replication. Firstly, we silenced the IRF2 expression by specific siRNA or overexpression by plasmid transfection to look at the effect of IRF2 on ZIKV replication. We found IRF2 overexpression inhibited ZIKV replication (Fig.
4d) while silencing of IRF2 stimulated ZIKV replication (Fig.
2). Previous reports that IRF2 promoted replication of caprine parainfluenza virus type 3 as a negative regulator to down-regulate the type I interferon signaling pathways [
29]. This contradictory phenomenon alarmed us to look into this effect in more detail. Although silencing of IRF2 increased the expression levels of some ISGs, such as ISG15 (Fig.
2f) and IFIT1 (Fig.
2g), confirming that IRF2 functioned as negative regulator of type-I IFN signaling, knockdown of IRF2 stimulated ZIKV replication (Fig.
2). After we confirmed the type-I IFN signaling is intact in A549 cells used for this study. We hypothesized the role of IRF2 in ZIKV replication may be independent of type-I IFN signaling. Using IFNAR-deficient U5A cells, we were able to show that IRF2 knockdown increased ZIKV replication in both U5A and its parental 2FTGH cells (Fig.
2d, e), which indicated that IRF2 regulate ZIKV replication in an IFN-independent manner.
In addition to negatively regulate type I IFN pathway, IRF2 has also been reported to affect dsDNA virus replication by regulating Family with sequence similarity 111 member A (FAM111A) and replication factor C subunit 3(RFC3) [
21]. Debasis Panda et al. proposed that siIRF2 may inhibit the host restriction effect of RFC3 by down-regulating the expression of FAM111A [
15]. Although FAM111A and RFC3 act as nuclear localization-related factors and both played important role in DNA virus replication, whether they are involved in RNA virus such as ZIKV infection remains to be determined [
21]. IRF-1 is upregulated by infection of Measles virus (MeV, RNA virus) and contributes to the growth arrest of MeV-infected human epithelial cells and efficient virus proliferation through the modulation of host cell events [
37,
38]. silencing IRF2 was reported to result in growth inhibition associated with G2/M arrest as well as induction of polyploidy, differentiation and apoptosis [
39]. FAM111A and RFC3 as replication fork related complex is downregulated, which will inhibit cell proliferation and survival [
40,
41].
We then moved on to investigate whether IRF2 silencing promoted ZIKV replication by regulating the expression of FAM111A. As shown in Fig.
3a–d, IRF2 knockdown decreased the expression of FAM111A significantly. Furthermore, knockdown of FAM111A or subunit of RFC (RFC3) pronouncedly promoted ZIKV replication in both 2FTGH and U5A cells as shown in Fig.
3e–h. These data indicated that IRF2 may modulate ZIKV replication by regulating FAM111A and RFC3 expression. In order to further confirm the role of IRF2 in ZIKV replication through FAM111A and RFC3, we investigated the effect of IRF2 overexpression on ZIKV replication in FAM111A or RFC3 knocked-down 2FTGH cells (Fig.
4c). We found overexpression of IRF2 increased FAM111A mRNA level by 2-fold (Fig.
4a) and inhibited ZIKV replication (Fig.
4d). However, this inhibitory effect of IRF2 on ZIKV replication was abolished in FAM111A or RFC3 knocked-down 2fTGH cells (Fig.
4d). Collectively these data supported that IRF2 regulates ZIKV replication through FAM111A and RFC3.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.