ITK inhibition induced in vitro and in vivo anti-tumor activity through downregulating TCR signaling pathway in malignant T cell lymphoma

A total of 38 AITL patients who were diagnosed in our Department of Pathology based on the 2016 World Health Organization classification between January 2008 and December 2017 were enrolled in this study [18]. All the patients received CHOP or CHOP-like therapy (e.g., COP, CCOP or CHOPE) as the first-line therapy. The response to the first-line therapy was evaluated after the completion of 2 to 3 courses of treatment and 1 to 2 months after the completion of all therapy, then every 3 months for the first year and every 6 months thereafter until progression. OS was calculated from the date of disease confirmation to the date of last follow-up or tumor-related death. PFS was identified as the date of disease confirmation to the date of progression or tumor-related death. The treatment response was evaluated as CR, partial response (PR), stable disease (SD) or progressive disease (PD) according to the response criteria for malignant lymphoma [19]. The clinical research protocol was approved by the Institutional Review Board and the Ethical Committee of Peking University Cancer Hospital and Institute, which were in accordance with the ethical standards of our Institutional Review Board (IRB) and with the 1975 Helsinki declaration (Revised 2010) and its later amendments or comparable ethical standards. All patients participating in this study signed the informed consent form.

Formalin-fixed, paraffin-embedded tissue specimens from 38 cases of AITL were prepared as 4-μm-thick slides by the Pathology Department for IHC. Antibodies against phospho-ZAP70 (Tyr 493, 1:100, LifeSpan BioSciences, Seattle, WA, USA), phospho-ITK (Tyr512, 1:50, LifeSpan BioSciences, Seattle, WA, USA), and phospho-PLCγ1 (Tyr783, 1:500, Cell Signaling Technology, Danvers, CA, USA) were used for immunohistochemical analysis. The immunohistochemical assay was performed by the BenchMark XT automated slide processing system (Roche, Mannheim, Germany). Each sample was graded independently by two pathologists from the department of pathology in Peking University Cancer Hospital & Institute.

The expression of the phosphoprotein was semi quantitatively estimated as the immunostaining scores. The percentage of density displayed the fraction of positive staining tumor cells (0–100%). The intensity score represented the staining intensity (‘0’ as negative, ‘1’ as weak positive, ‘2’ as moderate positive and ‘3’ as the strong positive). Slides were visualized through an Olympus BX51 microscope (Olympus, Melville, NY, USA) and photographed with Leica DM6000B camera. The images were analyzed with Leica Aperio Versa 200 (Leica Camera AG, Somme, Germany). Tumors were considered positive for phosphoprotein when ≥ 10% of the neoplastic cells demonstrated phosphoprotein staining.

Sequencing libraries were generated using Agilent SureSelect Human All Exon kit (Agilent Technologies, CA, USA) following manufacturer’s recommendations and index codes were added to each sample. 150-bp paired-end reads were generated using an Illumina HiSeq platform. Reads were mapped to the reference human genome (UCSC hg19) by Burrows-Wheeler Aligner (BWA) software [20]. The somatic SNV was detected by muTect [21], the somatic InDel by Strelka [22]. Control-FREEC was used to detect somatic CNV [23]. Variants were independently identified for each tumor germline pair, using the germline as reference.

Jurkat, Hut-78, Hut-102 and H9 cells were purchased from ATCC (Manassas, VA, USA). The Karpas-299 cell lines were generously provided by Dr. Fu. (University of Nebraska Medical Center, Omaha, NE, USA). All cells were grown in PRMI 1640 medium or DMEM supplemented with 10% fetal bovine serum (Gibco, Life Technology, CA, USA) and 5‰ penicillin/streptomycin (Gibco, Life Technologies, CA, USA) in a humidified atmosphere with 5% CO₂ at 37 °C. BD Vacutainer CPT™ (BD Biosciences, San Jose, CA, USA) were used for separation of peripheral blood mononuclear cells (PBMCs) from whole blood of healthy donors. PBMCs were labeled with CD3-PC5 (Beckman Coulter, USA) for 60 min at 4  °C and washed in PBS before T lymphocytes were sorted using BD FACSAria II (355 nm, 488 nm, 633 nm).

Lentiviral vectors containing green fluorescent protein (GFP) (shControl) or a short hairpin RNA (shRNA) sequence targeting ITK (shITK-34465: TCAGTACACCAGTTCCACAGG; shITK-34466: GCCTTATATGACTACCAAACC; shITK-34467: CTCCACACACGTCTACCAGAT) were obtained from GeneChem (Shanghai, China) [24]. Jurkat, H9, Hut-78 and Karpas-299 cells were infected with shControl or shITK at a multiplicity of infection (MOI) of 1: 50, and cultured for 72 h for use in subsequent experiments. BMS-509744 (Cat No. HY-11092) and HY-11066 (Cat No. HY-11066) are both selective ITK inhibitor, which were purchased from MedChemExpress (MCE, China).

Cell viability was evaluated by the Cell Titer-Glo Luminescent Cell Viability Assay system (Cat No. G7572, Promega Corporation, Madison, WI, USA). Cells were harvested and seeded in 96-well plates at a density of 4 × 10⁴/ml. After 2 h of incubation, the cells were treated with different concentrations of BMS-509744 and cultured for 72 h. Next, cell titer reagent (10 μl) was added to each well, and the samples were incubated on a shaker at room temperature for 10 min. Luminescent signals were measured by an LMax II instrument (Molecular Devices, Sunnyvale, CA, USA).

Total RNA from cell lines was extracted using TRIzol reagent (Cat No. 15596–026, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. Reverse transcription was performed using TransScript First-Strand cDNA Synthesis SuperMix (Cat No. AT301, TransGen Biotech, Beijing, China). To analyze the expression level of ITK, real-time PCR was performed using SYBR Green Master Mix (Cat No. A6001, Promega Corporation, Madison, WI, USA). Reactions were performed in a total volume of 10 μl, including 2.0 μl of cDNA (diluted 1:100), 5 μl of SYBR Green Master Mix and 0.2 μl of each specific primer (10 nM), and run in an ABI Prism 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The primers were as follows: ITK sense TGGTGCACAAACCTCAACCT, antisense CACATGGTTCTCCACCGTCA; GAPDH sense GCACCGTCAAGGCTGAGAAC, antisense TGGTGAAGACGCCAGTGGA; CXCR4 sense GGAGGGGATCAGTATATACA, antisense GAAGATGATGGAGTAGATGG. The cycling conditions were set at 95 °C for 10 min, followed by 45 cycles at 95 °C for 15 s and 60 °C for 1 min. GAPDH was measured for normalization. The ΔΔCt method was used to assess the relative quantifications.

Cells were harvested and lysed in radioimmunoprecipitation assay buffer (Cat No. 9806, Cell Signaling Technology, Danvers, MA, USA) supplemented with protease/phosphatase inhibitor cocktail (Cat No. 04693124001/04906845001, Roche, Mannheim, Germany). Protein concentrations were quantified using a Thermo BCA assay kit (Cat No. 23223, Thermo Scientific, MA, USA). Whole, cytoplasmic or nuclear cell extracts of cells were extracted and evaluated using 10% SDS-polyacrylamide gel electrophoresis or a 4–12% separating gel. After electrophoresis, the proteins were transferred to polyvinylidene fluoride membranes (Cat No. IPVH00010, Millipore Corporation, Billerica, MA, USA). The membranes were subsequently blocked with 5% defatted bovine serum albumin powder for 2 h at room temperature and then incubated with the indicated antibodies. The signals were detected using a chemiluminescence detection system (Alpha Innotech, San Leandro, CA, USA). Antibodies against ITK (Cat No. ab32039) and GAPDH (Cat No. ab9485) were provided by Abcam (Cambridge, MA, USA). The antibodies against caspase-3 (Cat No. #9662), Mcl-1 (Cat No. #5453), Bcl-xl (Cat No. #2764S), Bcl-2 (Cat No. #4223), Bak (Cat No. #12105), cyclin D1 (Cat No. #12231), phospho-cdc2-Tyr 15 (Cat No. #9111), cdc2 (Cat No. #9116), phospho-PLCγ1-Tyr783 (Cat No. #14008), phospho-Akt-Ser 473 (Cat No. #9271), Akt (Cat No. #9272), phospho-p44/42 MAPK-Thr202/Tyr 204 (Erk 1/2) (Cat No. #4370), p44/42 MAPK (Erk 1/2) (Cat No. #9102), Notch1 (Cat No. #4380T), NF-κB p65 (Cat No. #8242S), Phospho-NF-κB p65 (Ser536) (Cat No. #3031S), FAK (Cat No. #3285T), Phospho-Tyr397-FAK (Cat No. #8556) and RhoA (Cat No. #2117) were obtained from Cell Signaling Technology (Danvers, MA, USA).

Cell invasion assay was performed using a Matrigel invasion chamber (Cat No. 354480, Corning Costar, MA, USA) and cell migration was assessed by a Transwell assay (Cat No. 3422, Corning Costar, MA, USA). Serum-free medium (500 μl) was added into the insert of the Transwell and then were placed in the incubator at 37 °C for 2 h. Next, 1 × 10⁵ cells in 200 μl of serum-free medium were added to the top chamber and 500 μl of RPMI 1640 medium containing 30% FBS was added into the lower chamber. The cells were infected with shControl or shITK (shITK-34467) at a MOI of 1: 50, and cultured for 72 h for use in the invasion and migration assay. The cells were pretreated with vehicle and different concentrations of BMS-509744 for 12 h before they were used for the Transwell invasion and migration assay. After 24 h of incubation, the cells invading into the lower chamber were collected and counted using the Cell Titer-Glo Luminescent Cell Viability Assay system.

To determine the effects of BMS-509744 on apoptosis, the FITC Annexin V/propidium iodide (PI) double staining was evaluated in the cells using the FITC Annexin V Apoptosis Detection Kit (Dojindo Laboratories, Kumamoto, Japan). Briefly, cells (2 × 10⁵) were seeded into 6-well plates and incubated for 24 h at 37 °C in culture medium containing BMS-509744 at the indicated final concentrations. After incubation, the cells were washed with PBS twice and resuspended in 100 μl of binding buffer. The cells were stained for 15 min with Annexin V-FITC and PI, and then measured by flow cytometry (BD Biosciences, San Jose, CA, USA). Approximately 1 × 10⁴ counts were made for each sample. The percentage distribution of normal, early apoptotic, late apoptotic and necrotic cells was analyzed by a BD flow cytometer.

Cell cycle progression was determined by PI (Sigm-Aldrich, St. Louis, MO, USA) staining using a flow cytometer. The cells were seeded in 6-well culture plates and cultured with BMS-509744 for 24 h. Next, the cells were fixed with 70% cold ethanol at 4 °C overnight. Then, the cells were rehydrated and washed twice with PBS, and incubated with 100 μg/ml RNase (Cat No. GE101, TransGen Biotech, Beijing, China) at 37 °C for 30 min. Then, the cell cycle was monitored by using PI staining of nuclei at room temperature for 30 min. The cell cycle was calculated using ModFit LT software (Verity Software House, Topsham, ME, USA).

Six- to eight-week-old severe combined immunodeficiency (SCID) female mice were used to establish the H9-cell-derived xenograft model. H9 tumor cells (5 × 10⁶) in 0.1 ml of PBS medium with Matrigel (1: 1 ratio) were inoculated subcutaneously into the area under the right flank of each mouse. Tumor growth was measured twice weekly using a Vernier caliper. Treatments were initiated when the tumor volume reached approximately 100–150 mm³. The mice were randomized into four groups (n = 8/group): vehicle control, BMS-509744 (10 mg/kg), BMS-509744 (25 mg/kg) and BMS-509744 (40 mg/kg). Treatments were administered by intraperitoneal injection daily. The tumors were measured every 3 days, and tumor volume was calculated using the following formula: volume = length × width²/2. The treatment lasted 14 days, after which the mice were sacrificed, and the tumors were fixed in 10% formalin for histological and immunohistological analysis. All animal care and experimental procedures were performed in accordance with the Animal Care Ethics guidelines approved by the Medical Ethics Committee of the Beijing Cancer Hospital and Institute.

To detect DNA fragmentation and consequently apoptotic cells in tumor specimens, paraffin-embedded, 4-μM-thick sections from H9 tumor samples were used to identify apoptotic cells using an in situ Cell Death Detection Kit (Cat No. 11684795910, Roche, Mannheim, Germany).

Cells were infected with shITK (shITK-34465, shITK-34466 and shITK-34467) and shControl for 12 h and then cultured for 72 h before incubated with the indicated concentrations of vincristine or doxorubicin. For the ITK inhibitor, the cell lines were plated into 96-well plates and incubated with different concentrations of BMS-509744 and the indicated concentrations of vincristine or doxorubicin for 72 h. The control cells received an equivalent concentration of PBS. Inhibition rates were tested using the Cell Titer-Glo Luminescent Cell Viability Assay system. The CalcuSyn software was used to calculate the combination index values [25].

All experiments were repeated at least three times and representative results are shown in the figures. The results are expressed as the mean ± SD. All statistical analysis was carried out using SPSS software for Windows (version 19.0). An effect was considered statistically significant at P < 0.05. TCR-related protein expression levels and clinical parameters were compared using the χ² test. The Kaplan–Meier method was used to construct survival curves, and the results were compared using a log-rank test. The statistical significance of differences from the controls was assessed by Student’s t test.

The general characteristics of the 38 AITL (27 male and 11 female) patients in this study are summarized in Table 1. All enrolled patients had histopathologically confirmed AITL. The median age at diagnosis was 58 years (range 32–81 years). All patients were in stage 3 or stage 4 at diagnosis, and 18 (50%) patients had intermediate-to-high or high international prognostic index (IPI) scores. Twenty (54%) patients presented with B symptoms, twenty-five (69.4%) patients presented with elevated serum lactate dehydrogenase (LDH) and nineteen (59.4%) patients showed elevated β₂-MG levels.

To investigate the possible role of the TCR signaling pathway in the pathogenesis of T cell lymphoid malignancies, the phosphorylation status of key regulatory tyrosine kinases was analyzed in sections of tumor tissues from 38 AITL patients. Immunohistochemical staining analysis showed that phosphorylated ZAP70, ITK and PLCγ1 were observed in 68.4%, 73.68% and 52.6% of cases, respectively (Fig. 1a). The correlations between the phosphorylation status of these kinases and clinical characteristics were evaluated in patients with complete clinical data (Additional file 2: Tables S1, Additional file 3: Table S2). Importantly, of the 33 patients who were evaluable for the response to first-line therapy, lower CR rates were observed in patients positive for phospho-ITK expression than in patients negative for phospho-ITK expression (20% vs. 75%, P = 0.004, Table 1). Furthermore, survival analysis was performed in twenty-seven patients who did not undergo SCT after the first-line chemotherapy. After a median follow-up time of 16.53 months (range 0.6–60.67 months), 16 (59.3%) patients relapsed or progressed and 11 (40.7%) patients died. Patients with negative expression of phosphorylated ITK had a median PFS of 25.1 months and those with positive expression of phosphorylated ITK had a median PFS of 5.17 months (P = 0.022). The median OS of the phospho-ITK negative group and the phospho-ITK positive group were 21.65 months and 15.53 months (P = 0.787), respectively (Fig. 1b, c). These data suggested that the intracellular TCR signaling pathway, especially ITK, may play an essential role in the pathogenesis of T cell malignancies.

Next, patients with fresh frozen tumor tissues and matched peripheral blood samples were subjected to WES (n = 12). The epigenetic related gene TET2 was the most frequently mutated gene among those analyzed (8/12; 67%). The RHOA G17 V variant was identified in 5 of 12 patients (41.7%) (Table 2). Apart from RHOA and TET2 mutations, a high frequency of diverse mutations in TCR signaling-related genes were also present in AITL tumor samples (11/12, 91.7%). The somatic TCR signaling related mutations were frequently observed in these patients, such as CD28, FYN, CARD11, LCK, KRAS, PIK3R1, VAV1, ITK, ZAP70 and AKT1. These results also suggested that the TCR signaling pathway play an essential role in the pathogenesis of T-cell lymphoid malignancies.

To further elucidate the essential role of ITK in the pathogenesis of AITL, several malignant T-cell leukemia or lymphoma cell lines (Jurkat, Hut-78, Hut-102, Karpas-299 and H9) were selected for in vitro functional assays. Western Blotting and Real-time PCR analysis demonstrated that TCR signaling key regulatory kinase ITK is highly activated in H9, Hut-78 and Jurkat cell lines accompanied with ITK protein overexpression. Karpas-299 cell line, which had low expression of protein ITK and phospho-ITK, was used as a negative control. (Figure 1d, e). To analyze the functional role of ITK, the malignant T cells were transfected with lentiviral particles carrying a shRNA expression vector designed to knock down ITK expression (shITK-34465, shITK-34466 and shITK-34467). A lentiviral vector containing a nonspecific shRNA sequence was used as a negative control. The knockdown efficacy of the three individual ITK shRNAs in malignant T cell lymphoma cell lines was confirmed by Western blotting analysis (Fig. 2b). Then, the cell proliferation of shControl and shITK transfected cells was compared using the Cell Titer-Glo Luminescent Cell Viability Assay system. As shown in Fig. 2a, the reduction of ITK expression inhibited the proliferation of H9 cells. The inhibition rates of shITK-34465, shITK-34466 and shITK-34467 were 32%, 41% and 32% relative to the shControl cells, respectively. Similar results were also observed in Jurkat and Hut-78 cells, which indicated that ITK expression is critical for the growth of malignant T cell lymphoma cells. In contrast, the reduction of ITK expression did not influence the proliferation of Karpas-299 cells (Fig. 2c). More importantly, the selective ITK inhibitor BMS-509744 and HY-11066 also suppressed the proliferation of these malignant T cells (Fig. 2d; Additional file 1: Figure S1). But the viability of normal T cells from healthy donors and negative control cell line Karpas-299 were not affected after incubation with the indicated concentrations of ITK inhibitor BMS-509744 (Fig. 2d).

To clarify the possible impacts of ITK inhibition on the TCR signaling pathway, the related cascades were next investigated by immunoblotting analysis. Compared with those transfected with the shControl vector, H9 cells transfected with shITK exhibited decreased ITK expression and reduced phosphorylation of PLCγ-1, ERK1/2, and AKT. Similar results occurred in Jurkat and Hut-78 cells (Fig. 2b). More importantly, the ITK inhibitor BMS-509744 also substantially suppressed the phosphorylation of downstream TCR cascades (PLCγ-1, ERK and Akt) after 60 min and 120 min of treatment (Fig. 2e). Thus, ITK inhibition could suppress the proliferation of malignant T cells by downregulating the transduction and activation of the TCR signaling pathway.

To further investigate the other related pathways, western blotting analysis was used to detect the activity of Notch1 and phosphorylation of NF-κB (p-p65) after the cells were incubated with the indicated concentrations of BMS-509744 for 24 h (Fig. 2f). Results from this analysis revealed that inhibition of ITK could also downregulate the expression of Notch1 and phospho-NF-κB.

Previous studies have reported that ITK may regulate the migration of T cells [26, 27]. Next, the possible effect of ITK inhibition on the motility of malignant T cells was measured in the Transwell assay system. Similar to the inhibitory effect on tumor cell proliferation, compared with the cells transfected with the shControl vector, the invasion and migration activity of these malignant T cells was decreased after shITK vector transfection (Fig. 3a, b). Consistent with these results, treatment with the ITK inhibitor BMS-509744 also efficiently inhibited invasion and migration in malignant T cells in a dose- and time-dependent manner (Fig. 3c, d; Additional file 1: Figure S2B). These data demonstrate that the activation of ITK essentially regulated the motility of these neoplastic cells. As a negative control, the effect on the invasion and migration activity of Karpas-299 was not affected after shITK vector transfection (Additional file 1: Figure S2A).

To determine the molecular mechanism by which ITK inhibitor suppressed cell migration and invasion, we investigated whether ITK inhibitor could modulate motility via C-X-C receptor 4 (CXCR4), focal adhesion kinase (FAK) and RhoA, which is involved in migration and invasion of malignant lymphoma cells [28, 29]. For this purpose, we treated malignant T cell lymphoma cells with BMS-509744 for 24 h and then conducted q-PCR and Western blotting analysis. The results demonstrated that ITK inhibition significantly decreased the expression of CXCR4 and RhoA and the activation of FAK compared with the vehicle group (Fig. 3e, f).

To further investigate the mechanisms by which ITK inhibition induced cytotoxic effects on T cell lymphoma, the proportion of apoptotic cells was analyzed following treatment with the ITK inhibitor BMS-509744. As shown in Fig. 4a, b, the percentages of apoptotic H9 cells were 15.25 ± 0.8%, 25 ± 3.8% and 47.9 ± 2.7% upon treatment with three increasing doses of the ITK inhibitor for 24 h, suggesting that ITK inhibition mediated dose- and time-dependent apoptotic cell death in malignant T cell lines. Similar effects were also observed in Hut-78 cells. However, the apoptotic cells induced by the ITK inhibitor was not that significant in Jurkat cells compared with H9 and Hut-78. Furthermore, Western blotting analysis revealed that ITK inhibitor treatment resulted in an increase in the expression of the active forms of caspase-3 and poly-ADP ribose poly-merase (PARP). In addition, expression of the anti-apoptotic proteins, Bcl-2, Mcl-1, and Bcl-xl, was noticeably decreased in response to ITK inhibition, while expression of the pro-apoptotic protein Bak was increased (Fig. 4c). These results demonstrate that ITK inhibition promotes the induction of apoptosis via regulation of the intrinsic mitochondrial apoptosis pathway.

Next, cell cycle arrest was assayed by flow cytometry to further characterize the mechanism underlying this anti-proliferative activity. As shown in Fig. 4d, f, exposure of H9 cells to three increasing doses of the ITK inhibitor increased the percentage of cells in the G2 phase from 19.7 ± 5.4% in the control group to 21.4 ± 6.5%, 23.7 ± 7.3%, and 41.5 ± 17.4% in the treatment groups. Similar results were also observed in Jurkat and Hut-78 cells. The G2/M transition-related cell cycle proteins cyclinB1 and phosphorylated cdc2 were decreased in ITK inhibitor-treated tumor cells (Fig. 4e). These data indicate that ITK inhibition suppressed the proliferation of tumor cells by inducing cell cycle arrest at the G2/M checkpoint. As the negative control cell line, the BMS-509744 did not induce apoptosis and cell cycle arrest in Karpas-299 cells (Additional file 1: Figure S4a, b).

The in vivo antitumor activity of ITK inhibition was examined in SCID mice inoculated with H9 lymphoma cells. SCID mice were inoculated with H9 cells to establish a T cell lymphoma cell-derived xenograft. The mice were randomized into four treatment groups according to tumor volume and body weight. Mice were treated with the ITK inhibitor BMS-509744 (10, 25 and 40 mg/kg) once daily for 14 days by intraperitoneal injection. As shown in Fig. 5a, the ITK inhibitor reduced tumor growth by 11.49%, 24.53% and 53.82% (P = 0.502, P = 0.033 and P = 0.000) in response to 10, 25 and 40 mg/kg BMS-509744 treatment, respectively. The body weight of tumor-bearing mice was not significantly affected post ITK inhibitor treatment. To further evaluate the apoptosis status of tumor after the treatment of BMS-509744, we performed TUNEL staining on paraffin sections of tumor samples collected from H9 xenografts post ITK inhibitor treatment. As shown in Fig. 5c, BMS-509744 treatment produced an increase in apoptosis compared with that in the vehicle group. These data demonstrate that the reduction in the progression of the tumor is observed at high doses of the ITK inhibitor BMS-509744 in vivo.

Given the observed effects of ITK knockdown on the survival and proliferation of malignant T cell lymphoma, we next investigated whether ITK suppression enhanced chemosensitivity. shITK- or shControl-transfected H9 cells were incubated with vincristine (0.0015 μM) or doxorubicin (0.05 μM) for 72 h, which are commonly used in the treatment of AITL. (Figure 6a, b). shITK transfection synergistically enhanced the antitumor effect of the vincristine (shITK-34465: 29%; shITK-34466: 20% and shITK-34467: 30%) in H9 cells compared with that of cells transfected with shControl (13.5%). Similarly, H9 ITK knockdown cells exhibited higher inhibition rates for doxorubicin (shITK-34465: 56%; shITK-34466: 44% and shITK-34467: 43%) than those of the shControl cells (33.4%). The resulting data showed that ITK knockdown synergistically enhances the antitumor activity of vincristine and doxorubicin. Similar results were also observed in Jurkat ITK knockdown cells and Hut-78 ITK knockdown cells. In contrast, ITK inhibition did not enhance chemosensitivity of Karpas-299 cells towards vincristine and doxorubicin (Additional file 1: Figure S3).

To further confirm the synergistic activity of combined ITK inhibition and chemotherapy, H9 cells were incubated with a fixed concentration of vincristine or doxorubicin and increasing concentrations of the ITK inhibitor for 72 h. The combination treatments resulted in decreased cell viability compared to that of each agent alone. Similar results were also observed in Jurkat and Hut-78 tumor cells (Fig. 6c, d). The combination index (CI) values were used to quantify these synergistic antitumor effects (Fig. 6e). The analysis of CI values revealed synergism for the combination of the ITK inhibitor and vincristine or doxorubicin, with CI values < 1. These results suggested that ITK inhibition could moderately enhance the antitumor effects of standard T cell lymphoma treatment regimens.