Skip to main content
Erschienen in: BMC Cancer 1/2016

Open Access 01.12.2016 | Research article

Keratin 19 as a key molecule in progression of human hepatocellular carcinomas through invasion and angiogenesis

verfasst von: Masato Takano, Keiji Shimada, Tomomi Fujii, Kohei Morita, Maiko Takeda, Yoshiyuki Nakajima, Akitaka Nonomura, Noboru Konishi, Chiho Obayashi

Erschienen in: BMC Cancer | Ausgabe 1/2016

Abstract

Background

Keratin (K) 19-positive hepatocellular carcinoma (HCC) is well known to have a higher malignant potential than K19-negative HCC: However, the molecular mechanisms involved in K19-mediated progression of HCC remain unclear. We attempted to clarify whether K19 directly affects cell survival and invasiveness in association with cellular senescence or epithelial-mesenchymal transition (EMT) in K19-positive HCC.

Methods

K19 expression was analysed in 136 HCC surgical specimens. The relationship of K19 with clinicopathological factors and survival was analysed. Further, the effect of K19 on cell proliferation, invasion, and angiogenesis was examined by silencing K19 in the human HCC cell lines, HepG2, HuH-7, and PLC/PRF/5. Finally, we investigated HCC invasion, proliferation, and angiogenesis using K19-positive HCC specimens.

Results

Analysis of HCC surgical specimens revealed that K19-positive HCC exhibited higher invasiveness, metastatic potential, and poorer prognosis. In vitro experiments using the human HCC cell lines revealed that K19 silencing suppressed cell growth by inducting apoptosis or upregulating p16 and p27, resulting in cellular senescence. In addition, transfection with K19 siRNA upregulated E-cadherin gene expression, significantly inhibited the invasive capacity of the cells, downregulated angiogenesis-related molecules such as vasohibin-1 (VASH1) and fibroblast growth factor 1 (FGFR1), and upregulated vasohibin-2 (VASH2). K19-positive HCC specimens exhibited a high MIB-1 labelling index, decreased E-cadherin expression, and high microvessel density around cancer foci.

Conclusion

K19 directly promotes cancer cell survival, invasion, and angiogenesis, resulting in HCC progression and poor clinical outcome. K19 may therefore be a novel drug target for the treatment of K19-positive HCC.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s12885-016-2949-y) contains supplementary material, which is available to authorized users.
Abkürzungen
EMT
Epithelial-mesenchymal transition
FGFR
Fibroblast growth factor
HBsAg
Hepatitis B virus surface antigen
HCC
Hepatocellular carcinoma
HCVAb
Hepatitis C virus antibody
K
Keratin
LBC
Liquid based cytology
TUNEL
Terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate-biotin nick end labeling
VASH
Vasohibin

Background

Liver cancer is the second leading cause of cancer death in men worldwide. In 2012, the incidence of liver cancer was estimated at 782,500 and 745,500 deaths were associated with this disease [1]. Primary liver cancers have traditionally been classified into hepatocellular carcinoma (HCC) and cholangiocellular carcinoma (CCC) originating from hepatocytes and cholangiocytes, respectively [2]. In normal human liver, hepatocytes typically express keratin (K) 8 and K18, while bile duct cells predominantly express K7 and K19 [3]. In previous studies, a subset of HCC was observed to express K19 [310]. Durnez et al. [4] showed that K19-positive HCC cells were characterized by an oval nucleus and a narrow rim of cytoplasm, resembling non-neoplastic hepatic progenitor cells. Given this phenotype, these researchers hypothesized that these cells may be derived from progenitor cells that have the bipotential to differentiate into both hepatocytes and cholangiocytes. Interestingly, K19-positive HCC had a significantly higher incidence of early recurrence and metastasis to extrahepatic organs, including regional lymph nodes, compared to K19-negative (conventional) HCC [5]. Aggressive clinical behavior and poor prognosis of K19-positive HCC are thought to be due to frequent vascular invasion, poor differentiation, or high proliferative activity of these cells, as identified by immunohistochemical assessment of Ki-67 [3, 6, 8]. Several studies using a tissue microarray or snap-frozen human HCC tissue samples demonstrated that both protein and mRNA levels of the molecules associated with epithelial-mesenchymal transition (EMT), such as vimentin, S100A4, and snail, were highly elevated, but decreased expression of E-cadherin was observed less frequently in K19-positive HCC [8].
The mechanisms responsible for the increased malignancy of K19-positive HCC compared to conventional K19-negative HCC have been previously explored in the study by Govaere et al. [11]. In the present study, we attempted to clarify whether K19 affects cell survival and invasiveness directly in association with cellular senescence or EMT in K19-positive HCC.

Methods

Patients and tissue specimens

Tissue specimens were collected from 136 patients with HCC who underwent primary curative hepatectomy at the Nara Medical University Hospital, during the period between 2007 and 2012. No other treatments were given before resection. There were 103 men and 33 women with an age range of 29 to 84 (mean 69) years. Of the 136 HCC cases, 33 (24.3%) were positive for hepatitis B virus surface antigen (HBsAg), 62 (45.6%) were positive for hepatitis C virus antibody (HCVAb), and 43 (31.6%) were negative for both HBsAg and HCVAb. The follow-up period from surgical treatment until death due to HCC (16 cases) or the end of this study was 30 to 2550 days (mean 1100 days).
Tissues were fixed in 10% formalin, embedded in paraffin, cut into 3 μm sections, and mounted on silane-coated slides. One section from each tissue was stained with hematoxylin and eosin for histological examination. The diagnosis of HCC was based on WHO criteria [2]. Recurrence was diagnosed by biochemical tests (tumour marker; Alpha-fetoprotein, protein induced by vitamin K absence or antagonist-II), sonograms, computed tomography (CT) and magnetic resonance imaging (MRI). Written informed consent was obtained from all patients before treatment, according to our institutional guidelines. This study was approved by the institutional review board.

Immunohistochemistry

Immunohistochemical study was performed on paraffin sections using a BOND MAX Automated Immunohistochemistry Vision Biosystem (Leica Microsystems, Wetzlar, Germany). For antigen retrieval step, Bond Epitope Retrieval Solution 1 (citrate-based solution, pH 6.0) (Leica Biosystems, Nussloch, Germany) was used. Antibodies for immunohistochemistry are listed in Table 1. Double immunostaining was carried out following manufacturer’s protocols using K19 and the Bond Polymer Refine Detection kit (brownish colour, Leica Biosystems), and E-cadherin and the Bond Polymer Refine AP-Red Detection kit (red colour, Leica Biosystems). Bile ducts, liver, lymph nodes, vascular endothelium, and endothelial layer of the human placenta were used as positive control for K19, E-cadherin, Ki-67, CD31, and VASH1, respectively. Negative controls were carried out by substitution of the primary antibodies with non-immunized mouse serum, resulted in no signal detection (Additional file 1: Fig. S1). In this study, K19-positive HCC was defined as that in which > 5% of total carcinoma cells showed immunoreactivity against K19. E-cadherin, Ki-67, and VASH1 positive cells were counted in 1000 cancer cells from K19-positive and K19-negative areas in K19-positive HCC specimens. The number of blood vessels in K19-positive and K19-negative HCC specimens, identified by CD31 around cancer foci, was counted in 10 high-power fields (100×.).
Table 1
List of antibodies for immunohistochemistry
Primary antibody
Clone
Species
Source
Dilution
Staining reagent
K19
B170
Mouse
Leica Biosystems, Nussloch, Germany
1:300
DAB
E-cadherin
36B5
Mouse
Leica Biosystems
1:50
AP
Ki-67
MIB-1
Mouse
Life Technologies, Carlsbad, CA, USA
Predilution
DAB
CD31
JC70A
Mouse
DAKO, Glostrup, Denmark
1:200
DAB
VASH1
4A3
Mouse
Abnova, Taipei, Taiwan
1:1500
DAB
Abbreviations: DAB diaminobenzidene, AP alkaline phosphatase

Cell culture

The human HCC cell lines, HepG2, HuH-7, and PLC/PRF/5 were purchased from Japanese Collection of Research Bioresources Cell Bank (Osaka, Japan) and cultured in RPMI supplemented with 10% FBS.

Transfection of human K19 siRNA in vitro

The cells were seeded at 105 cells per well in 6-cm plates, and transfected with 100 nmol/L control RNA (Santa Cruz bio, Dallas, TX, USA) or human K19 siRNAs using Lipofectamine RNAiMAX (Life Technologies, Carlsbad, CA, USA), in accordance with the manufacturer's protocol. After culturing for the indicated time, the samples were removed and homogenized.

Quantitative real-time PCR

Template cDNA was synthesised from 1 μg of total RNA using Primer Script RT reagent Kit (Takara, Shiga, Japan). The quantitative real-time PCR detection was performed using a SYBR® Premix Ex Taq kit (Takara). The amount of actin mRNA in each sample was used to standardise the quantity of each mRNA. The sequences of the primers used for PCR are shown in Table 2.
Table 2
The sequences of the primers for PCR used in this study
Gene
Sequences (5’-3’)
Actin
ATGGGTCAGAAGGATTCCTATGT
GAAGGTCTCAAACATGATCTGGG
K19
TACAGCCACTACTACACGACCATC
AGAGCCTGTTCCGTCTCAAACT
E-cadherin
CAGCGTGTGTGACTGTGAAGG
CAGCAAGAGCAGCAGAATCAGAA
vimentin
TGGCCGACGCCATCAACACC
CACCTCGACGCGGGCTTTGT
p16
GCTTCCTGGACACGCTGGT
CGGGCATGGTTACTGCCTCTG
p27
CCGGCTAACTCTGAGGACAC
TTGCAGGTCGCTTCCTTATT
N-cadherin
ACGCCGAGCCCCAGTATC
GGTCATTGTCAGCCGCTTTAAG
snail
CCTGCGTCTGCGGAACCT
TTGGAGCGGTCAGCGAAGG
vasohibin-1 (VASH1)
ACATGCGGCTCAAGATTGGC
TCACCCGAGGGCCGTCTT
vasohibin-2 (VASH2)
CAGGGACATGAGAATGAAGATCCT
CAGGCAGTGCAGGCGACT
FGFR1
GCCTGAACAAGATGCTCTCC
CAATATGGAGCTACGGGCAT
Abbreviations: K keratin, FGFR fibroblast growth factor

Cell proliferation assay 

For the cell proliferation assay, the methane thiosulfonate (MTS) reagent was used as previously described [1214]. All the experiments were performed in triplicate.

Cell invasion assay

In vitro invasion assays were performed using Matrigel invasion chambers (BD Biosciences, Bedford, MA, USA) as previously described [15]. Invading cells were counted under a light microscope. The experiment was repeated three times.

Senescence assay

Cells were fixed at 70% confluence and then incubated at 37 °C overnight with staining solution containing X-gal substrate (Senescence Detection kit, BioVision, Milpitas, CA, USA). Cells were then observed under a microscope for the presence of blue stain [16].

Detection of apoptosis

Liquid based cytology (LBC) was used to prepare the cell lines for apoptosis assay by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate-biotin nick end labelling (TUNEL) using the ApopTag in situ apoptosis detection kit (Oncor, Gaithersburg, MD, USA) [17]. We identified cells showing darkly stained nuclei or nuclear fragments as TUNEL-positive apoptotic cells, and counted those in several high-power fields.

Statistical analysis

Differences in continuous variables were analysed using ANOVA or nonparametric tests (Mann–Whitney and Kruskal–Wallis tests). All the experimental results were analysed using the 1-way analysis of variance and Tukey’s post-hoc test. The 2-tailed student’s t-test was used to compare 2 data points. The survival curves were calculated by the Kaplan-Meier method, and the differences between curves were analysed by the log-rank test. Multivariate analysis for overall survival was performed using a Cox regression model with forward stepwise selection. The results were considered to be statistically significant if p < 0.05.

Results

Clinicopathological features and prognosis of K19-positive HCC

Out of the total 136 HCC cases, 12 K19-positive HCC cases (8.8%) were examined in the present study (Fig. 1a). Results of an analysis of the relationship between K19 expression and various clinicopathological parameters are summarized in Table 3. K19-positive HCC predominantly occurred in young, female patients. K19-positive HCC was also associated with TNM stage, tumour differentiation (Fig. 1b), major vascular invasion, tumour-capsule formation as well as tumour necrosis. Early recurrence (within 6 months after surgery) frequently occurred in K19-positive cases. The percentages of extrahepatic recurrence were 41.7 and 10.5% in K19-positive and K19-negative cases, respectively (p = 0.002). Among the organs, metastasis to lung was most frequently observed in this study (p = 0.003). There was no significant difference between K19 expression and HBV or HCV infection. The non-HBV/non-HCV group and other pathological parameters such as microvascular invasion and fibrous stroma were not statistically correlated with K19 expression.
Table 3
Comparison of clinicopathologic features between K19-positive and K19- negative HCC (n = 136 cases)
Features
K19-positive group [n = 12 (8.8%)]
K19-negative group [n = 124 (91.2%)]
P value
Age (years, mean ± SD)
60.1 ± 16.4
69.7 ± 9.32
0.002
Gender (male:female) (male%)
5:7 (41.7)
98:26 (79.0)
0.004
Infection
 HBV (%)
4 (33.3)
29 (23.4)
0.443
 HCV (%)
4 (33.3)
58 (46.8)
0.372
 Non-HBV, non- HCV (%)
4 (33.3)
39 (31.5)
0.894
Cirrhosis (%)
3 (25.0)
40 (32.3)
0.606
Tumour size (mm, mean ± SD)
42.2 ± 33.3
37.0 ± 24.8
0.505
Multiple tumours (%)
2 (16.7)
14 (11.3)
0.581
TNM stage
  
<0.001
 I-II (%)
4 (33.3)
63 (50.8)
 
 III-IV (%)
8 (66.6)
61 (49.2)
 
Differentiation
  
<0.001
 Well (%)
0 (0)
33 (26.6)
 
 Moderate (%)
7 (58.3)
84 (67.7)
 
 Poor (%)
5 (41.7)
7 (5.6)
 
Major vascular invasion (%)
3 (25.0)
3 (2.4)
<0.001
Microvascular invasion (%)
10 (83.3)
68 (54.8)
0.063
Tumour-capsule formation (%)
5 (41.7)
98 (79.0)
0.004
Fibrous stroma (%)
5 (41.7)
41 (33.1)
0.575
Necrosis (%)
9 (75.0)
34 (27.4)
<0.001
Recurrence (%)
5 (41.7)
54 (43.5)
0.977
Early recurrencea (%)
5 (41.7)
16 (12.9)
0.005
Extrahepatic recurrence (%)
5 (41.7)
13 (10.5)
0.002
Lung (%)
4 (33.3)
9 (7.3)
0.003
Bone (%)
1 (8.3)
2 (1.6)
0.130
Lymph nodes (%)
1 (8.3)
3 (2.4)
0.247
Adrenal gland (%)
0(0)
1 (0.8)
0.755
aEarly recurrence within 6 months after surgery
Survival analysis demonstrated that patients with K19-positive HCC had significantly poorer overall survival than did patients with K19-negative HCC (p < 0.01) (Fig. 1c). In contrast, there was no significant difference in disease-free survival (p = 0.573) unless the data were analysed during an early phase (Fig. 1d). The multivariate analysis demonstrated that tumour size and necrosis were independent predictors of overall survival, but this was not the case with K19 expression (Additional file 2: Table S1).

Induction of senescence and apoptosis by K19 knockdown

In the current study, we used three human HCC cell lines, HepG2, PLC/PRF/5, and HuH-7, which express K19 strongly, as determined by real-time PCR (Fig. 2a). K19 expression was successfully suppressed by transfection with K19 siRNA, followed by 72-h incubation (Fig. 2b). As shown in Fig. 2c, cell growth was significantly suppressed by K19 knockdown in PLC/PRF/5 and HuH-7 cells but not in HepG2 cells. When PLC/PRF/5 cells were transfected with K19 siRNA, senescence was induced, as assessed by SA-β-gal assay (Fig. 3d). Furthermore, K19 silencing upregulated mRNA levels of senescence-related genes such as p16 and p27 in PLC/PRF/5 cells (Fig. 3e). In LBC of HuH-7 cells, the number of apoptotic cells increased following K19 knockdown (Fig. 3f). Considered together, it appears that K19 knockdown induced apoptosis in HuH-7 cells and senescence in PLC/PRF/5 cells through the upregulation of p16 and p27 genes.

K19 knockdown increased E-cadherin gene expression, and inhibited cancer invasion and angiogenesis

As stated above, cell growth was not significantly affected by K19 siRNA transfection of HepG2 cells. In the light of this result, we examined the effect of K19 knockdown on cancer invasion and angiogenesis. Figure 3a and c indicate that E-cadherin gene expression and matrigel invasion capacity of HepG2 cells increased and decreased, respectively, following K19 silencing. This suggests that K19 could enhance cancer invasion through decreased E-cadherin gene expression in HCC cells. Gene expression levels of Vimentin, N-cadherin, and snail were not affected by K19 knockdown (Fig. 3a). The expression of the angiogenesis-related genes VASH1 and FGFR1 decreased, while that of VASH2 increased following K19 knockdown in HepG2 cells (Fig. 3b). However, immunohistochemical analysis of HCC specimens indicated that VASH1 is strongly expressed not only in K19-positive HCC cells, but also in K19-negative HCC cells. VASH1 expression in HCC was not statistically correlated with K19 expression. Finally, we examined the E-cadherin expression and the HCC proliferative activity in both K19-positive and K19-negative areas using human K19-positive HCC specimens. Double immunohistochemical staining clearly showed that the percentages of cells positive for E-cadherin were 27.2% in K19-positive areas and 61.7% in K19-negative areas (p < 0.01) (Fig. 4a). In contrast, the Ki-67 proliferative index was higher in the K19-positive areas than in K19-negative areas (Fig. 4b). The Ki-67 proliferative index in the K19-negative area was similar to that observed in the K19-negative HCC specimens. Furthermore, the number of blood vessels around cancer foci was significantly higher in K19-positive HCC specimens than in K19-negative HCC specimens (Fig. 4c). These pathological data were thus in agreement with the results from the in vitro experiments.

Discussion

In the current study, we demonstrated that K19 promoted HCC invasion, proliferation, and angiogenesis, using in vitro experiments and immunohistochemistry. Survival analysis revealed that patients with K19-positive HCC had significantly poorer overall survival than did patients with K19-negative HCC, although K19 expression was not an independent predictor in the multivariate analysis for overall survival. In previous reports, K19-positive HCC demonstrated higher invasiveness, greater metastatic potential, and poorer prognosis than did conventional HCC. Moreover, K19-positive HCC specimens examined had greater vessel invasion, poor differentiation, greater infiltrative growth, and more extrahepatic metastasis than did K19-negative HCC specimens [5, 8]. Although these pathological characteristics are well documented, the biological mechanisms involved in the aggressive behaviour of K19-positive HCC remain unclear.
The keratins, which are intermediate filament proteins, play several important roles within the cell. For instance, they maintain the mechanical stability and integrity of epithelial cells, as well as participate in several intracellular signalling pathways involved in coping with cell stress [18]. K19 is the smallest keratin, as it lacks the non-α-helical tail domain, which is typical of all other keratins [19]. This protein also appears functionally dispensable because K19 knockout mice were viable, fertile, and appear normal [20]. In the present study, K19 enhanced cancer invasion by decreasing E-cadherin expression, and promoted cell survival by suppressing the induction of senescence and apoptosis in HCC cells. However, the effects of K19 were not the same across all three cell lines used in this study, which may be due to differences in the roles of K19, such as in cellular differentiation, in the biological subtypes.
Ozturk et al. [21] reported that HCC cells bypass the senescence barrier by inactivating major senescence-related genes such as p53, p16 INK4a and p15 INK4 . p16 is well known to induce cell quiescence, which is tightly associated with cell differentiation. Thus, K19 could inhibit HCC cell differentiation by regulating p16. Apoptosis was induced by K19 knockdown in vitro; however, the TUNEL assay did not indicate a significant difference in apoptosis induction between K19-positive and K19-negative HCC areas. The percentage of Ki-67-positive cells was statistically higher in K19-positive HCC areas than in K19-negative areas. Considered together with the in vitro data, K19 appears to promote HCC cell proliferation, and its suppression effectively inhibits tumour growth via induction of cytotoxicity.
Recently, Govaere et al. [11] reported for the first time that K19 knockdown in HCC cell line resulted in reduced invasive ability. We found that K19 promotes cancer invasion in HepG2 cells through the downregulation of E-cadherin gene expression. Gene expression of snail, N-cadherin, and vimentin was not affected by K19 knockdown. Kim et al. [8] reported that K19-positive HCC was not associated with loss of E-cadherin expression in tissue microarray study. Using double immunostaining of K19 and E-cadherin, we clearly showed that the percentage of cells positive for E-cadherin in K19-positive areas was lower than that in K19-negative areas of K19-positive HCC specimens. Decreased E-cadherin expression was also shown in invasive lobular carcinoma of the breast. In this case, E-cadherin downregulation is caused by promoter methylation, mutations, or loss of heterozygosity (LOH) [22]. The mechanism underlying the decrease in E-cadherin expression in K19-positive HCC should be one of the goals of future investigations.
We showed here that K19 upregulated FGFR1 and VASH1 and downregulated VASH2 in HCC cells. Moreover, immunochemical analysis showed increased blood vessels in K19-positive HCC. FGFR1 is a receptor tyrosine kinase that activates endothelial-cell proliferation and migration [23]. Thus, it is expected that FGFR1 could be a useful therapeutic target [24]. Recent investigations focused on the roles of VASH1 and VASH2 as new regulators in angiogenesis. VASH1 is a negative feedback regulator of angiogenesis, whereas VASH2 promotes angiogenesis [25, 26]. Several studies have shown that VASH1 expression in HCC is associated with vascular invasion and poor prognosis [27, 28]. VASH may have different functions in HCC, and it is necessary to analyse its organ-specific functions. Immunohistochemical analysis of HCC specimens indicated that VASH1 is strongly expressed not only in K19-positive but also in K19-negative HCC cells. We have not excluded the possibility that K19 might control other signals of VASH1-dependent angiogenesis in HCCs. K19 may enhance tumour angiogenesis by regulating FGFR1, VASH1, and VASH2 in HCC. Yoneda et al. [3] reported that epidermal growth factor (EGF) promoted growth and invasiveness in HCC, which was accompanied by increased K19 expression. EGF might be associated with tumour growth and invasion as a molecule downstream of K19.

Conclusions

Our findings clearly indicate that K19 has a direct role in promoting HCC cell survival and invasion by inhibiting senescence and apoptosis and downregulating E-cadherin gene expression, respectively. In addition, K19 enhanced angiogenesis by affecting the expression of angiogenesis-related genes such as VASH1, VASH2, and FGFR1. Thus, K19 directly promotes cancer cell survival, invasion, and angiogenesis. K19 could be a new target molecule for the development of therapies against K19-positive HCC.

Acknowledgement

We express our deep appreciation to Ms. Aya Asano for excellent technical assistance.

Funding

This study financially supported by funds from the Department of Diagnostic Pathology, Nara Medical University.

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article. Any request of data and material may be sent to the corresponding author.

Authors’contributions

MT designed the study with KS, TF, AN, NK and CO. MT, KS and TF also cultured cells, collected date, and drafted the manuscript. MT and AN participated in pathological diagnosis, and statistical analysis. YN obtained informed consent from patients and collected tissue samples with assistance from KM and MT. MT, KS, TF and NK interpreted results and prepared the manuscript. KS, NK and CO coordinated and designed the study and critically revised the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.
Not applicable.
Written informed consent was obtained from all patients before treatment, according to our institutional guidelines. This study was approved by the Nara medical university institutional review board committee.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;11–12. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;11–12.
2.
Zurück zum Zitat Theise ND, Curado MP, Franceschi S, et al. Tumours of the liver and intrahepatic bile ducts. In: Bosman FT, Carneiro F, editors. WHO Classification of Tumours of the Digestive System. Lyon: IARC Press; 2009. p. 195–261. Theise ND, Curado MP, Franceschi S, et al. Tumours of the liver and intrahepatic bile ducts. In: Bosman FT, Carneiro F, editors. WHO Classification of Tumours of the Digestive System. Lyon: IARC Press; 2009. p. 195–261.
3.
Zurück zum Zitat Yoneda N, Sato Y, Kitao A, et al. Epidermal growth factor induces cytokeratin 19 expression accompanied by increased growth abilities in human hepatocellular carcinoma. Lab Invest. 2011;91:262–72.CrossRefPubMed Yoneda N, Sato Y, Kitao A, et al. Epidermal growth factor induces cytokeratin 19 expression accompanied by increased growth abilities in human hepatocellular carcinoma. Lab Invest. 2011;91:262–72.CrossRefPubMed
4.
Zurück zum Zitat Durnez A, Verslype C, Nevens F, et al. The clinicopathological and prognostic relevance of cytokeratin 7 and 19 expression in hepatocellular carcinoma. A possible progenitor cell origin. Histopathology. 2006;49:138–51.CrossRefPubMed Durnez A, Verslype C, Nevens F, et al. The clinicopathological and prognostic relevance of cytokeratin 7 and 19 expression in hepatocellular carcinoma. A possible progenitor cell origin. Histopathology. 2006;49:138–51.CrossRefPubMed
5.
Zurück zum Zitat Uenishi T, Kubo S, Yamamoto T, et al. Cytokeratin 19 expression in hepatocellular carcinoma predicts early postoperative recurrence. Cancer Sci. 2003;94:851–77.CrossRefPubMed Uenishi T, Kubo S, Yamamoto T, et al. Cytokeratin 19 expression in hepatocellular carcinoma predicts early postoperative recurrence. Cancer Sci. 2003;94:851–77.CrossRefPubMed
6.
Zurück zum Zitat Wu PC, Fang JW, Lau VK, et al. Classification of hepatocellular carcinoma according to hepatocellular and biliary differentiation markers. Clinical and biological implications. Am J Pathol. 1996;149:1167–75.PubMedPubMedCentral Wu PC, Fang JW, Lau VK, et al. Classification of hepatocellular carcinoma according to hepatocellular and biliary differentiation markers. Clinical and biological implications. Am J Pathol. 1996;149:1167–75.PubMedPubMedCentral
7.
Zurück zum Zitat Aishima S, Nishihara Y, Kuroda Y, et al. Histologic characteristics and prognostic significance in small hepatocellular carcinoma with biliary differentiation: subdivision and comparison with ordinary hepatocellular carcinoma. Am J Surg Pathol. 2007;31:783–91.CrossRefPubMed Aishima S, Nishihara Y, Kuroda Y, et al. Histologic characteristics and prognostic significance in small hepatocellular carcinoma with biliary differentiation: subdivision and comparison with ordinary hepatocellular carcinoma. Am J Surg Pathol. 2007;31:783–91.CrossRefPubMed
8.
Zurück zum Zitat Kim H, Choi GH, Na DC, et al. Human hepatocellular carcinomas with "Stemness"-related marker expression: keratin 19 expression and a poor prognosis. Hepatology. 2011;54:1707–17.CrossRefPubMed Kim H, Choi GH, Na DC, et al. Human hepatocellular carcinomas with "Stemness"-related marker expression: keratin 19 expression and a poor prognosis. Hepatology. 2011;54:1707–17.CrossRefPubMed
9.
Zurück zum Zitat Lee CW, Kuo WL, Yu MC, et al. The expression of cytokeratin 19 in lymph nodes was a poor prognostic factor for hepatocellular carcinoma after hepatic resection. World J Surg Oncol. 2013;11:136.CrossRefPubMedPubMedCentral Lee CW, Kuo WL, Yu MC, et al. The expression of cytokeratin 19 in lymph nodes was a poor prognostic factor for hepatocellular carcinoma after hepatic resection. World J Surg Oncol. 2013;11:136.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Fatourou E, Koskinas J, Karandrea D, et al. Keratin 19 protein expression is an independent predictor of survival in human hepatocellular carcinoma. Eur J Gastroenterol Hepatol. 2015;27:1094–102.PubMed Fatourou E, Koskinas J, Karandrea D, et al. Keratin 19 protein expression is an independent predictor of survival in human hepatocellular carcinoma. Eur J Gastroenterol Hepatol. 2015;27:1094–102.PubMed
11.
Zurück zum Zitat Govaere O, Komuta M, Berkers J, et al. Keratin 19: a key role player in the invasion of human hepatocellular carcinomas. Gut. 2014;63:674–85.CrossRefPubMed Govaere O, Komuta M, Berkers J, et al. Keratin 19: a key role player in the invasion of human hepatocellular carcinomas. Gut. 2014;63:674–85.CrossRefPubMed
12.
Zurück zum Zitat Shimada K, Nakamura M, et al. Syndecan-1, a new target molecule involved in progression of androgen-independent prostate cancer. Cancer Sci. 2009;100:1248–54.CrossRefPubMed Shimada K, Nakamura M, et al. Syndecan-1, a new target molecule involved in progression of androgen-independent prostate cancer. Cancer Sci. 2009;100:1248–54.CrossRefPubMed
13.
Zurück zum Zitat Crawford M, Brawner E, Batte K, et al. MicroRNA-126 inhibits invasion in non-small cell lung carcinoma cell lines. Biochem Biophys Res Commun. 2008;373:607–12.CrossRefPubMed Crawford M, Brawner E, Batte K, et al. MicroRNA-126 inhibits invasion in non-small cell lung carcinoma cell lines. Biochem Biophys Res Commun. 2008;373:607–12.CrossRefPubMed
14.
Zurück zum Zitat Shimada K, Anai S, Marco DA, et al. Cyclooxygenase 2-dependent and independent activation of Akt through casein kinase 2a contributes to human bladder cancer cell survival. BMC Urol. 2011;11:8.CrossRefPubMedPubMedCentral Shimada K, Anai S, Marco DA, et al. Cyclooxygenase 2-dependent and independent activation of Akt through casein kinase 2a contributes to human bladder cancer cell survival. BMC Urol. 2011;11:8.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Shimada K, Nakamura M, Ishida E, et al. c-Jun NH2 terminal kinase activation and decreased expression of mitogen-activated protein kinase phosphatase-1 play important roles in invasion and angiogenesis of urothelial carcinomas. Am J Pathol. 2007;171:1003–12.CrossRefPubMedPubMedCentral Shimada K, Nakamura M, Ishida E, et al. c-Jun NH2 terminal kinase activation and decreased expression of mitogen-activated protein kinase phosphatase-1 play important roles in invasion and angiogenesis of urothelial carcinomas. Am J Pathol. 2007;171:1003–12.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Shimada K, Anai S, Fujii T, et al. Syndecan-1 (CD138) contributes to prostate cancer progression by stabilizing tumour-initiating cells. J Pathol. 2013;231:495–504.CrossRefPubMed Shimada K, Anai S, Fujii T, et al. Syndecan-1 (CD138) contributes to prostate cancer progression by stabilizing tumour-initiating cells. J Pathol. 2013;231:495–504.CrossRefPubMed
17.
Zurück zum Zitat Nakamura M, Ishida E, Shimada K, et al. Frequent HRK inactivation associated with low apoptotic index in secondary glioblastomas. Acta Neuropathol. 2005;110:402–10.CrossRefPubMed Nakamura M, Ishida E, Shimada K, et al. Frequent HRK inactivation associated with low apoptotic index in secondary glioblastomas. Acta Neuropathol. 2005;110:402–10.CrossRefPubMed
19.
Zurück zum Zitat Bader BL, Magin TM, Hatzfeld M, Franke WW. Amino acid sequence and gene organization of cytokeratin no. 19, an exceptional tail-less intermediate filament protein. EMBO J. 1986;5:1865–75.PubMedPubMedCentral Bader BL, Magin TM, Hatzfeld M, Franke WW. Amino acid sequence and gene organization of cytokeratin no. 19, an exceptional tail-less intermediate filament protein. EMBO J. 1986;5:1865–75.PubMedPubMedCentral
20.
Zurück zum Zitat Harada N, Tamai Y, Ishikawa T, et al. Intestinal polyposis in mice with a dominant stable mutation of the beta-catenin gene. EMBO J. 1999;18:5931–42.CrossRefPubMedPubMedCentral Harada N, Tamai Y, Ishikawa T, et al. Intestinal polyposis in mice with a dominant stable mutation of the beta-catenin gene. EMBO J. 1999;18:5931–42.CrossRefPubMedPubMedCentral
21.
Zurück zum Zitat Ozturk M, Arslan-Ergul A, Bagislar S, et al. Senescence and immortality in hepatocellular carcinoma. Cancer Lett. 2009;286:103–13.CrossRefPubMed Ozturk M, Arslan-Ergul A, Bagislar S, et al. Senescence and immortality in hepatocellular carcinoma. Cancer Lett. 2009;286:103–13.CrossRefPubMed
22.
Zurück zum Zitat Droufakou S, Deshmane V, Roylance R, et al. Multiple ways of silencing E-cadherin gene expression in lobular carcinoma of the breast. Int J Cancer. 2001;92:404–8.CrossRefPubMed Droufakou S, Deshmane V, Roylance R, et al. Multiple ways of silencing E-cadherin gene expression in lobular carcinoma of the breast. Int J Cancer. 2001;92:404–8.CrossRefPubMed
23.
Zurück zum Zitat Bergers G, Benjamin LE. Tumorigenesis and the angiogenic switch. Nat Rev Cancer. 2003;3:401–10.CrossRefPubMed Bergers G, Benjamin LE. Tumorigenesis and the angiogenic switch. Nat Rev Cancer. 2003;3:401–10.CrossRefPubMed
24.
Zurück zum Zitat Auguste P, Gürsel DB, Lemière S, et al. Inhibition of fibroblast growth factor/fibroblast growth factor receptor activity in glioma cells impedes tumor growth by both angiogenesis-dependent and -independent mechanisms. Cancer Res. 2001;61:1717–26.PubMed Auguste P, Gürsel DB, Lemière S, et al. Inhibition of fibroblast growth factor/fibroblast growth factor receptor activity in glioma cells impedes tumor growth by both angiogenesis-dependent and -independent mechanisms. Cancer Res. 2001;61:1717–26.PubMed
25.
Zurück zum Zitat Watanabe K, Hasegawa Y, Yamashita H, et al. Vasohibin as an endothelium-derived negative feedback regulator of angiogenesis. J Clin Invest. 2004;114:898–907.CrossRefPubMedPubMedCentral Watanabe K, Hasegawa Y, Yamashita H, et al. Vasohibin as an endothelium-derived negative feedback regulator of angiogenesis. J Clin Invest. 2004;114:898–907.CrossRefPubMedPubMedCentral
26.
Zurück zum Zitat Sato Y. The vasohibin family: a novel family for angiogenesis regulation. J Biochem. 2013;153:5–11.CrossRefPubMed Sato Y. The vasohibin family: a novel family for angiogenesis regulation. J Biochem. 2013;153:5–11.CrossRefPubMed
27.
Zurück zum Zitat Murakami K, Kasajima A, Kawagishi N, et al. The prognostic significance of vasohibin 1-associated angiogenesis in patients with hepatocellular carcinoma. Hum Pathol. 2014;45:589–97.CrossRefPubMed Murakami K, Kasajima A, Kawagishi N, et al. The prognostic significance of vasohibin 1-associated angiogenesis in patients with hepatocellular carcinoma. Hum Pathol. 2014;45:589–97.CrossRefPubMed
28.
Zurück zum Zitat Wang Q, Tian X, Zhang C, et al. Upregulation of vasohibin-1 expression with angiogenesis and poor prognosis of hepatocellular carcinoma after curative surgery. Med Oncol. 2012;29:2727–36.CrossRefPubMed Wang Q, Tian X, Zhang C, et al. Upregulation of vasohibin-1 expression with angiogenesis and poor prognosis of hepatocellular carcinoma after curative surgery. Med Oncol. 2012;29:2727–36.CrossRefPubMed
Metadaten
Titel
Keratin 19 as a key molecule in progression of human hepatocellular carcinomas through invasion and angiogenesis
verfasst von
Masato Takano
Keiji Shimada
Tomomi Fujii
Kohei Morita
Maiko Takeda
Yoshiyuki Nakajima
Akitaka Nonomura
Noboru Konishi
Chiho Obayashi
Publikationsdatum
01.12.2016
Verlag
BioMed Central
Erschienen in
BMC Cancer / Ausgabe 1/2016
Elektronische ISSN: 1471-2407
DOI
https://doi.org/10.1186/s12885-016-2949-y

Weitere Artikel der Ausgabe 1/2016

BMC Cancer 1/2016 Zur Ausgabe

Adjuvante Immuntherapie verlängert Leben bei RCC

25.04.2024 Nierenkarzinom Nachrichten

Nun gibt es auch Resultate zum Gesamtüberleben: Eine adjuvante Pembrolizumab-Therapie konnte in einer Phase-3-Studie das Leben von Menschen mit Nierenzellkarzinom deutlich verlängern. Die Sterberate war im Vergleich zu Placebo um 38% geringer.

Alectinib verbessert krankheitsfreies Überleben bei ALK-positivem NSCLC

25.04.2024 NSCLC Nachrichten

Das Risiko für Rezidiv oder Tod von Patienten und Patientinnen mit reseziertem ALK-positivem NSCLC ist unter einer adjuvanten Therapie mit dem Tyrosinkinase-Inhibitor Alectinib signifikant geringer als unter platinbasierter Chemotherapie.

Bei Senioren mit Prostatakarzinom auf Anämie achten!

24.04.2024 DGIM 2024 Nachrichten

Patienten, die zur Behandlung ihres Prostatakarzinoms eine Androgendeprivationstherapie erhalten, entwickeln nicht selten eine Anämie. Wer ältere Patienten internistisch mitbetreut, sollte auf diese Nebenwirkung achten.

ICI-Therapie in der Schwangerschaft wird gut toleriert

Müssen sich Schwangere einer Krebstherapie unterziehen, rufen Immuncheckpointinhibitoren offenbar nicht mehr unerwünschte Wirkungen hervor als andere Mittel gegen Krebs.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.